Cassava MeTGA9 gene and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a cassava MeTGA9 gene and application thereof. The nucleotide sequence of the cassava MeTGA9 gene is as shown in SEQ ID NO: 1. The cassava MeTGA9 gene is over-expressed in cassava, so that the plant height and the root length of the transgenic cassava can be remarkably reduced. The MeTGA9 gene provided by the invention has important significance in the aspects of cassava genetic improvement, cultivation of new cassava dwarf varieties, cultivation of new cassava varieties suitable for interplanting and the like, and provides valuable gene resources and theoretical basis for cultivation of new cassava varieties with excellent plant types.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to cassava MeTGA9 gene and application thereof. BACKGROUND

[0002] Cassava (Manihot esculenta Crantz) is a crop of Euphorbiaceae, and has the characteristics of high light efficiency, high starch yield, drought resistance and poor tolerance, and is known as the "king of starch". It is not only the sixth largest food crop and one of the three major potato crops in the world, but also an important industrial and bioenergy raw material.

[0003] TGA transcription factors belong to the D branch of the bZIP family, and have been widely studied and identified in the plant kingdom. The transcription factors of the family play a key role in the process of plant response to drought stress and other adverse environments, and are involved in the regulation of plant growth and development, signal transduction, hormone balance and defense against adversity and other biological processes. At present, its function has been reported in-depth in major crops such as soybean and corn. The present study aims to explore the function of the gene through experiments, and to provide valuable gene resources and theoretical basis for breeding new cassava varieties with excellent plant type. SUMMARY

[0004] The application provides cassava MeTGA9 gene and application thereof.

[0005] The technical solution of the application is implemented as follows:

[0006] The first aspect of the application provides a cassava MeTGA9 gene, and the nucleotide sequence of the cassava MeTGA9 gene is shown as SEQ ID NO: 1.

[0007] The second aspect of the application provides a protein encoded by the cassava MeTGA9 gene according to the first aspect of the application.

[0008] The third aspect of the application provides a recombinant vector containing the coding region of the cassava MeTGA9 gene according to the first aspect of the application.

[0009] The original vector of the recombinant vector can adopt a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The application does not limit this. In a specific embodiment of the application, the original vector adopts a pGAMBIA1300 expression vector, but it should be understood that the application can also adopt other plasmids or viruses, etc.

[0010] Preferably, the original vector of the recombinant vector is a pGAMBIA1300 expression vector, and the coding region of the cassava MeTGA9 gene is located between the Sal I and BamH I restriction endonuclease sites of the pGAMBIA1300 expression vector.

[0011] The fourth aspect of the present application provides a host bacterium containing the coding region of the cassava MeTGA9 gene according to the first aspect of the present application.

[0012] The fifth aspect of the present application provides an expression cassette containing the coding region of the cassava MeTGA9 gene according to the first aspect of the present application.

[0013] The sixth aspect of the present application provides the use of the cassava MeTGA9 gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in reducing the plant height of cassava and / or reducing the root length of cassava.

[0014] Further, in the above use, the cassava MeTGA9 gene is overexpressed.

[0015] The seventh aspect of the present application provides the use of the cassava MeTGA9 gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in breeding a dwarf cassava variety.

[0016] The eighth aspect of the present application provides the use of the cassava MeTGA9 gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in screening a dwarf cassava variety and / or breeding a transgenic cassava.

[0017] The ninth aspect of the present application provides a primer pair for amplifying the cassava MeTGA9 gene, comprising the following primer pair: Primer F: 5'-CT GTCGAC ATGGCGAGCCACGGGGTTGG-3' and Primer R: 5'-GT GGATCC AAAGTTTGAGAAATGATTTG -3'.

