Application of SibZIP11 gene in regulation and control of drought tolerance of millet

Abstract

The invention relates to the technical field of agriculture and genetic engineering, and particularly discloses application of a SibZIP11 gene in regulation and control of drought tolerance of millet, and the nucleotide sequence of the SibZIP11 gene is shown as SEQ ID NO.1. The invention further discloses a preparation method of the SibZIP11 gene. According to the invention, the transgenic millet strain is constructed by knocking out the millet SibZIP11 gene, so that the drought tolerance of millet is enhanced.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agriculture and genetic engineering technology, in particular to SibZIP11 application of a gene in regulating drought tolerance of foxtail millet. BACKGROUND

[0002] Foxtail millet (Setaria italica), also known as millet, broomcorn millet and dogtail millet, is an ancient cultivated cereal of the genus Setaria. Drought problem poses a major threat to agricultural production. Foxtail millet is a crop with strong drought tolerance, and research on its drought tolerance is helpful for breeding more drought-tolerant varieties and ensuring grain yield under drought conditions.

[0003] Drought stress is one of the main abiotic stresses, which damages plant growth and development and affects crop yield and quality. Plant response to drought stress is a very complex biological process involving the regulation of multiple complex molecular signaling pathways, and transcription factors play a key role in these regulatory networks. It is of great significance to explore the regulatory role of existing transcription factors in drought tolerance of foxtail millet for breeding drought-tolerant foxtail millet varieties. SUMMARY

[0004] To develop a way to regulate drought tolerance of foxtail millet, the present application provides SibZIP11 application of a gene in regulating drought tolerance of foxtail millet. The present application enhances drought tolerance of foxtail millet by knocking out the gene SibZIP11 SibZIP11 in foxtail millet.

[0005] The present application provides SibZIP11 application of a gene in regulating drought tolerance of foxtail millet, wherein SibZIP11 the nucleotide sequence of the gene is shown as SEQ ID NO. 1.

[0006] Further, the gene SibZIP11 SibZIP11 enhances drought tolerance of foxtail millet by knocking out the gene.

[0007] Further, SibZIP11 the knockout target of the gene is Target1 shown as SEQ ID NO. 1 and / or Target2 shown as SEQ ID NO. 2.

[0008] The present application also provides a SibZIP11 knockout vector, wherein the SibZIP11 gene is a target gene.

[0009] The present application also provides a method for constructing the SibZIP11 knockout vector, comprising the following steps: The nucleotide fragment shown in SEQ ID NO. 8 is connected with pHUE411 plasmid, and the obtained connection product is transformed into E. coli competence, and then a SibZIP11 knockout vector is extracted by plasmid.

[0010] The application further provides a recombinant Agrobacterium, which is obtained by transforming the SibZIP11 knockout vector into Agrobacterium.

[0011] Further, the Agrobacterium is Agrobacterium EHA105.

[0012] The application further provides a method for enhancing drought resistance of millet, comprising the following steps: The recombinant Agrobacterium is used to infect millet callus, and drought-resistant millet transgenic plants are obtained after culture.

[0013] Compared with the prior art, the application has the beneficial effects that: The application clones a bZIP transcriptional regulatory factor SibZIP11 from millet cDNA by using transcriptome data, and the gene has a conserved basic leucine zipper motif (bZIP). A knockout vector is constructed, Agrobacterium transformation is used to transform millet callus, and millet regenerated seedlings are obtained after hygromycin screening. The mutant plants are identified by PCR amplification of the mutation site and sequencing analysis, and two independent SibZIP11 edited homozygous lines are obtained. The knockout line of the gene has stronger drought resistance compared with the wild-type millet. This shows that the SibZIP11 gene has a negative regulatory effect on drought stress, and the knockout line has enhanced drought stress tolerance, which has important significance and application value. BRIEF DESCRIPTION OF DRAWINGS

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description only some embodiments of the application, and for those skilled in the art, other drawings can be obtained without creative labor on the basis of these drawings.

[0015] Figure 1 For the application SibZIP11 The schematic diagram of gene knockout site construction, Target1 and Target2 are editing sites designed according to SibZIP11 Gene sequence.

[0016] Figure 2 For SibZIP11The identification results of the KO2-1-3 and KO4-1-3 strains obtained after gene knockout are as follows: WT (846bp) is the wild-type original sequence; KO2-1-3 is the strain with two bases deleted at Target 1 site and one T base inserted at Target 2 site; KO4-1-3 is the strain with one T base inserted at Target 2 site.

[0017] Figure 3 for SibZIP11 A schematic diagram of the changes in amino acid sequence after gene knockout.

