SNP (Single Nucleotide Polymorphism) molecular marker related to false smut resistance and application of SNP molecular marker
By using KASP marker technology to detect the polymorphism of SNP-2661279 in the rice genome, the problem of difficulty in identifying rice false smut resistance in existing technologies has been solved, enabling rapid and accurate resistance identification and improving breeding efficiency and planting results.
Patent Information
- Application Number
- CN202511545805.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-28
- Publication Date
- 2026-01-09
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify rice blast resistance, affecting breeding efficiency and planting results.
KASP marker technology was used to detect the polymorphism of SNP-2661279 in the rice genome using specific PCR primers, and genotypes were identified by fluorescent probes to rapidly identify rice blast resistance.
It enables rapid and accurate identification of rice blast resistance, improves breeding efficiency and planting results, and significantly accelerates the breeding process of new disease-resistant rice varieties.
Smart Images
Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This invention belongs to the field of rice molecular breeding, specifically involving SNP molecular markers related to rice false smut resistance and their applications. Background Technology
[0002] KASP (Kompetitive Allele-Specific PCR) achieves genotyping by specifically recognizing gene loci using fluorescent probes. It can be used to detect SNP and InDel sites. Compared with molecular markers such as SSR, RFLP, and InDel, KASP markers offer advantages such as rapid detection, low cost, and ease of large-scale application. KASP markers do not require genotyping based on DNA fragment size, overcoming the relatively cumbersome and low-throughput drawbacks of traditional gel electrophoresis methods, making them suitable for high-throughput molecular detection platforms.
[0003] Rice false smut is a fungal disease that affects the panicle of rice. Ustilaginoidea virens and U. albicans The process transforms rice grains into green or white blasted grains. Rice blast not only severely reduces rice yield but also affects rice quality. Breeding and cultivating rice varieties resistant to rice blast is an economical and environmentally friendly strategy. Developing molecular markers for detecting rice blast resistance is of significant application value for identifying resistant rice germplasm resources and rapidly identifying resistant plants during the breeding process. Summary of the Invention
[0004] One of the technical problems to be solved by the present invention is how to use molecular markers to identify or assist in the identification of rice false smut resistance.
[0005] To solve the above-mentioned technical problems, the present invention provides any one of the following applications A1-A3 and the method A4: A1. Application of a composition for detecting the polymorphism or genotype (i.e., allele) of SNP-2661279 in the rice genome in the identification or auxiliary identification of rice false smut resistance; wherein SNP-2661279 is an SNP site in the rice genome, its nucleotide type is A or G, using the Nipponbare genome sequence as a reference genome, wherein SNP-2661279 is located at 2661279 bp on chromosome 10 of rice, specifically nucleotide 30 of SEQ ID No. 1; the composition contains PCR primers, wherein the PCR primers are P1 or P2: P1. The PCR primers are a primer set consisting of single-stranded DNA with nucleotide sequence of SEQ ID No. 2 from position 22 to 44, single-stranded DNA with nucleotide sequence of SEQ ID No. 3 from position 22 to 44, and single-stranded DNA with nucleotide sequence of SEQ ID No. 4. P2. The PCR primers are a primer set consisting of single-stranded DNA with nucleotide sequence SEQ ID No. 2, single-stranded DNA with nucleotide sequence SEQ ID No. 3, and single-stranded DNA with nucleotide sequence SEQ ID No. 4.
[0006] A2. The application of a composition for detecting the polymorphism or genotype (i.e., allele) of SNP-2661279 in the rice genome in the preparation of products for identifying or assisting in the identification of rice false smut resistance; wherein SNP-2661279 is an SNP site in the rice genome, and its nucleotide type is A or G, and it is the 30th nucleotide of SEQ ID No. 1; wherein the composition contains the PCR primers, and the PCR primers are P1 or P2 as described above.
