Application of KASP molecular marker in identification of resistance to physalospora piricola of tea trees

Abstract

The invention discloses application of a KASP molecular marker in identification of resistance to physalospora piricola of tea trees, and belongs to the technical field of plant molecular biology. The invention aims to develop the KASP molecular marker closely linked with the resistance of the tea tree physalospora piricola and accelerate the process of assisted breeding of the molecular marker with the resistance of the tea tree physalospora piricola. The KASP marker for identifying the resistance to the physalospora piricola of the tea tree is Cs-KASP, and the marker is positioned to an SNP related to identification of the resistance to the physalospora piricola of the tea tree through generic genome sequence alignment. A group of KASP molecular markers closely linked with the resistance of the tea tree physalospora piricola are developed according to the SNP site. The marker can be used for genotype detection of different resistant materials of the tea tree physalospora piricola, can be used for successfully distinguishing a disease-resistant material from a disease-susceptible material, and is combined with a high-throughput genotyping detection system to quickly identify physalospora piricola-resistant germplasm resources, so that the breeding efficiency is improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant molecular biology, and particularly relates to application of a KASP molecular marker in identifying camellia sinensis resistance to cercospora leaf spot. BACKGROUND

[0002] Camellia sinensis belongs to Theaceae and is a perennial evergreen woody plant, which has been cultivated for thousands of years in China and is an important economic tree species in China. However, it mainly grows in tropical and subtropical regions, and the warm and humid climate is conducive to the growth and reproduction of various pathogenic bacteria, which can easily lead to diseases and cause different degrees of loss to the yield and quality of tea. At present, tea breeding plays an important role in scientific research and industrial development. The genetic composition of tea is highly heterogeneous and heterozygous. It is particularly important to improve breeding efficiency through early identification and accurate selection in the early stage of disease-resistant variety breeding. Therefore, it is one of the primary tasks of breeders and researchers to identify the true disease resistance of natural populations.

[0003] Molecular marker technology is one of the important means for identifying tea germplasm resources. In recent years, with the rapid development of molecular marker technology, variety identification and seed purity identification have entered the DNA level. Because of its high accuracy, stability and repeatability, it provides more accurate and reliable results for crop variety purity analysis. SNP molecular markers, as the most mainstream third-generation molecular markers, have the characteristics of wide distribution, high polymorphism and good stability, and are considered by the International Union for the Protection of New Varieties of Plants (UPOV) as one of the effective methods for variety identification.

[0004] Kompetitive allele specific PCR (KASP) is a new high-throughput SNP genotyping technology. This technology has high accuracy, high throughput and low cost, and is currently the most ideal genotyping technology. It has been widely used in crops such as rice, wheat, corn, Chinese cabbage, melon, cucumber and grape.

[0005] In tea production, the use of pesticides is prohibited. In order to reduce yield loss, breeding of disease-resistant varieties is an economic and effective control method. The application of KASP molecular markers in tea variety breeding has the advantages of saving breeding costs, being convenient and fast, and being unaffected by the environment. It can significantly improve breeding efficiency, shorten breeding time, and reduce breeding workload. It has important significance in screening high-quality and highly resistant materials, breeding disease-resistant varieties, and promoting the progress of tea disease research. Therefore, it is of great significance to tea resistance breeding to excavate genetic genes related to tea disease resistance and develop linked KASP molecular markers. However, there is no mature KASP marker and primer for identifying tea disease resistance in the prior art.

[0006] The Chinese patent application with the publication number CN108713441A discloses a method for preventing and treating tea tree annular spot disease, which comprises the following steps: selecting a disease-resistant or disease-tolerant variety, planting, fertilizing a tea garden, pruning a tea tree, strengthening tea garden management, entering an onset period, and timely spraying 50% benomyl wettable powder 1500 times of liquid after tea picking or in the early onset period, preventing and treating once every 7-14 days, and continuously preventing and treating 2-3 times. The patent can effectively prevent and treat tea tree annular spot disease, avoid a large amount of tea leaf shedding or tea tree death, and reduce economic losses. However, the method of the patent only stays at the physical method level and does not involve the gene level, and has certain limitations, so further research and improvement are needed. SUMMARY

[0007] The technical problem to be solved by the present application is how to provide a KASP molecular marker closely linked to tea tree annular spot disease resistance and its application, so as to help the breeding, identification of annular spot disease-resistant varieties and the research of related molecular mechanisms.

