Method for screening of myriophyllum spicatum for improving efficiency of wetland ecological restoration, kit and application thereof
By screening Myriophyllum sp. populations using microsatellite marker technology and dual PCR reaction, the problem of uneven water purification efficiency of Myriophyllum sp. was solved, enabling rapid and accurate identification of the phylogenetic relationships of Myriophyllum sp. and improving the efficiency of wetland ecological restoration.
Patent Information
- Application Number
- CN202511843998.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-12-09
AI Technical Summary
The water purification efficiency of different populations of Myriophyllum spicatum varies greatly, resulting in uneven wetland ecological restoration efficiency and making it difficult to quickly find Myriophyllum spicatum populations with high water purification efficiency.
Five primer pairs using microsatellite marker technology were used for double PCR reaction. Combined with UPGMA cluster analysis software, the Myriophyllum populations that were closely related to the Myriophyllum population with high water purification efficiency were screened out.
Quickly and accurately identify the kinship of different Myriophyllum spicatum populations, find Myriophyllum spicatum populations with good water purification effects, improve the efficiency of wetland ecological restoration, and save about 50% of medicines and time.
Smart Images

Figure CN121294725B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of ecological restoration technology, and in particular to a method, reagent kit and application for screening Myriophyllum sp. to improve the efficiency of wetland ecological restoration. Background Technology
[0002] Myriophyllum spp., a perennial submerged plant belonging to the family Myriophyllum, has rhizomes that grow in the bottom mud. Its stems are erect and branched, its leaves are filiform and completely lobed, and its spike-like inflorescences emerge above the water surface. It reproduces rapidly through both sexual and asexual reproduction (by cutting branches or rhizomes), exhibiting strong adaptability and widespread distribution in ponds, ditches, and marshes throughout northern and southern my country. It thrives in slightly alkaline, warm, humid, and sunny environments. In winter, its above-ground parts die back, and it overwinters as a rhizome. Myriophyllum is known as a "nitrogen-removing elf" because it can simultaneously absorb nitrogen and phosphorus from the water and bottom mud through its roots, stems, and leaves. Studies have shown that its removal efficiency for ammonium nitrogen, nitrate nitrogen, and total nitrogen can reach over 90%, and its removal rate for total phosphorus can reach over 45%, effectively curbing eutrophication. After planting *Myriophyllum spicatum*, water transparency significantly improved (e.g., from 0.5 meters to 2.3 meters in the Hangzhou Bay case), dissolved oxygen concentration increased (average 9.3 mg / L), pH rose, and ammonia volatilization and phosphorus precipitation were promoted. *Myriophyllum spicatum* competitively inhibits the growth of phytoplankton (especially cyanobacteria such as *Microcystis*), reducing algal density (algal density in the remediation area is only 1 / 10 of that in the non-remediation area), while simultaneously increasing phytoplankton diversity and preventing outbreaks of single algal species. Meanwhile, in rural areas of southern China, the "Green Myriophyllum Spica Wetland Ecological Management Technology" combines straw substrate with *Myriophyllum spicatum* wetlands to treat aquaculture wastewater, farmland drainage, and domestic sewage at low cost, ensuring that effluent COD, ammonia nitrogen, and other indicators meet the national Class A standard.
[0003] Due to its strong nitrogen and phosphorus absorption capacity and ecological adaptability, *Myriophyllum spicatum* has become a "green engine" for water body restoration, especially demonstrating high efficiency and low cost advantages in the treatment of eutrophic wastewater. However, different populations of *Myriophyllum spicatum* have varying water purification efficiencies; selecting *Myriophyllum spicatum* populations with high water purification efficiency can better improve the efficiency of wetland ecological restoration. Summary of the Invention
[0004] This application provides a method, reagent kit, and application for screening Myriophyllum spicatum to improve the efficiency of wetland ecological restoration. It is a method that can quickly find Myriophyllum spicatum communities with high water purification efficiency and has great application value.
[0005] In a first aspect, this application provides a method for screening Myriophyllum sp. to improve the efficiency of wetland ecological restoration, which screens Myriophyllum sp. populations with high water purification efficiency. The method includes:
[0006] Five sets of primer pairs using microsatellite marker technology were used to analyze the genetic relationship between the identified Myriophyllum sp. population with high water purification efficiency and the Myriophyllum sp. population to be identified, in order to screen Myriophyllum sp. populations that are closely related to the high water purification efficiency population.