[0007] A3. The application of the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP-2661279 site in the rice genome in rice breeding or in the preparation of rice breeding products; the SNP-2661279 site is an SNP site in the rice genome, whose nucleotide type is A or G, and is the 30th nucleotide of SEQ ID No. 1; the composition contains the PCR primers, and the PCR primers are P1 or P2 as described above.
[0008] The purpose of the breeding program includes selecting rice varieties resistant to rice false smut.
[0009] A4. A method for identifying or assisting in the identification of rice false smut resistance, comprising detecting the genotype of the rice to be tested, and identifying or assisting in the identification of rice false smut resistance based on the genotype of the rice to be tested; wherein the genotype is the genotype of the SNP-2661279 site in the rice genome; wherein the SNP-2661279 site is an SNP site in the rice genome, the nucleotide type being A or G, and is the 30th nucleotide of SEQ ID No. 1; the detection is performed using PCR primers, wherein the PCR primers are P1 or P2 as described above.
[0010] Another technical problem that this invention aims to solve is how to conduct rice breeding.
[0011] To solve the above-mentioned technical problems, the present invention provides the following technical solution: Application of the methods described in B1 and A4 in rice breeding.
[0012] The purpose of the breeding program includes selecting rice varieties resistant to rice false smut.
[0013] B2. Rice breeding methods, including: detecting the polymorphism of the SNP-2661279 site in the rice genome A1, and selecting homozygous rice with the SNP-2661279 site A in the rice genome as parents for breeding.
[0014] The purpose of the breeding program includes selecting rice varieties resistant to rice false smut.
[0015] Any one of the following products containing a composition for detecting the polymorphism or genotype (i.e., allele) of the SNP-2661279 locus in the rice genome, 1)-3), is also within the scope of protection of this invention: 1) Products that detect single nucleotide polymorphisms or genotypes associated with rice false smut resistance; 2) Products for identifying or assisting in the identification of rice blast resistance; 3) Products used in rice breeding.
[0016] In the above applications, methods, and products, the SNP-2661279 site is an SNP site in the rice genome, and its nucleotide type is A or G, which is the 30th nucleotide of SEQ ID No. 1. The detection of the polymorphism or genotype (i.e., allele) of the SNP-2661279 site in the rice genome can specifically involve detecting the nucleotide type of the SNP-2661279 site. The genotype of the SNP-2661279 site in the rice genome can be GG, AA, or AG. GG is a homozygous type of the SNP-2661279 site in the rice genome that is G; AA is a homozygous type of the SNP-2661279 site in the rice genome that is A; and AG is a heterozygous type of the SNP-2661279 site in the rice genome that is both A and G.
[0017] In the method described in A4, the identification or auxiliary identification of rice false smut resistance based on the genotype of the rice to be tested can be that the rice to be tested with genotype AA has stronger or candidate stronger rice false smut resistance than the rice to be tested with genotype GG.
[0018] In the above applications, methods and products, the rice breeding is for cultivating rice resistant to rice false smut.
[0019] In the above applications, methods, and products, the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP-2661279 locus in the rice genome can be reagents and / or instruments required to determine the polymorphism or genotype of the SNP-2661279 locus by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.
[0020] In the above applications, methods, and products, the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP-2661279 locus in the rice genome is as follows: 1), 2), or 3). D1) The composition for detecting the polymorphism or genotype of the SNP-2661279 site in the rice genome contains PCR primers for amplifying rice genomic DNA fragments including the SNP-2661279 site. D2) The composition for detecting the polymorphism or genotype of SNP-2661279 in the rice genome is a PCR reagent containing the PCR primers described above; D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).