[0018] Figure 4 The results are for drought treatment of wild-type and transgenic lines; WT is wild-type material, and KO2-1-3 and KO4-1-3 are two knockout lines of SibZIP11.

[0019] Figure 5 Wild-type materials after drought treatment and rehydration SibZIP11 Survival statistics of two gene knockout millet lines: WT represents the survival rate of wild-type material, and KO represents the survival rate of two lines, KO2-1-3 and KO4-1-3. Detailed Implementation

[0020] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0021] Example 1: SibZIP11 Application of genes in regulating drought resistance in millet.

[0022] I. Transcription factors related to drought resistance in millet SibZIP11 Gene sequence analysis This invention clones a bZIP-like transcriptional regulator from millet cDNA using transcriptome data. SibZIP11 The SibZIP11 The nucleotide sequence of the gene is shown in SEQ ID NO.1. The gene contains a conserved leucine zipper motif (bZIP).

[0023] SEQ ID NO.1:

[0024] II. Knockout Vector Construction 1. Primer design SibZIP11 Gene knockout site construction, such as Figure 1 As shown. Design two. SibZIP11 Gene knockout targets Target1 and Target2. SibZIP11 The sequence of gene knockout target Target1 is shown in SEQ ID NO.2, and the sequence of knockout target Target2 is shown in SEQ ID NO.3.

[0025] SEQ ID NO. 2: TCGGGACTGGATTGGTGTC.

[0026] SEQ ID NO. 3: CCGGTTACGTCCAACGGGTT.

[0027] Primers for constructing the knockout vector were designed based on gene sequences from the Millet Genome Database, including the outer primer pairs SibZIP11-MT1-BsF and SibZIP11-MT2-BsR, and the inner primer pairs SibZIP11-MT1-F0 and SibZIP11-MT2-R0.

[0028] SibZIP11-MT1-BsF: ATATATGGTCTCTGGCGTCGGGACTGGATTGGTGTCGTT (SEQ ID NO.4); SibZIP11-MT2-BsR: ATTATTGGTCTCTAAACAACCCGTTGGACGTAACCGC (SEQ ID NO.5); SibZIP11-MT1-F0: TGTCGGGACTGGATTGGTGTCGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 6); SibZIP11-MT2-R0: AACAACCCGTTGGACGTAACCGCGCTTCTTGGTGCC (SEQ ID NO. 7).

[0029] 2. SibZIP11 Amplification of gene knockout vector fragments Using pCBC-MT1T2 (#50590) plasmid as a template, the vector fragment for gene knockout was amplified using overlap extension PCR. The specific steps are as follows:

[0030] The PCR reaction system consisted of: 1 μL pCBC-MT1T2 plasmid template, 1 μL 10 μM SibZIP11-MT1-BsF primer, 1 μL 10 μM SibZIP11-MT2-BsR primer, 1 μL 0.5 μM SibZIP11-MT1-F0 primer, 1 μL 0.5 μM SibZIP11-MT2-R0 primer, 1 μL dNTPs, 1 μL high-fidelity DNA polymerase, 2 μL DNA polymerase buffer, and 11 μL sterile water.

[0031] PCR reaction program: 95℃, 3 min; 95℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 min, 35 cycles of amplification; 72℃, 5 min.

[0032] After PCR, a 964 bp fragment was obtained as the PCR product. The 964 bp PCR product was subjected to agarose gel electrophoresis, and the gel was excised and the PCR product was recovered.

[0033] The gene sequence of the PCR product is shown in SEQ ID NO.8.

[0034] SEQ ID NO.8: ATATATGGTCTCTGGCGTCGGGACTGGATTGGTGTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTTCGTTTTGCATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGCATTGAAATTTCTCCGTCTCATGTTTGCAGCGTGTTCAAAAAGTACGCAGCTGTATTTCACTTATTTACGGCGCCACATTTTCATGCCGTTTGTGCCAACTATCCCGAGCTAGTGAATACAGCTTGGCTTCACACAACACTGGTGACCCGCTGACCTGCTCGTACCTCGTACCGTCGTACGGCACAGCATTTGGAATTAAAGGGTGTGATCGATACTGCTTGCTGCTCATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTATATCTGTCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGAAATAATAATTGACAAGTAGATACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTAGGAAAAGAAAAAGCCATACGAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCGCTGCTGTGCAGCAGCACGTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAGCAGAACCAGCTTATAAGCGGAGGCGCGGCACCAAGAAGCGGTTACGTCCAACGGGTTGTTTAGAGACCAATAAT。

[0035] 3. Knockout vector construction The recovered PCR products were ligated with the pHUE411 plasmid, and the ligation system is shown in Table 1.