[0007] The microsatellite marker technology uses ten pairs of primers, which are divided into five groups for duplex PCR. The ten pairs of primers are as follows:
[0008] HWZ1-F, sequence as shown in SEQ ID No. 1; HWZ1-R, sequence as shown in SEQ ID No. 2;
[0009] HWZ2-F, sequence as shown in SEQ ID No. 3; HWZ2-R, sequence as shown in SEQ ID No. 4;
[0010] HWZ3-F, sequence as shown in SEQ ID No. 5; HWZ3-R, sequence as shown in SEQ ID No. 6;
[0011] HWZ4-F, sequence as shown in SEQ ID No. 7; HWZ4-R, sequence as shown in SEQ ID No. 8;
[0012] HWZ5-F, sequence as shown in SEQ ID No. 9; HWZ5-R, sequence as shown in SEQ ID No. 10;
[0013] HWZ6-F, sequence as shown in SEQ ID No. 11; HWZ6-R, sequence as shown in SEQ ID No. 12;
[0014] HWZ7-F, sequence as shown in SEQ ID No. 13; HWZ7-R, sequence as shown in SEQ ID No. 14;
[0015] HWZ8-F, sequence as shown in SEQ ID No. 15; HWZ8-R, sequence as shown in SEQ ID No. 16;
[0016] HWZ9-F, sequence as shown in SEQ ID No. 17; HWZ9-R, sequence as shown in SEQ ID No. 18;
[0017] HWZ10-F, sequence as shown in SEQ ID No. 19; HWZ10-R, sequence as shown in SEQ ID No. 20;
[0018] The annealing temperature for each primer pair is 56℃.
[0019] Furthermore, in the method for screening Myriophyllum sp. to improve the efficiency of wetland ecological restoration provided in this application, HWZ1 is used in combination with HWZ2; HWZ3 is used in combination with HWZ4; HWZ5 is used in combination with HWZ6; HWZ7 is used in combination with HWZ8; and HWZ9 is used in combination with HWZ10.
[0020] Secondly, this application also provides a kit comprising primers used in the Myriophyllum sp. screening method for improving wetland ecological restoration efficiency provided in the first aspect.
[0021] Thirdly, this application also provides an application of microsatellite marker primers for identifying the phylogenetic relationships of Myriophyllum spicatum populations, applying the primers used in the Myriophyllum spicatum screening method for improving wetland ecological restoration efficiency provided in the first aspect to identify the phylogenetic relationships of Myriophyllum spicatum populations.
[0022] Fourthly, this application also provides a method for identifying the phylogenetic relationships of Myriophyllum spicatum populations, comprising:
[0023] S1. Extract genomic DNA from the *Myriophyllum sp.* population identified as having high water purification efficiency and the *Myriophyllum sp.* population to be identified, respectively.
[0024] S2. Using the genomic DNA of the Myriophyllum sp. population extracted in S1 as a DNA template, and using the primer pairs divided into five groups provided in the Myriophyllum sp. screening method for improving wetland ecological restoration efficiency as described above, PCR amplification was performed to obtain the amplification product.
[0025] S3. The amplification products were subjected to electrophoresis and silver staining using polyacrylamide gel to obtain the silver staining results.
[0026] S4. Based on the silver staining results, a UPGMA cluster analysis diagram was drawn using genetic analysis software to obtain the clustering results, and the kinship of the Myriophyllum sp. population was identified and distinguished based on the clustering results.
[0027] Furthermore, in the method for identifying the phylogenetic relationships of Myriophyllum sp. populations provided in this application, the PCR amplification reaction system has a capacity of 25 μL, and the contents are as follows:
[0028] 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL each of the upstream and downstream of two pairs of primers, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water.
[0029] Furthermore, in the method for identifying the phylogenetic relationships of Myriophyllum sp. populations provided in this application, the PCR amplification reaction procedure is as follows:
[0030] Pre-denaturate at 94℃ for 3 minutes;
[0031] The process was repeated sequentially: denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 45 seconds, for a total of 35 cycles.