[0021] In the above applications, methods, and products, the PCR primers can be labeled with a marker. The marker refers to any atom or molecule that can be used to provide detectable results and can be linked to nucleic acids. Markers include, but are not limited to, dyes; radioactive markers, such as... 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moieties (positive or negative) or, optionally, charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading). The PCR primers described herein can be a primer set consisting of single-stranded DNA with nucleotide sequence SEQ ID No. 2, single-stranded DNA with nucleotide sequence SEQ ID No. 3, and single-stranded DNA with nucleotide sequence SEQ ID No. 4. SEQ ID No. 2 in the sequence listing consists of 44 nucleotides, with nucleotides 1-21 being the FAM adapter sequence (as a marker) and nucleotides 22-44 being the specific sequence; SEQ ID No. 3 in the sequence listing consists of 44 nucleotides, with nucleotides 1-21 being the HEX adapter sequence (as a marker) and nucleotides 22-44 being the specific sequence.
[0022] In the above applications, methods, and products, the product may be a reagent, kit, or system. The system may include a combination of reagents or kits, instruments, and analysis software, such as a product consisting of PCR primers, KASP HiGeno 2x Probe Mix reagent, and a real-time PCR instrument, or a combination of PCR primers, KASP HiGeno 2x Probe Mix reagent, and an ELISA reader. The product may include the above-described composition for detecting the polymorphism or genotype of SNP-2661279 in the rice genome.
[0023] In this study, the rice varieties resistant to rice false smut showed significantly higher resistance levels to the disease than those susceptible to it.
[0024] In this article, rice varieties resistant to rice false smut are specifically those with an average number of diseased grains per panicle that are artificially inoculated with less than 5.0.
[0025] In this article, rice varieties susceptible to rice false smut are those with an average number of diseased grains per panicle greater than 15.0 when artificially inoculated.
[0026] The artificial inoculation method is injection inoculation. During the 7th to 8th stage of rice panicle differentiation (i.e., 3 to 7 days before heading), the spore suspension is injected into the lower part of the rice panicle using a syringe. The inoculation amount is limited to filling the panicle with the spore suspension. The spore suspension is prepared by using potato sucrose liquid medium to a concentration of approximately 1x10⁻⁶. 6 A spore suspension of CFU / mL was used as the inoculum. The spore germination rate needed to reach 95%.
[0027] The rice false smut pathogen used in the artificial inoculation is... U. albicans Strain UA25.
[0028] For details on the strains, please refer to the following URL: https: / / www.ncbi.nlm.nih.gov / biosample?Db=biosample&DbFrom=bioproject&Cmd=Link&LinkName=bioproject_biosample&LinkReadableName=BioSample&ordinalpos=1&IdsFromResult=910162.
[0029] The rice varieties mentioned above can be any one of the following rice materials: FAISCA::GERVEX900-C1, GLADIO::GERVEX 1652-C1, HAREM::GERVEX 929-C1, ITALPATNA 48::GERVEX 60-C1, LOMELLINO::GERVEX 83-C1, LOTO::GERVEX 104-C1, LUSITO IRRADIADO 859-85-2::GERVEX 1676-C1, MELAS::GERVEX 1684-C1, MERLE::GERVEX 1685-C1, MESTRE::GERVEX1082-C1, OEIRAS::IRGC 286-1, OWARI MOCHI::IRGC 74513-1, VEGOLD::IRGC 7756-1, IRGA411-1-6-1F-A::IRGC 117344-1, Xugunuo, Jiienuo, Aimakang, Liaogeng 287, Dangyu 5, 76--1, G Zhenshan 97B, Diangeng, Huangsizhan, Molizhanxuan, 531::IRGC 82643-1, AC74::IRGC 33967-1, B 3913 B 16-20 ST 28::IRGC 63099-1, LIU TIAO XIAN::IRGC72758-1.