[0008] The present application solves the above technical problems by the following technical means: The first aspect of the present application provides a KASP molecular marker closely linked to tea tree annular spot disease, the nucleotide sequence of which is shown in SEQ ID NO. 4, and there is a G / A mutation at the 49th base of the sequence shown in SEQ ID NO. 4.

[0009] The KASP molecular marker Cs-KASP is designed according to the single nucleotide polymorphism (SNP) site at the position of chr12: 21518769 of the 'Jinguanyin' genome.

[0010] The second aspect of the present application provides a primer set for detecting the above-mentioned KASP molecular marker, which comprises an allelic primer F1, an allelic primer F2 and a universal primer R, the nucleotide sequence of the allelic primer F1 is shown in SEQ ID NO. 1, the nucleotide sequence of the allelic primer F2 is shown in SEQ ID NO. 2, and the nucleotide sequence of the universal primer R is shown in SEQ ID NO. 3.

[0011] The third aspect of the present application provides the use of the above-mentioned primer set in the preparation of a kit for detecting the resistance of tea tree annular spot disease.

[0012] The fourth aspect of the present application provides a kit for detecting the resistance of tea tree annular spot disease, which comprises the above-mentioned primer set.

[0013] The fifth aspect of the present application provides the use of the above-mentioned KASP molecular marker, primer set and kit in identifying the resistance of tea tree annular spot disease.

[0014] The sixth aspect of this invention proposes the application of the above-mentioned KASP molecular markers, primer sets, and kits in the selection and breeding of tea tree ring spot disease resistant and / or susceptible varieties or lines.

[0015] The seventh aspect of this invention proposes the application of the above-mentioned KASP molecular markers, primer sets, and kits in the study of the molecular mechanism of resistance to tea ring spot disease.

[0016] The eighth aspect of the present invention provides a method for identifying resistance of tea plants to leaf spot disease, comprising the following steps: Using the genomic DNA of the tea plant sample to be tested as a template, the template was amplified by PCR using the above primer set or kit, and the resistance of the tea plant to leaf spot was determined by the amplification results. If the amplification result identifies the genotype as A / A, the tea plant being tested is resistant to leaf spot disease; if the amplification result identifies the genotype as G / A, the tea plant being tested is susceptible to leaf spot disease.

[0017] Preferably, the PCR amplification reaction system is as follows: 10 μL of Kaspar 2×reactionmix, 0.02 μL each of allele primer F1 and allele primer F2 at a concentration of 100 μM, 0.05 μL of universal primer R, and 1 μL of DNA.

[0018] Preferably, the PCR amplification procedure includes the following steps: Pre-denaturation at 94℃ for 15 min; Denaturation at 94℃ for 20 seconds; Annealing at 65℃-57℃ for 45 seconds; 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; Denaturation at 94℃ for 20 seconds; Annealing at 57℃ for 60 seconds, 27 cycles.

[0019] The beneficial effects of this invention are as follows: 1. This invention provides an application of KASP molecular markers in identifying resistance to tea leaf spot disease. The KASP technology, developed based on functional SNP loci, can quickly, economically, and reliably determine SNP genotypes and plays a significant role in gene mapping, molecular marker-assisted selection, and germplasm identification.

[0020] 2. The KASP marker developed and applied in this invention for identifying resistance to tea leaf spot disease is of great significance for the efficient screening and breeding of disease-resistant tea varieties. Furthermore, this invention also relates to primer pairs associated with this KASP molecular marker, and a kit containing these specific primer pairs, designed for the efficient identification of highly resistant varieties under laboratory conditions. This invention is not limited to providing these molecular markers and kits, but further elaborates on the specific application methods of these tools in the breeding process of tea leaf spot disease-resistant germplasm.