[0032] Extend at 72°C for 10 minutes and store at 4°C.
[0033] Furthermore, in the method for identifying the phylogenetic relationship of Myriophyllum colonies provided in this application, the amplified products are subjected to electrophoresis and silver staining using 12% polyacrylamide gel.
[0034] Furthermore, in the method for identifying the kinship of Myriophyllum sp. populations provided in this application, the genetic analysis software includes MEGA software.
[0035] This application provides a method, kit, and application for screening Myriophyllum sp. to improve the efficiency of wetland ecological restoration. It screens Myriophyllum sp. populations with high water purification efficiency and provides five primer pairs using microsatellite marker technology to analyze the genetic relationship between identified Myriophyllum sp. populations with high water purification efficiency and those yet to be identified. This allows for the screening of Myriophyllum sp. populations closely related to those with high water purification efficiency, enabling rapid assessment of phylogenetic relationships. The application also employs a dual PCR system for Myriophyllum sp. phylogenetic analysis, which significantly reduces reagent and time costs by approximately 50% compared to traditional microsatellite PCR systems for species phylogenetic analysis. Furthermore, it proposes a method for assessing the genetic relationships of Myriophyllum sp., providing technical support for analyzing relationships between Myriophyllum sp. populations in different regions and populations. This facilitates rapid and accurate identification of the phylogenetic relationships of different Myriophyllum sp. populations, enabling the assessment of their growth status and quickly identifying Myriophyllum sp. populations closely related to known high water purification efficiency. This effectively improves the efficiency of wetland ecological restoration and has high practicality and significant potential for widespread application. Attached Figure Description
[0036] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0037] Figure 1 The UPGMA clustering analysis diagram of Myriophyllum sp. provided in the embodiments of this application. Detailed Implementation
[0038] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.
[0039] It should be understood that, when used in this specification and the appended claims, the terms "comprising" and "including" indicate the presence of the described features, integrals, steps, operations, elements and / or components, but do not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components and / or collections thereof.
[0040] It should also be understood that the terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the scope of the application. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” are intended to include the plural forms unless the context clearly indicates otherwise.
[0041] It should also be further understood that the term “and / or” as used in this application specification and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.
[0042] This application provides a method for screening Myriophyllum sp. to improve the efficiency of wetland ecological restoration, which screens Myriophyllum sp. populations with high water purification efficiency. The method includes:
[0043] Five primer pairs using microsatellite marker technology were used to analyze the genetic relationship between identified Myriophyllum sp. populations with high water purification efficiency and those yet to be identified. This allowed for the screening of Myriophyllum sp. populations closely related to those with high water purification efficiency, providing technical support for analyzing relationships between Myriophyllum sp. populations in different regions. This facilitates the rapid and accurate identification of the kinship between different Myriophyllum sp. populations, enabling the assessment of their growth status and the quick identification of Myriophyllum sp. populations closely related to known high water purification efficiency. Ultimately, this can effectively improve the efficiency of wetland ecological restoration.
[0044] The microsatellite marker technology uses ten pairs of primers, which are divided into five groups for duplex PCR. The ten pairs of primers are as follows:
[0045] HWZ1-F, sequence as shown in SEQ ID No. 1; HWZ1-R, sequence as shown in SEQ ID No. 2;
[0046] HWZ2-F, sequence as shown in SEQ ID No. 3; HWZ2-R, sequence as shown in SEQ ID No. 4;
[0047] HWZ3-F, sequence as shown in SEQ ID No. 5; HWZ3-R, sequence as shown in SEQ ID No. 6;
[0048] HWZ4-F, sequence as shown in SEQ ID No. 7; HWZ4-R, sequence as shown in SEQ ID No. 8;
[0049] HWZ5-F, sequence as shown in SEQ ID No. 9; HWZ5-R, sequence as shown in SEQ ID No. 10;
[0050] HWZ6-F, sequence as shown in SEQ ID No. 11; HWZ6-R, sequence as shown in SEQ ID No. 12;
[0051] HWZ7-F, sequence as shown in SEQ ID No. 13; HWZ7-R, sequence as shown in SEQ ID No. 14;
[0052] HWZ8-F, sequence as shown in SEQ ID No. 15; HWZ8-R, sequence as shown in SEQ ID No. 16;
[0053] HWZ9-F, sequence as shown in SEQ ID No. 17; HWZ9-R, sequence as shown in SEQ ID No. 18;
[0054] HWZ10-F, sequence as shown in SEQ ID No. 19; HWZ10-R, sequence as shown in SEQ ID No. 20;
[0055] The annealing temperature for each primer pair is 56℃.