[0030] The rice varieties mentioned above are offspring obtained from any one or two of the following rice materials as parents: FAISCA::GERVEX 900-C1, GLADIO::GERVEX 1652-C1, HAREM::GERVEX 929-C1, ITALPATNA48::GERVEX 60-C1, LOMELLINO::GERVEX 83-C1, LOTO::GERVEX 104-C1, LUSITO IRRADIADO859-85-2::GERVEX 1676-C1, MELAS::GERVEX 1684-C1, MERLE::GERVEX 1685-C1, MESTRE::GERVEX 1082-C1, OEIRAS::IRGC 286-1, OWARI MOCHI::IRGC 74513-1, VEGOLD::IRGC7756-1, IRGA 411-1-6-1F-A::IRGC 117344-1, Xugunuo, Jiienuo, Aimakang, Liaogeng287, Dangyu 5, 76--1, G Zhenshan 97B, Diangeng, Huangsizhan, Molizhanxuan, 531::IRGC82643-1, AC 74::IRGC 33967-1, B 3913 B 16-20 ST 28::IRGC 63099-1, LIU TIAOXIAN::IRGC 72758-1.
[0031] This invention discloses a novel KASP marker for detecting rice false smut resistance. The specific primer set provided by this invention consists of single-stranded DNA as shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4, wherein the single-stranded DNA shown in SEQ ID No. 2 and SEQ ID No. 3 carries fluorescently labeled adapters. In one embodiment of this invention, the primer set with fluorescently labeled adapters is used to amplify rice genomic DNA from two groups of multiple samples, including the SNP-2661279 site. Fluorescence signal processing is performed to determine the nucleotide type of the SNP-2661279 site, and the rice false smut resistance of each sample is measured. Experiments showed that in a population of 34 rice materials, the average number of diseased grains per panicle was significantly lower in homozygous rice materials with SNP-2661279 at locus A than in homozygous rice materials with SNP-2661279 at locus G. This indicates that the homozygous rice varieties with SNP-2661279 at locus A exhibit significantly stronger resistance to rice false smut than those with SNP-2661279 at locus G. This demonstrates that SNP-2661279 is a molecular marker associated with rice false smut resistance. The specific primer set provided in this invention can be used to identify or assist in the identification of rice false smut resistance, to screen for rice false smut-resistant varieties, to assist in rice marker-assisted breeding, and to breed and cultivate rice resistant to rice false smut. The polymorphism of SNP-2661279 is directly expressed in DNA form and can be detected in all tissues and developmental stages of rice. This facilitates convenient and rapid prediction of rice false smut resistance and enables the rapid screening of rice varieties (germplasm) with strong resistance to false smut, thereby accelerating the breeding process of new disease-resistant rice varieties. In practical applications, to improve accuracy, substances detecting the SNP-2661279 polymorphism and genotype can be combined with other substances (such as substances detecting other single nucleotide polymorphisms or genotypes related to rice false smut resistance) to prepare products for identifying rice varieties resistant to false smut. This invention has significant theoretical and economic value for using molecular markers to assist in the selection of disease-resistant rice varieties. Attached Figure Description
[0032] Figure 1 The image shows the genotype detection results. AA represents rice materials with the genotype AA at the SNP-2661279 locus, GG represents rice materials with the genotype GG at the SNP-2661279 locus, and NTC is a blank control in the reaction system without template DNA. Detailed Implementation
[0033] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0034] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0035] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0036] The 340 rice materials in the following examples have all been disclosed in the reference: Wang W, Mauleon R, Hu Z, et al. Genomic variation in 3010 diverse accessions of Asian cultivated rice, Nature, 2018, 557 (7703): 43-49. The public can obtain these biological materials from the applicant, and these biological materials are only used to repeat the relevant experiments of the present invention.
[0037] HiGeno 2x Probe Mix: Beijing Jiacheng Biotechnology Co., Ltd., Product No.: AQP-001S.