[0021] 3. Based on the provided KASP molecular markers, primer sets, and kits, this invention also details a method for identifying resistance to tea leaf spot disease. This method includes steps such as extracting DNA from tea plant samples, performing PCR amplification, and using KASP technology for genotyping analysis, thereby achieving accurate identification of tea plant resistance.

[0022] 4. The KASP genotyping technology of this invention performs precise bicelestem typing of target SNPs. Based on the developed SNP sites and designed primers, it can be used to identify the true strength of tea tree disease resistance.

[0023] 5. The KASP marker developed in this invention, which is closely linked to resistance to leaf spot disease, provides an efficient technical means for genotyping tea germplasm resources. This marker can be rapidly detected using a high-throughput genotyping system, significantly reducing the manpower and material costs of traditional identification methods. Secondly, the detection process is unaffected by environmental factors, ensuring the accuracy and reliability of the identification results. Finally, this technology enables early screening of leaf spot resistant varieties, effectively shortening the breeding cycle, greatly improving breeding efficiency, and providing an important molecular marker-assisted selection tool for disease-resistant tea breeding.

[0024] Of course, implementing any product or method of the present invention does not necessarily require achieving all of the advantages described above at the same time. Attached Figure Description

[0025] Figure 1 This is a map of SNP sites for the KASP molecular marker of tea plant in Example 1 of the present invention, where JX. Bam and DG. Bam represent the resequencing data of 'Jin Xuan' and 'Dan Gui', respectively.

[0026] Figure 2 This is a genotyping diagram of the KASP marker Cs-KASP in the natural populations of 'Jin Xuan', 'Dan Gui', 'Jin Guan Yin', and 'Gan Cha 2' in Example 2 of this invention.

[0027] Figure 3The images show the phenotypes of the susceptible tea tree materials 'Dan Gui' and 'Jin Guan Yin', and the resistant tea tree materials 'Jin Xuan' and 'Gan Cha 2', on the 7th day after they were infected with leaf spot disease in Example 2 of this invention. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0029] Unless otherwise specified, the test materials and reagents used in the following examples are commercially available or prepared by known methods.

[0030] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0031] Example 1: A KASP molecular marker and primer set for identifying resistance to tea leaf spot disease was developed using the following method: 1. Genome resequencing was performed on the highly resistant leaf spot material 'Jinxuan' and the highly susceptible leaf spot material 'Dangui' (materials were collected from the Guohe Tea Variety and Resource Nursery of Anhui Agricultural University).

[0032] Determination of core SNP sites: 'Jinxuan' and 'Dangui' were selected for resequencing. Based on the VCF files in the resequencing data, SNPs were screened using a Linux server and filtered using the vcftools command.

[0033] The specific parameters are set as follows: (1) Preserve biallelic loci (operate according to the instructions in Example 2 of CN119082360 A); (2) Set the genotype deletion rate to be less than 1; (3) Set the minimum allele frequency to less than 0.05; (4) Set the average sequencing depth to 5×.

[0034] The bcftools command was used to extract the SNP locus information for 'Jinxuan' and 'Dangui' from the filtered VCF file. The command requires outputting the chromosome name, SNP physical location, reference allele, alternative allele, and genotype. Based on the principle that there should be no other variable sites within 100 bp before and after the SNP locus, one core SNP marker was finally selected. Specific information is shown in Table 1 below. The SNP locus diagram is shown below. Figure 1 As shown.

[0035] Table 1

[0036] In this embodiment, the KASP molecular marker used to identify tea disease resistance was identified as KASP molecular marker Cs-KASP. In the above scheme, the KASP molecular marker Cs-KASP was obtained by locating a major-effect site related to tea resistance through pan-genome sequence alignment, and then searching for polymorphic SNP sites among different natural populations on the tea reference genome. This tea reference genome is based on the whole genome sequence of the tea variety 'Jin Guanyin'. The SNP site at Chr12:21518769 within this site underwent a base mutation from G to A, and a set of KASP molecular markers closely linked to tea rotation disease resistance was developed based on this site.