[0056] Specifically, the sequence of HWZ1-F is: TGGGATGAGTAAGATGAC, and the sequence of HWZ1-R is TATAACCGTGAAAGAAAT;
[0057] The sequence of HWZ2-F is: CACTCGCTCTACGCCCTC, and the sequence of HWZ2-R is: TATCAACAACTTCAAAAGCAATG.
[0058] The sequence of HWZ3-F is: AATCCACTGTCTCCCTCC, and the sequence of HWZ3-R is: TTTCAAACTGACACGCATAG.
[0059] The sequence of HWZ4-F is: GCTTCGTTAGCACCCTAT, and the sequence of HWZ4-F is: TCATGCGCTTCGTATTCC;
[0060] The sequence of HWZ5-F is: TGTAATGAAGGGCATGATAT, and the sequence of HWZ5-R is: TCGAGCTAGATGGAGAAAC.
[0061] The sequence of HWZ6-F is: GACTGCTGATGGTGACCCTGAT, and the sequence of HWZ6-R is: CCGACGAAGTACCTGCCTCT.
[0062] The sequence of HWZ7-F is: AGTCTAGTGGGCTTTCAGTTT, and the sequence of HWZ7-R is: AGGGAAGTCGGTGGTAGG.
[0063] The sequence of HWZ8-F is: ACCGAAGTCAGAATCAAGTCAA, and the sequence of HWZ8-R is: ATTAGGTGTTATCAACTTAGTTGGAA.
[0064] The sequence of HWZ9-F is: TCGGGAGTGAGATTGTTG, and the sequence of HWZ9-R is: GCAGTGCTGGTGTTTGTT.
[0065] The sequence of HWZ10-F is: CAGTAGCAACAACCGTGT, and the sequence of HWZ10-R is: TCTATGGCCCAATAGATAG.
[0066] Furthermore, in some embodiments, HWZ1 is used in conjunction with HWZ2; HWZ3 is used in conjunction with HWZ4; HWZ5 is used in conjunction with HWZ6; HWZ7 is used in conjunction with HWZ8; and HWZ9 is used in conjunction with HWZ10.
[0067] In some embodiments, this application also provides a kit comprising primers used in the Myriophyllum sp. screening method for improving wetland ecological restoration efficiency provided in this application. Specifically, the kit can be used for Myriophyllum sp. population genetic diversity analysis.
[0068] In some embodiments, this application also provides the application of microsatellite marker primers for identifying the phylogenetic relationships of Myriophyllum spicatum populations, applying the primers used in the Myriophyllum spicatum screening method for improving wetland ecological restoration efficiency provided in this application to identify the phylogenetic relationships of Myriophyllum spicatum populations.
[0069] In some embodiments, this application also provides a method for identifying the phylogenetic relationships of Myriophyllum spicatum populations, comprising:
[0070] S1. Extract genomic DNA from the *Myriophyllum sp.* population identified as having high water purification efficiency and the *Myriophyllum sp.* population to be identified, respectively.
[0071] S2. Using the genomic DNA of the Myriophyllum sp. population extracted in S1 as a DNA template, and using the primer pairs divided into five groups provided in the Myriophyllum sp. screening method for improving wetland ecological restoration efficiency provided in this application, PCR amplification was performed to obtain the amplification product.
[0072] S3. The amplification products were subjected to electrophoresis and silver staining using polyacrylamide gel to obtain the silver staining results.
[0073] S4. Based on the silver staining results, a UPGMA cluster analysis diagram was drawn using genetic analysis software to obtain the clustering results, and the kinship of the Myriophyllum sp. population was identified and distinguished based on the clustering results.