[0038] Example 1: SNP sites and related primer design 1. 340 rice varieties described in the literature "Wang W, Mauleon R, Hu Z, et al. Genomic variation in 3010 diverse accessions of Asian cultivated rice, Nature, 2018, 557(7703): 43-49" were selected from the global core rice germplasm resources that have been sequenced (average depth 14×) as experimental materials and inoculated with rice false smut. U. albicansStrain UA25; Based on high-density SNP genotypes, genome-wide association analysis was performed on the resistance and susceptibility phenotypes of 340 rice varieties to rice false smut. Combined with linkage disequilibrium (LD) analysis, a region on chromosome 10 associated with rice false smut resistance was identified. The SNP locus within this region that was most significantly associated with rice false smut resistance was selected for further analysis. Using the Nipponbare genome sequence as a reference genome, this SNP locus is located at 2661279 bp on chromosome 10 and is designated as SNP-2661279.
[0039] SNP-2661279 is a specific SNP site in the rice genome, located at 2661279 bp on chromosome 10. It is the 30th nucleotide of SEQ ID No. 1, and its nucleotide is either A or G, represented by the letter R.
[0040] SEQ ID No. 1: 5'-ACATCTAACGGGAGAAAGGCTTTAAAATTRAATATTGAATGATTATAGAAAATTGATTTATACTGGGTAAGCATCCAATGCTTGGATCCTCACATGCAGACCTCGGA-3'.
[0041] The rice genome has three alleles: one is AA (homozygous for A at nucleotide 30 of SEQ ID No. 1); another is GG (homozygous for G at nucleotide 30 of SEQ ID No. 1); and the third is AG (heterozygous for both A and G at nucleotide 30 of SEQ ID No. 1).
[0042] Rice varieties with the genotype AA at the SNP-2661279 locus showed significantly higher resistance to rice false smut than rice varieties with the genotype GG at the SNP-2661279 locus.
[0043] 2. Convert SNP-2661279 to the KASP marker and design a primer set for detecting this marker. SNP-2661279 was converted to the KASP marker for use in marker-assisted selection breeding.
[0044] A primer set for detecting KASP markers based on KASP technology was designed, referred to as the KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C).
[0045] The nucleotide sequence of primer A is shown in SEQ ID No. 2 of the sequence listing.
[0046] SEQ ID No. 2: 5'- GAAGGTGACCAAGTTCATGCT ACGGGAGAAAGGCTTTAAAATTA-3' (Positions 1-21 are the FAM adapter sequence, indicated by underscores; positions 22-44 are the specific sequence, identical to positions 8-30 of SEQ ID No. 1, where nucleotide A is at SNP-2661279).
[0047] The nucleotide sequence of primer B is shown in SEQ ID No. 3 of the sequence listing.
[0048] SEQ ID No.3: 5'- GAAGGTCGGAGTCAACGGATT ACGGGAGAAAGGCTTTAAAATTG-3' (Positions 1-21 are the HEX adapter sequence, indicated by underscores; positions 22-44 are the specific sequence, identical to positions 8-30 of SEQ ID No. 1, where the nucleotide at SNP-2661279 is G).
[0049] The nucleotide sequence of primer C is shown in SEQ ID No. 4 of the sequence listing.
[0050] SEQ ID No.4: 5'-GAGGTCTGCATGTGAGGATC-3' (reverse complementary to the sequence from positions 85 to 104 of SEQ ID No. 1) The single-stranded DNA molecules shown in SEQ ID No. 2 (primer A) and SEQ ID No. 4 (primer C) amplify the fragment with nucleotide T at position 30 of SEQ ID No. 1. The fluorescent signal of the fluorescent group bound to the FAM sequence can be read using an ELISA reader or a real-time PCR instrument. The single-stranded DNA molecules shown in SEQ ID No. 3 (primer B) and SEQ ID No. 4 (primer C) amplify the fragment with nucleotide C at position 30 of SEQ ID No. 1. The fluorescent signal of the fluorescent group bound to the HEX sequence can be read using an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument.
[0051] Example 2: Establishment of a method for detecting rice resistance to rice false smut. 1. Genomic DNA was extracted from the leaves of the rice plants to be tested and diluted to obtain a template solution. The DNA concentration in the template solution was 30-40 ng / μL.