[0036] Table 1 Connection System The ligation system according to Table 1 was incubated at 37°C for 5 h, at 50°C for 5 min, and at 80°C for 10 min. After the reaction was completed, the ligation product was obtained and set aside for later use.

[0037] 4. Transformation of the ligation product into E. coli Add 10 μl of the ligation product to competent E. coli (DH5α) cells and incubate on ice for 30 min, then heat shock at 42°C for 30 sec. Add 1 ml of LB broth and shake at 220 rpm for 1 h at 37°C. Spread the mixture onto a substrate containing 50 mg L... −1 E. coli transformed and ligated were obtained by culturing at 37°C for 10 h on LB agar plates in Kans. The plasmid was extracted to obtain the SibZIP11 knockout vector, denoted as pHUE411-SibZIP11.

[0038] III. Transformation of millet using SibZIP11 knockout vector 1. SibZIP11 knockout vector transformed into Agrobacterium tumefaciens EHA105 Add 1 μg of the constructed SibZIP11 knockout vector to Agrobacterium EHA105 competent cells, flash freeze in liquid nitrogen for 1 min, incubate at 37°C for 5 min, add 1 mL of YEB medium, and incubate at 28°C with slow shaking for 4 h. Centrifuge at 10,000 rpm for 30 sec, discard the supernatant, resuspend the cells in 0.1 mL of YEB medium, and spread on a medium containing 100 mg L... −1 Kan and 125 mg L −1 Agrobacterium was obtained by culturing at 28°C for about 48 h on Sm YEB plates to transform the knockout vector.

[0039] 2. The EHA105 strain (Agrobacterium with the vector knocked out) transformed with the pHUE411-SibZIP11 plasmid infected millet callus tissue. (1) Pick a single colony (transformed into Agrobacterium knockout vector) into 15 ml YEB and incubate overnight at 180 rpm and 28°C. Transfer to YEB containing 200 μM AS to achieve a bacterial concentration of OD. 600 =0.6, then cultured to OD 600 =1.0;

[0040] (2) OD 600The bacterial suspension with an OD value of 1.0 was centrifuged at 3500 rpm, 4°C, for 15 min. The bacterial cells were collected and resuspended in co-culture suspension medium containing 200 μM AS. The final bacterial concentration was adjusted to OD value. 600 =0.6, to obtain an Agrobacterium suspension for infection; (3) Transfer the callus tissue into a 50 ml Erlenmeyer flask, add 20 ml of liquid co-culture medium, and incubate on ice for 20 min; (4) After the callus was placed on ice, it was transferred to Agrobacterium suspension and incubated at 100 rpm and 26°C for 30 min for infection. After infection, the callus was transferred to sterile filter paper to blot off the bacterial solution on the surface, dried for 15 min, and then transferred to a culture dish containing solid co-culture medium. The dish was incubated at 22°C in the dark for 3 days. A filter paper was placed on the surface of the medium in each culture dish to prevent Agrobacterium contamination.

[0041] (5) Transfer the callus to 150 mg L −1 Incubate on Timentin solid co-culture medium at 26°C for 7 days; (6) Then the callus tissue was transferred to a solution containing 150 mg L −1 Timentin + 30 mg L −1 Hygromicin B was cultured at 26°C for 7 days in a novel callus induction medium. (7) Callus redifferentiation and plant culture: Callus tissue was transferred to regeneration medium and kept at 26±2℃ under a 16 h photoperiod / 8 h dark period for 4 weeks. An activated carbon was placed on each medium but not in contact with the medium. The medium was changed every two weeks.

[0042] (8) Transfer the callus to a rooting medium, and after about 4 weeks, transfer it to a plastic pot for three days of cultivation; (9) Transfer the cultivated seedlings to the ground to grow and bear fruit.

[0043] The culture medium formulations used in the above steps are as follows: Callus induction medium: MS salt, 1 mg / L −1 D-Biotin, 0.5 mg L −1 Vitamin B6, 0.5 mg / L −1 Niacin, 50 mg / L −1 Inositol, 300 mg L −1 Acid-hydrolyzed casein, 0.1 mg / L −1 Vitamin B1, 0.6 mg / L −1 CuSO4, 30 g L −1 Sucrose, 2 mg / L −12,4-D, 0.5 mg L −1 Kinetin, 3 g / L −1 Plant-based gel, adjusted to pH 5.8, sterilized, then 2 mg L added. − 1 AgNO3, 1 mg L −1 Citric acid.