[0074] In some embodiments, the PCR amplification reaction system has a capacity of 25 μL, and consists of:
[0075] 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL each of the upstream and downstream of two pairs of primers, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water.
[0076] In some embodiments, the PCR amplification reaction procedure is as follows:
[0077] Pre-denaturate at 94℃ for 3 minutes;
[0078] The process was repeated sequentially: denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 45 seconds, for a total of 35 cycles.
[0079] Extend at 72°C for 10 minutes and store at 4°C.
[0080] In some embodiments, the amplified products are subjected to electrophoresis and silver staining using a 12% polyacrylamide gel.
[0081] In some embodiments, the genetic analysis software includes MEGA (Molecular Evolutionary Genetics Analysis).
[0082] In some embodiments, this application also provides a primer screening method for microsatellite markers used to identify the phylogenetic relationships of Myriophyllum sp. populations, which is used to screen out the primers provided in this application for identifying the phylogenetic relationships of Myriophyllum sp. populations. The method includes:
[0083] Provide N microsatellite sequences with repeating units of more than 2 bases to design N primer pairs; where N is greater than or equal to 10.
[0084] Based on microsatellite marker technology, the M pairs of primers were screened using genomic DNA templates from Myriophyllum sp. population samples to obtain ten pairs of primers.
[0085] In this application, before screening primers, it is necessary to select samples of Myriophyllum sp. population and extract genomic DNA from the Myriophyllum sp. population.
[0086] Specifically, in the process of selecting samples of *Myriophyllum spicatum* populations, *Myriophyllum spicatum* populations with high water purification efficiency were selected. Specifically, populations with relatively long mature individuals, vigorous growth, and rapid growth were selected as the base population (this population was assumed to be a *Myriophyllum spicatum* population with high water purification efficiency). *Myriophyllum spicatum* seedlings were selected from wetlands in different locations as *Myriophyllum spicatum* populations to be identified, and the direct phylogenetic relationship between the *Myriophyllum spicatum* populations to be identified and the base populations was detected.
[0087] During the extraction of genomic DNA from the Myriophyllum sp. population, six Myriophyllum sp. strains (samples labeled 1-6) were selected as the base population, representing individuals with relatively long mature bodies, vigorous growth, and rapid growth. Six Myriophyllum sp. strains (samples labeled 7-12) were randomly selected from Tangxun Lake in Wuhan, six Myriophyllum sp. strains (samples labeled 13-18) were randomly selected from East Lake Wetland in Wuhan, six Myriophyllum sp. strains (samples labeled 19-24) were randomly selected from Panlong Lake Wetland in Wuhan, and six Myriophyllum sp. strains (samples labeled 25-30) were randomly selected from Jinyinhu Wetland in Wuhan.
[0088] The genomic DNA of Myriophyllum sp. was extracted using the Tiangen Novel Plant Genomic DNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing). The specific procedure is as follows:
[0089] 1. Use tweezers to take about 100mg of the dry weight of the 1-30 Myriophyllum sp. sample obtained in step (1) into a 2mL centrifuge tube. To avoid cross-contamination, the tweezers used to take the plant tissue should be burned on an alcohol lamp each time. Then add two grains of quartz sand and place the tube on a shaker to grind the tissue. Grind the tissue in both directions for 1 minute until it is powdery. After centrifuging for 30s, add 500μL of buffer LP1 and 6uRNase A (10mg / mL). Vortex for 1 minute (check if it sticks to the wall; if it does, add another 100uL of buffer LP1). Dry bath at 65℃ for 10 minutes (300rpm) and then place the tube in an ice box for 2 minutes.
[0090] 2. Add 150 μL of buffer LP2, vortex for 1 min to mix thoroughly, centrifuge at 12000 rpm for 5 min, and transfer the supernatant (150 μL each time, twice) to a new 2 mL centrifuge tube;
[0091] 3. Add 450 μL of buffer LP3 (1.5 times the volume of the supernatant) and vortex for 15 seconds;
[0092] 4. Place the adsorption column CB3 into the collection tube, and pour all the contents obtained in 2.3 into the adsorption column CB3. Centrifuge at 12000 rpm for 1 min in a centrifuge, and keep the adsorption column CB3 in the collection tube.