[0052] 2. Perform KASP genotyping.
[0053] Primer working solution: First, dilute the three primers to 100 mM with ddH2O, and then prepare the primer working solution according to the following formula: Primer A 12 μL, Primer B 12 μL, Primer C 30 μL, ddH2O 46 μL.
[0054] KASP HiGeno 2x Probe Mix is a product of Beijing Jiacheng Biotechnology Co., Ltd. (Catalog No. AQP-001S). KASP HiGeno 2x Probe Mix contains fluorescent probe A, fluorescent probe B, quencher probe A, quencher probe B, high-fidelity Taq enzyme, dNTPs, and Mg. 2+ wait.
[0055] The sequence of fluorescent probe A is 5'-GAAGGTGACCAAGTTCATGCT-3' (FAM sequence, as shown in positions 1-21 of SEQ ID No. 2).
[0056] The sequence of fluorescent probe B is 5'-GAAGGTCGGAGTCAACGGATT-3' (HEX sequence, as shown in positions 1-21 of SEQ ID No. 3).
[0057] The sequence of quenching probe A is 5'-AGCATGAACTTGGTCACCTTC-3' (the sequence for quenching FAM, as shown in SEQ ID No. 5, is inversely complementary to positions 1-21 of SEQ ID No. 2).
[0058] The sequence of quenching probe B is 5'-AATCCGTTGACTCCGACCTTC-3' (the sequence that quenches HEX, as shown in SEQ ID No. 6, is the reverse complementary sequence of positions 1-21 of SEQ ID No. 3).
[0059] The KASP reaction system consisted of 1 μL template solution, 0.14 μL primer working solution, 5 μL KASP HiGeno 2x Probe Mix, and 3.86 μL sterile ultrapure water.
[0060] KASP can be found in Analytica Jena qTOWER 3 The amplification was performed on a G IVD real-time PCR instrument using the Touch Down PCR program.
[0061] KASP's response procedure: Step 1: Pre-denaturation at 95℃ for 10 min; Step 2: 95℃ for 20s, 61℃ for 40s, 95℃ for 20s, 60.4℃ for 40s, 95℃ for 20s, 59.8℃ for 40s, 95℃ for 20s, 59.2℃ for 40s, 95℃ for 20s, 58.6℃ for 40s, 95℃ for 20s, 58℃ for 40s, 95℃ for 20s, 57.4℃ for 40s, 95℃ for 20s, 56.8℃ for 40s, 95℃ for 20s, 56.2℃ for 40s, 95℃ for 20s, 55.6℃ for 40s; Step 3: 95℃ denaturation for 20s, 55℃ annealing for 40s, 34 cycles.
[0062] The experiment also included a blank control (NTC) in the reaction system without template DNA, with three or more blank controls per plate.
[0063] 3. Perform fluorescence scanning.
[0064] After completing step 2, in Analytik Jena qTOWER 3 The G IVD real-time PCR instrument was used for fluorescence plate reading at 35℃ for 5 seconds, and a fiber optic scanning system was used to collect fluorescence signals for genotyping.
[0065] The FAM excitation wavelength is 485 nm, and the emission wavelength is 520 nm. The HEX excitation wavelength is 535 nm, and the emission wavelength is 556 nm. The system reference fluorescence ROX excitation wavelength is 575 nm, and the emission wavelength is 610 nm.
[0066] If only the FAM group shows a fluorescent signal, the genotype of the SNP site of the rice to be tested is AA (i.e., the homozygous type of SNP-2661279 in the genome is A); if only the HEX group shows a fluorescent signal, the genotype of SNP-2661279 in the rice to be tested is GG (i.e., the homozygous type of SNP-2661279 in the genome is G).