[0037] The nucleotide sequence of the SNP site is shown in Cs-KASP. The sequence identifier Cs-KASP and its corresponding mutation site (the 49th base is mutated from G to A) are detailed below: >Cs-KASP (Chr12:21518769): TTTTTTCATCAAATTATATAAAAAGGGAAATTTGGGATAAGATGAGATTCTTTAAAAGGATTTTGATAAAAATTTGATGAAAAGATTGG (SEQ ID NO.4) 2. Synthesis of KASP primer pair combinations Using 'Jin Guanyin' as the reference genome, the IGV software (IGV-2.11.9) was used to screen for SNP sites that showed differences between susceptible and resistant plants within the localization region. 50 bp sequences before and after each SNP site were extracted, and the SNP site sequences were compared using the Cucurbitaceae genome database alignment tool. KASP primers were designed based on the flanking sequences of the specific SNP sites.

[0038] Primer pairs for identifying the KASP molecular marker Cs-KASP resistance to tea leaf spot include allelic primer Cs-KASP-F1 as shown in SEQ ID NO.1, allelic primer Cs-KASP-F1 as shown in SEQ ID NO.2, and universal primer Cs-KASP-R as shown in SEQ ID NO.3.

[0039] (1) The sequence SEQ ID NO.1 is detailed below: 5' GAAGGTGACCAAGTTCATGCTGTGTGTGCATTAACATTGAAAAA 3'.

[0040] (2) The sequence SEQ ID NO.2 is detailed below: 5' GAAGGTCGGAGTCAACGGATTGTGTGTGCATTAACATTGAAAAC 3'.

[0041] (3) The sequence SEQ ID NO.3 is detailed below: 5' CATGTATTCTAGAATGACCGTRC 3' A kit for detecting the KASP molecular marker Cs-KASP for resistance to tea leaf spot disease, comprising the allelic primer Cs-KASP as shown in SEQ ID NO.1. F1, as shown in SEQ ID NO.2, the allelic primer Cs-KASP F1 and the universal primer Cs-KASP as shown in SEQ ID NO.3 R.

[0042] Example 2: The application of a KASP molecular marker for identifying resistance to tea leaf spot disease, wherein the KASP molecular marker described in Example 1 is applied to identify resistance, and the identification method includes the following steps: 1. Genomic DNA Extraction: Genomic DNA was extracted from 'Dan Gui', 'Jin Xuan', 'Gan Cha 2', and 'Jin Guan Yin' tea varieties collected from the Guohe Tea Variety and Resource Nursery (31°25′N, 117°09′E) of Anhui Agricultural University using a modified CTAB method. (1) Weigh 0.1 g of tea tree tissue and place it in a 2 mL centrifuge tube pre-cooled with liquid nitrogen. Use a ball mill to grind the sample (add 2 steel balls and an appropriate amount of PVPP to the centrifuge tube in advance). (2) Add 700 μL of CTAB extraction solution (preheated to 65℃) to the centrifuge tube, incubate in a 65℃ water bath for 15 min, and shake up and down 6-8 times every 5 min. (3) Add 600 μL of nucleic acid extraction solution and centrifuge at 12000 rpm for 10 min. Take 500 μL of the supernatant into a new 1.5 mL centrifuge tube, add 500 μL of isopropanol, shake gently 6-8 times, centrifuge at 12000 rpm for 5 min, and discard the supernatant. (4) Add 500 μL of 70% ethanol, mix the bottom precipitate by blowing, centrifuge at 12000 rpm for 5 min, and discard the supernatant. Repeat step (4) once. (5) Open the centrifuge tube cap and place it in a fume hood to dry the remaining ethanol. Add 100 μL of sterile water and mix well before use. 2. DNA sample detection and dilution: The quality and concentration of DNA were detected and confirmed using a NanoDrop2000 (ThermoScientific) nucleic acid analyzer, and then uniformly diluted to 20-30 ng / μL.

[0043] 3. PCR amplification: PCR amplification was performed on a BIO-RAD real-time quantitative instrument using the KASP primer pair designed in the second aspect, and the products were scanned for fluorescence signals and genotyped. (1) The PCR amplification system is as follows: Table 2: PCR reaction system

[0044] (2) PCR reaction procedure: Pre-denaturation at 94℃ for 15 min; Denaturation at 94℃ for 20 seconds; 65℃ Annealing at 57℃ for 45 seconds; 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; Denaturation at 94℃ for 20 seconds; Annealing at 57℃ for 60 seconds, 27 cycles.