[0093] 5. Add 600 μL of washing buffer PW to the adsorption column CB3 retained in the collection tube of 2.4 to wash the DNA, centrifuge at 12000 rpm for 1 min, and retain the adsorption column CB3 in the collection tube.
[0094] 6. Repeat the rinsing process of rinsing solution PW in step 2.5 (if the filter membrane of adsorption column CB3 is green, rinse once with 500 μL of anhydrous ethanol, and the rinsing process is the same as that of rinsing solution PW) until the filter membrane of adsorption column CB3 is colorless.
[0095] 7. After centrifuging the collection tube treated in 2.6 at 12000 rpm for 2 min, open the cap of the adsorption column CB3 and place it horizontally to air dry. It can be placed at room temperature for 30 min or in a 32℃ oven for 10 min to completely dry the residual rinsing solution in the adsorption column CB3. The best result is when the adsorption membrane is slightly wrinkled and you can hardly smell the alcohol when you get close.
[0096] 8. Collect the Myriophyllum genomic DNA from the adsorption column CB3 into centrifuge tubes using elution buffer (TE) (ensuring the pH value is within the range of 7.0-8.5), to obtain 24 Myriophyllum genomic DNA samples.
[0097] In addition, before amplification, the 30 Myriophyllum sp. genomic DNA samples obtained above need to be tested and preserved through the following steps:
[0098] A. The success of extraction was determined by 1% agarose gel electrophoresis, and the concentration was determined by micro-spectrophotometer.
[0099] B. According to the experimental requirements, the genomic DNA of Myriophyllum spicatum was diluted 5 times as a working solution and stored in a 4°C refrigerator for later use. The remaining mother solution was stored in a -20°C refrigerator for long-term preservation.
[0100] Furthermore, in the process of screening primers for microsatellite markers to identify the kinship of Myriophyllum colonies, primers can be obtained and preliminarily screened. Then, the universality of primers for polymorphic sites can be detected, followed by double PCR amplification. Finally, detection and identification can be performed, and thus 10 pairs of better primers can be screened out. At the same time, genetic structure analysis can be performed based on the results of double PCR amplification.
[0101] In the process of obtaining primers, microsatellite search software can be used to search for microsatellite fragments in the genome of Myriophyllum sp. population and the transcriptome obtained from previous sequencing. Among the fragments containing microsatellites, 500 microsatellite sequences with repeat units of more than 2 bases are selected. Microsatellite primers are designed using Primer 6 software, and a total of 500 pairs of primers are designed and sent to a primer company for synthesis.
[0102] During the initial screening of primers, six Myriophyllum colony genomic DNA templates can be randomly selected from the extracted Myriophyllum colony genomic DNA templates to conduct preliminary screening of the synthesized primers, selecting microsatellite markers with good polymorphism, few deletions, and stable amplified bands.
[0103] The PCR reaction system consisted of a 25 μL volume, comprising: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL each of the forward and reverse ends of two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water. The PCR amplification program was as follows: pre-denaturation at 94℃ for 3 minutes; followed by denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, and extension at 72℃ for 45 seconds, for a total of 35 cycles; a final extension at 72℃ for 10 minutes, followed by storage at 4℃.
[0104] During the universality detection of polymorphic sites, microsatellite markers with good polymorphism, few deletions, and stable amplified bands can be selected. Genomic DNA from 30 Myriophyllum sp. population samples was extracted and used to perform PCR amplification again on the selected microsatellite markers with good polymorphism, few deletions, and stable amplified bands. The microsatellite markers were then evaluated.
[0105] The PCR reaction system consisted of a 25 μL volume, comprising: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTPs, 3 μL of 2 mmol / L MgCl2, 1 μL each of the forward and reverse ends of two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water. The PCR amplification program was as follows: pre-denaturation at 94℃ for 3 minutes; followed by denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, and extension at 72℃ for 45 seconds, for a total of 35 cycles; a final extension at 72℃ for 10 minutes, followed by storage at 4℃.