[0067] If the genotype of the rice at the SNP locus is AA, then the rice is or is a candidate for rice blast resistance. If the genotype of the rice at the SNP locus is GG, then the rice is or is a candidate for rice blast susceptibility. The rice blast resistance of the resistant rice is higher than that of the susceptible rice. Rice with the genotype AA at SNP-2661279 has higher or candidate higher resistance to rice blast than rice with the genotype GG at SNP-2661279.
[0068] Example 3: Identification of resistance to rice false smut. 1. Use rice false smut ( U. albicansStrain UA25 is described at "https: / / www.ncbi.nlm.nih.gov / biosample?Db=biosample&DbFrom=bioproject&Cmd=Link&LinkName=bioproject_biosample&LinkReadableName=BioSample&ordinalpos=1&IdsFromResult=910162". Before artificial inoculation, the *Strombus oryzae* strain, preserved at -70℃, was activated on PDA plates for one week. It was then transferred to Erlenmeyer flasks containing potato sucrose liquid medium (200g potatoes boiled for 10 minutes, filtered through gauze, 20g sucrose added to the filtrate, and distilled water added to a final volume of 1000mL, sterilized at 121℃ for 15 minutes). The flasks were placed in a shaker at 28℃ and 150 rpm for 7 days. The spore suspension was collected by filtration through two layers of gauze and diluted with sterile water to a concentration of approximately 1×10⁻⁶. 6 A spore suspension of CFU / mL was used as the inoculum. The spore germination rate needed to reach 95% or higher.
[0069] 2. From 340 rice varieties derived from core global rice germplasm resources in Example 1, 28 rice materials were selected as experimental materials. Inoculation was performed at stage 7-8 of panicle differentiation (3-7 days before heading). The spore suspension was injected into the lower part of the panicle bract using a syringe, with the inoculation amount limited to filling the bract with the spore suspension. Normal field management followed in inoculation. Three replicates were set up for each inoculated material, with 5 plants inoculated per replicate, and 3 panicles inoculated per plant.
[0070] 3. After completing step 2, the number of diseased grains in the inoculated rice panicles was investigated 25 days after inoculation. The results are shown in Table 1. Of the 28 rice materials, 13 were resistant to rice false smut (the average number of diseased grains in the artificially inoculated rice panicles was less than 5.0), and 15 were susceptible to rice false smut (the average number of diseased grains in the artificially inoculated rice panicles was greater than 15.0).
[0071] 4. Detect the genotype of the rice sample based on specific SNPs. The method is described in Example 2. The genotyping of SNP-2661279 is shown in Table 1 and... Figure 1 .
[0072] Table 1. Average number of diseased grains per panicle and genotype of SNP-2661279 locus after inoculation of rice germplasm resources with rice false smut.
[0073] The results are shown in Table 1. AA represents the genotype at SNP-2661279 in the rice material, GG represents the genotype at SNP-2661279 in the rice material, and NTC represents the blank control without template DNA added to the reaction system. The genotyping diagram is shown below. Figure 1 .
[0074] The above results indicate that the genotype of the SNP-2661279 locus in 13 rice blast-resistant accessions is AA, and the genotype of the SNP-2661279 locus in 15 rice blast-susceptible accessions is GG.
[0075] Table 2. Analysis of the relationship between SNP-2661279 genotype and rice false smut resistance.
[0076] Note: Different superscript letters in the same column indicate significant differences (P<0.05).
[0077] Table 2 shows that the average number of diseased grains per panicle in homozygous AA rice varieties was 2.4, indicating resistance to rice false smut in all AA genotypes. In contrast, the average number of diseased grains per panicle in homozygous GG rice varieties was 30.8, indicating susceptibility to the disease. There was a significant difference in the average number of diseased grains per panicle between the two genotypes.
[0078] The above results indicate that the SNP-2661279 site can rapidly and accurately identify rice false smut resistance.