[0018] The beneficial effects of the present application are as follows:

[0019] The present research selects a TGA family gene MeTGA9 closely related to growth and development in cassava through transcriptome data analysis. Overexpression of MeTGA9 gene in cassava can affect the growth and development of cassava plants, and has a significant effect on the plant height and root development of cassava. The plant height and root length of the transgenic cassava can be significantly reduced. Since the plant height and root system are key agronomic traits that determine the yield and quality of cassava, the reduction of the plant height of cassava can improve the lodging resistance of cassava and increase the ornamental value. The reduction of the root length is conducive to interplanting with other plants. Therefore, the MeTGA9 gene has important significance for genetic improvement of cassava, breeding of new cassava varieties with dwarfing, breeding of new cassava varieties suitable for interplanting, and the like, and provides valuable gene resources and theoretical basis for breeding of new cassava varieties with excellent plant type. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0021] Figure 1 The growth of the transgenic cassava after being potted for 3 months.

[0022] Figure 2 The growth of the transgenic cassava after being transplanted to the field. DETAILED DESCRIPTION

[0023] Embodiment 1: Obtaining of cassava MeTGA9 gene

[0024] The total RNA meeting the requirements of subsequent tests was obtained by extracting RNA from the stems and leaves of the potted cassava seedlings according to the method of TIANGEN plant polysaccharide and polyphenol RNA extraction kit. The cDNA was obtained by reverse transcription according to the reverse transcription kit instruction (Fastking gDNA Dispelling RTSuperMix, TIANGEN). The obtained cDNA was used as a template, Primer F: 5'-CT GTCGAC ATGGCGAGCCACGGGGTTGG-3' and Primer R: 5'-GT GGATCCAAAGTTTGAGAAATGATTTG -3' as a primer, high-fidelity PCR amplification (PrimeSTAR Max DNA Polymerase, TAKARA) was performed, the PCR product was recovered, and after sequencing verification, the correct cassava MeTGA9 gene was obtained, and the sequence is shown in SEQ ID No: 1 (with Sal I and BamHI two restriction endonuclease enzyme cutting sites).

[0025] The PCR amplification reaction system is as follows:

[0026]

[0027] PCR amplification program:

[0028]

[0029] Example 2: Function verification of cassava MeTGA9 gene

[0030] (1) Construction of overexpression vector

[0031] The nucleotide sequence of the above-mentioned cassava MeTGA9 gene was digested with Sal I and BamH I two restriction endonucleases respectively, the target fragment and pCAMBIA1300 vector plasmid were recovered, linked, transformed and sequenced to verify the correctness, and the pGAMBIA1300-MeTGA9-35s:eGFP overexpression vector was obtained.

[0032] (2) Cassava genetic transformation

[0033] In this experiment, Agrobacterium-mediated method was used to transform pGAMBIA-MeTGA9-1300-35s:eGFP overexpression vector into cassava cultivar cv.60444 embryonic friable callus, and transgenic cassava plants were obtained.

[0034] The specific operation is as follows:

[0035] The pGAMBIA-MeTGA9-1300-35s:eGFP plasmid was transformed into Agrobacterium GV3101 competent cells by heat shock method (i.e. 100 μL competent Agrobacterium cells were taken in a pre-cooled centrifuge tube, 0.1-1 μg of plasmid DNA was added, the centrifuge tube was quickly frozen in liquid nitrogen for 5 minutes, the centrifuge tube was quickly taken out from the liquid nitrogen and immediately placed in a 37°C water bath, and heat shock for 5 minutes), the Agrobacterium was coated on solid YEP medium added with kanamycin and rifampicin antibiotics, and after the colonies grew, PCR identification was performed, the PCR positive colonies were shaken and stored for subsequent plant infection.

[0036] The embryogenic friable callus of cassava cultivar cv. 60444 was used as the recipient material, and the OD = 0.8 or so Agrobacterium liquid containing pGAMBIA-MeTGA9-1300-35s:eGFP plasmid was centrifuged to collect, washed twice with MS medium without antibiotics, suspended with the same volume of MS medium added with 200 mmol / L acetosyringone, added with a small amount of embryogenic friable callus at room temperature for 40 min, centrifuged to remove the bacterial liquid, and the callus cells were placed on MS solid medium added with 100 mmol / L acetosyringone and cultured in the dark at 22°C for 3 days. After repeatedly washing the callus cells with sterile water, the callus cells were placed on GD solid medium added with 500 mg / L carbenicillin and 5 mg / L hygromycin and cultured in the light at 26°C for 2 weeks to eliminate the cells that were not successfully transformed and induce the resistant callus; then the callus cells were transferred to embryonic induction medium added with 500 mg / L carbenicillin and 5 mg / L hygromycin to obtain the resistant transgenic plants.