[0044] Co-culture medium: MS salt, 1 mg / L −1 Vitamin H, 0.5 mg / L −1 Vitamin B6, 0.5 mg / L −1 Niacin, 50mg / L −1 Inositol, 0.1 mg / L −1 Vitamin B1, 30 g / L −1 Sucrose, 2 mg / L −1 2,4-D, 0.5 mg L −1 Kinetin, adjust pH to 5.8, sterilize and add 200 μM L -1 Acetyleugenol, 3 g / L in solid culture medium −1 Plant gel.

[0045] Regeneration medium: MS salt, 1 mg / L −1 Vitamin H, 0.5 mg / L −1 Vitamin B6, 0.5 mg / L −1 Niacin, 300mg / L −1 Acid-hydrolyzed casein, 0.1 mg / L −1 Vitamin B1, 0.6 mg / L −1 CuSO4, 15 g L −1 Sucrose, 15 g / L −1 Glucose, 2 mg / L −1 2,4-D, 3 mg L −1 6-BA, adjust pH to 5.8, sterilize, then add 150 mg L. −1 Timentin, 8 mg / L −1 Hygromycin, 2 mg / L −1 AgNO3.

[0046] Rooting medium: ½ MS salt, 0.25 mg / L −1 Vitamin B6, 0.25 mg / L −1 Niacin, 0.05 mg / L −1 Vitamin B1, 15 g / L −1 Sucrose, 2.5 g / L −1 Plant-based gel, pH 5.8, 150 mg / L −1Timentin, 8 mg / L −1 Hygromycin, 2 mg / L −1 AgNO3.

[0047] 3. SibZIP11 Identification of homozygous knockout lines 0.5 g of leaves from the regenerated material of the flowering spike were taken, DNA was extracted, the knockout site sequence was amplified by PCR and sequenced, and the knockout plants were screened and self-pollinated before seeds were collected. The collected seeds were sown again in the experimental plot, one row (15 plants), and 0.5 g of leaves were taken from each plant, DNA was extracted, the knockout site sequence was amplified by PCR and sequenced, and two homozygous edited mutant plants with different editing modes of the knockout site were selected and named KO2-1-3 and KO4-1-3, respectively. The sequencing results are as follows. Figure 3 As shown, KO2-1-3 has a two-base deletion at Target1 and a one-base T insertion at Target2; KO4-1-3 has a one-base T insertion at Target2. Seeds from homozygous plants were harvested for subsequent drought resistance analysis.

[0048] 4. Identification of drought resistance in SibZIP11 knockout millet Drought treatment: Wild-type millet and SibZIP11 homozygous knockout lines were planted in the substrate and allowed to grow normally for 2 weeks. Figure 4 (A), stop watering for 15 days ( Figure 4 Of the B strains, after 5 days of rehydration, most of the knockout strains remained green and continued to grow, while the wild-type materials wilted, turned yellow, and died. Figure 4 Statistical analysis of plant survival rates revealed that the survival rate of the knockout lines (combining the survival rates of KO2-1-3 and KO4-1-3 lines) was significantly higher than that of the wild type. Figure 5 The above results indicate that SibZIP11 has a negative regulatory effect on the drought resistance of millet.

[0049] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0050] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. SibZIP11 The application of genes in regulating drought resistance in millet is characterized by, The SibZIP11 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. As described in claim 1 SibZIP11 The application of genes in regulating drought resistance in millet is characterized by, Knockout through gene editing SibZIP11 Genes enhance the drought resistance of millet.

3. As described in claim 2 SibZIP11 The application of genes in regulating drought resistance in millet is characterized by, SibZIP11 The gene knockout targets are Target1 shown in SEQ ID NO.1 and / or Target2 shown in SEQ ID NO.

2.

4. A SibZIP11 knockout vector, characterized in that, As described in claim 1 SibZIP11 The gene is the target gene.

5. The method for constructing the SibZIP11 knockout vector according to claim 4, characterized in that, Includes the following steps: The nucleotide fragment shown in SEQ ID NO.8 was ligated with the pHUE411 plasmid. The ligation product was transformed into competent E. coli cells, and the plasmid was extracted to obtain the SibZIP11 knockout vector.

6. A recombinant Agrobacterium, characterized in that, The recombinant Agrobacterium was obtained by transforming Agrobacterium with the SibZIP11 knockout vector as described in claim 4.

7. The recombinant Agrobacterium according to claim 6, characterized in that, The Agrobacterium is Agrobacterium EHA105.

8. A method for enhancing the drought resistance of millet, characterized in that, Includes the following steps: The recombinant Agrobacterium as described in claim 6 was used to infect millet callus tissue, and drought-resistant transgenic millet plants were obtained after culturing.

Images