[0079] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of a composition for detecting the polymorphism or genotype of SNP-2661279 in the rice genome in the identification or auxiliary identification of rice false smut resistance; characterized in that: The SNP-2661279 site is a SNP site in the rice genome, with nucleotide type A or G, and is the 30th nucleotide of SEQ ID No. 1; the composition contains PCR primers, wherein the PCR primers are P1 or P2: P1. The PCR primers are a primer set consisting of single-stranded DNA with nucleotide sequence of SEQ ID No. 2 from position 22 to 44, single-stranded DNA with nucleotide sequence of SEQ ID No. 3 from position 22 to 44, and single-stranded DNA with nucleotide sequence of SEQ ID No.
4. P2. The PCR primers are a primer set consisting of single-stranded DNA with nucleotide sequence SEQ ID No. 2, single-stranded DNA with nucleotide sequence SEQ ID No. 3, and single-stranded DNA with nucleotide sequence SEQ ID No.
4.
2. The application of a composition for detecting the polymorphism or genotype of SNP-2661279 in the rice genome in the preparation of products for identifying or assisting in the identification of rice false smut resistance; characterized in that: The SNP-2661279 is an SNP site in the rice genome, and its nucleotide type is A or G, which is the 30th nucleotide of SEQ ID No. 1; the composition contains PCR primers, and the PCR primers are P1 or P2 as described in claim 1.
3. The application of a composition for detecting the polymorphism or genotype of SNP-2661279 in the rice genome in rice breeding or in the preparation of rice breeding products, characterized in that: The SNP-2661279 is an SNP site in the rice genome, and its nucleotide type is A or G, which is the 30th nucleotide of SEQ ID No. 1; the composition contains PCR primers, and the PCR primers are P1 or P2 as described in claim 1.
4. A method for identifying or assisting in the identification of rice false smut resistance, comprising detecting the genotype of the rice to be tested, and identifying or assisting in the identification of rice false smut resistance based on the genotype of the rice to be tested; characterized in that: The genotype is the genotype of the SNP-2661279 site in the rice genome; the SNP-2661279 site is an SNP site in the rice genome, and its nucleotide type is A or G, which is the 30th nucleotide of SEQ ID No. 1; the detection is performed using PCR primers, and the PCR primers are P1 or P2 as described in claim 1.
5. The application of the method described in claim 4 in rice breeding.
6. A method for rice breeding, characterized by: The method includes: detecting the polymorphism of SNP-2661279 in the rice genome as described in claim 1, and selecting homozygous rice with SNP-2661279 site A in the rice genome as parents for breeding.
7. A product containing a composition for detecting the polymorphism or genotype of the SNP-2661279 locus as described in claim 1 in the rice genome, wherein the product is any one of 1)-3): 1) Products that detect single nucleotide polymorphisms or genotypes associated with rice false smut resistance; 2) Products for identifying or assisting in the identification of rice resistance to rice false smut; 3) Products used in rice breeding.
8. The application according to any one of claims 1-3 and 5, the method according to claim 4 or 6, or the product according to claim 7, characterized in that: The rice breeding mentioned is for the purpose of developing rice resistant to rice false smut.
9. The application according to any one of claims 1-3, 5 and 8, the method according to claim 4, 6 or 8, or the product according to claim 7 or 8, characterized in that: The composition for detecting the polymorphism or genotype of SNP-2661279 in the rice genome is as follows: D1), D2), or D3). D1) The composition for detecting the polymorphism or genotype of the SNP-2661279 site in the rice genome contains PCR primers for amplifying rice genomic DNA fragments including the SNP-2661279 site. D2) The composition for detecting the polymorphism or genotype of SNP-2661279 in the rice genome is a PCR reagent containing the PCR primers described in D1); D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).
10. The application, method, or product according to claim 9, characterized in that: The PCR primers are a primer set consisting of the single-stranded DNA shown in SEQ ID No. 1, the single-stranded DNA shown in SEQ ID No. 2, and the single-stranded DNA shown in SEQ ID No. 3.