[0037] (3) Result statistics

[0038] After the transgenic cassava was planted in pots for 3 months, the plant height and root length of the cassava plants were counted, and the results are shown in Tables 1 and 2 and Figures 1-2 It is shown that the plant height and root length of the transgenic cassava are significantly reduced and are significantly lower than those of the wild type.

[0039] Table 1 Comparison of plant height of cassava plants

[0040]

[0041] Table 2 Comparison of root length of cassava plants

[0042]

[0043] The above potted cassava plants were transplanted to the field on July 4, 2025, and the plant height of the cassava was measured 15 days (July 19) and 30 days (August 3) after the transplantation, and the results are shown in Figure 2 It is shown that the plant height of the transgenic cassava is significantly lower than that of the wild type after being transplanted to the field for cultivation.

[0044] The above results show that the MeTGA9 gene can affect the growth and development of cassava plants, and has a particularly significant effect on the plant height and root development of cassava.

[0045] Dwarf cassava varieties exhibit strong lodging resistance, and the MeTGA9 gene significantly reduces cassava plant height, providing a new candidate gene for breeding dwarf, lodging-resistant cassava varieties. Furthermore, with the promotion of intercropping in forests, dwarf cassava varieties are also suitable for intercropping. In this invention, the root length of MeTGA9-transgenic cassava plants is also significantly reduced, minimizing nutrient competition with other crops during intercropping or understory cultivation, making them more suitable for intercropping with other plants. Therefore, this invention provides valuable genetic resources for breeding new cassava varieties with excellent plant architecture.

[0046] The specific embodiments of the present invention have been described in detail above, but they are merely examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. The application of the cassava MeTGA9 gene, or the protein encoded by the cassava MeTGA9 gene, or a recombinant vector, host bacterium, or expression cassava containing the coding region of the cassava MeTGA9 gene, in reducing cassava plant height and / or reducing cassava root length; the nucleotide sequence of the cassava MeTGA9 gene is shown in SEQ ID NO:

1.

2. The application of the cassava MeTGA9 gene, or the protein encoded by the cassava MeTGA9 gene, or a recombinant vector, host bacterium, or expression cassette containing the coding region of the cassava MeTGA9 gene in the breeding of dwarf cassava varieties; the nucleotide sequence of the cassava MeTGA9 gene is shown in SEQ ID NO:

1.

3. The application as described in claim 1 or 2, characterized in that, The cassava MeTGA9 gene of claim 1 is overexpressed in cassava.

4. The application as described in claim 1 or 2, characterized in that, The original vector of the recombinant vector is the pGAMBIA1300 expression vector, and the coding region of the cassava MeTGA9 gene is located between the Sal I and BamHI restriction endonuclease sites of the pGAMBIA1300 expression vector.

5. The application of the cassava MeTGA9 gene, or the protein encoded by the cassava MeTGA9 gene, or a recombinant vector, host bacterium, or expression cassette containing the coding region of the cassava MeTGA9 gene, in screening dwarf cassava varieties and / or breeding transgenic cassava; the nucleotide sequence of the cassava MeTGA9 gene is shown in SEQ ID NO:

1.

6. The application as described in claim 5, characterized in that, The original vector of the recombinant vector is the pGAMBIA1300 expression vector, and the coding region of the cassava MeTGA9 gene is located between the Sal I and BamHI restriction endonuclease sites of the pGAMBIA1300 expression vector.

7. Primer pairs for amplifying the cassava MeTGA9 gene, characterized in that, Including the following primer pair: Primer F: 5'-CT GTCGAC ATGGCGAGCCACGGGGTTGG-3' and Primer R: 5'-GT GGATCC AAAGTTTGAGAAATGATTTG -3'; The nucleotide sequence of the cassava MeTGA9 gene is shown in SEQ ID NO:1.

Images