[0045] (3) Fluorescence data reading and analysis After the PCR reaction, fluorescence data were read and analyzed using a BIO-RAD real-time quantitative instrument. The genotypes of resistant and susceptible plants were determined based on the typing results. (If the tea plant showed a blue or orange signal, the tea variety was homozygous; if it showed a green signal, the tea variety was heterozygous.) The A / A genotype was homozygous resistant, and the G / A genotype was heterozygous susceptible.

[0046] If a well-defined genotype cluster is not obtained after the initial KASP thermal cycling procedure, the thermal cycle should be repeated 3 times using the detailed conditions in Table 3, and then the reaction plate should be reread and the results analyzed.

[0047] Table 3 PCR amplification reaction procedure:

[0048] The results are as follows Figure 2 As shown, PCR primers designed using the SNP combination of this invention, combined with competitive allele-specific PCR (KASP), can distinguish tea trees with different genotypes. Points closer to the Y-axis represent homozygous genotypes, and points on the diagonal of the coordinate axis represent heterozygous genotypes. Disease-resistant tea tree varieties have genotypes of A / A ('Jin Xuan', 'Gan Cha 2'), while susceptible tea tree varieties have genotypes of G / A ('Dan Gui', 'Jin Guan Yin'). The phenotypic diagrams of susceptible tea tree materials 'Dan Gui' (DG) and 'Jin Guan Yin' (JGY), and disease-resistant tea tree materials 'Jin Xuan' (JX) and 'Gan Cha 2' (GC2) on day 7 after infection with ring spot disease are shown below. Figure 3 As shown.

[0049] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A KASP molecular marker closely linked to tea leaf spot disease, characterized in that, The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO. 4, and a G / A mutation exists at the 49th base of the sequence shown in SEQ ID NO.

4.

2. A primer set for detecting the above-mentioned KASP molecular marker, characterized in that, The primer set includes allele F1, allele F2, and universal primer R. The nucleotide sequence of allele F1 is shown in SEQ ID NO.1, the nucleotide sequence of allele F2 is shown in SEQ ID NO.2, and the nucleotide sequence of universal primer R is shown in SEQ ID NO.

3.

3. The application of the primer set according to claim 2 in the preparation of a kit for detecting resistance to tea leaf spot disease.

4. A kit for detecting resistance to leaf spot disease in tea trees, characterized in that, Includes the primer set as described in claim 2.

5. The application of the KASP molecular marker of claim 1, the primer set of claim 2, or the kit of claim 4 in the identification of resistance to tea leaf spot disease.

6. The application of the KASP molecular marker of claim 1, the primer set of claim 2, or the kit of claim 4 in the selection and breeding of tea tree ring spot disease resistant and / or susceptible varieties or lines.

7. The application of the KASP molecular marker of claim 1, the primer set of claim 2, or the kit of claim 4 in the study of the molecular mechanism of resistance to tea leaf spot disease.

8. A method for identifying resistance of tea plants to leaf spot disease, characterized in that, Includes the following steps: Using the genomic DNA of the tea plant sample to be tested as a template, the template was amplified by PCR using the above primer set or kit, and the resistance of the tea plant to leaf spot was determined by the amplification results. If the amplification result identifies the genotype as A / A, the tea plant being tested is resistant to leaf spot disease; if the amplification result identifies the genotype as G / A, the tea plant being tested is susceptible to leaf spot disease.

9. The method according to claim 8, characterized in that, The PCR amplification reaction system consisted of: 10 μL of Kaspar 2×reactionmix, 0.02 μL each of 100 μM allele primers F1 and F2, 0.05 μL of universal primer R, and 1 μL of DNA.

10. The method according to claim 8, characterized in that, The PCR amplification procedure includes the following steps: Pre-denaturation at 94℃ for 15 min; Denaturation at 94℃ for 20 seconds; Annealing at 65℃-57℃ for 45 seconds; 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; Denaturation at 94℃ for 20 seconds; Annealing at 57℃ for 60 seconds, 27 cycles.

Images