[0106] During the duplex PCR amplification process, after amplifying the genomic DNA of 30 Myriophyllum sp. population samples, microsatellite markers that still exhibit good polymorphism, few deletions, and stability can be screened out. These markers are then randomly paired to form duplex PCR primer sets. Simultaneously, the DNA of the above 30 samples is amplified using the duplex PCR amplification system, and 18 samples are selected as having a stable duplex PCR system for microsatellite molecular markers that exhibit good polymorphism, few deletions, and stable amplified bands.
[0107] The PCR reaction system consisted of a 25 μL volume, comprising: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTPs, 3 μL of 2 mmol / L MgCl2, 1 μL each of the forward and reverse ends of two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water. The PCR amplification program was as follows: pre-denaturation at 94℃ for 3 minutes; followed by denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, and extension at 72℃ for 45 seconds, for a total of 35 cycles; a final extension at 72℃ for 10 minutes, followed by storage at 4℃.
[0108] Finally, during the detection and identification process, the PCR products of the above-mentioned Myriophyllum sp. population can be separated by electrophoresis using a 12% non-denaturing polyacrylamide gel, photographed after silver staining, and then ten pairs of better primers can be screened out. The sequences of the ten primer pairs are as follows:
[0109] HWZ1:F:TGGGATGAGTAAGATGAC
[0110] R:TATAACCGTGAAAGAAAT
[0111] HWZ2:F:CACTCGCTCTACGCCCTC
[0112] R:TATCAACAACTTCAAAAGCAATG
[0113] HWZ3:F:AATCCACTGTCTCCCTCC
[0114] R:TTTCAAACTGACACGCATAG
[0115] HWZ4:F:GCTTCGTTAGCACCCTAT
[0116] R:TCATGCGCTTCGTATTCC
[0117] HWZ5:F:TGTAATGAAGGGCATGATAT
[0118] R:TCGAGCTAGATGGAGAAAC
[0119] HWZ6:F:GACTGCTGATGGTGACCCTGAT
[0120] R:CCGACGAAGTACCTGCCTCT
[0121] HWZ7:F:AGTCAGTGGGCTTTCAGTTT
[0122] R:AGGGAAGTCGGTGGTAGG
[0123] HWZ8:F:ACCGAAGTCAGAATCAAGTCAA
[0124] R:ATTAGGTGTTATCAACTTAGTTGGAA
[0125] HWZ9:F:TCGGGAGTGAGATTGTTG
[0126] R:GCAGTGCTGGTGTTTGTT
[0127] HWZ10:F:CAGTAGCAACAACCGTGT
[0128] R:TCTAATGGCCCAATAGATAG
[0129] The annealing temperature for each primer pair is 56℃.
[0130] In this application, primer pair HWZ1 is used in combination with primer pair HWZ2, primer pair HWZ3 is used in combination with primer pair HWZ4, primer pair HWZ5 is used in combination with primer pair HWZ6, primer pair HWZ7 is used in combination with primer pair HWZ8, and primer pair HWZ9 is used in combination with primer pair HWZ10.
[0131] The microsatellite molecule M1 corresponding to primer pair HWZ1 is labeled as shown in SEQ ID No. 21, specifically:
[0132] CattgttgattttgtttatagttcatgtttaacattaaatttataagaattgatatgttaatgttctgagaaaaatgaaaatatacctaaggtacacctaactaggtgtgtcataggcatttttatatgtatgttataaccgtgaaagaaATATA TATATgaaattgataaattacgaaaccatcatcttgtgtctatgacgtacctatctaggtgtaccttcgccacattttcatacatccgtgatattttatatggttgcagaataatttttgaatagtcatcttactcatcccattaaaaattttcc
[0133] The microsatellite molecular marker M2 corresponding to primer pair HWZ2 is shown in SEQ ID No. 22, specifically as follows:
[0134] gtcgtcatcatcatcatattcatacagaaaattataaacattgttttcttaatatcaacaacttcaaaagcaatggattctgcattttcggattggagagaagagggagaaaaactagcctgtgaaaaattaaagtgaaattggagaaggTATAT ATATAgtattagtagtagagagtctcagaggaagaggaaacgagcgcgagaggttaacggttggggggggaggatctgcagcagaaccacgcgagggcgtagagcgagtggctgaaattttttctgatgtttccgacttagggtttctctctcgc
[0135] The microsatellite molecular marker M3 corresponding to primer pair HWZ3 is shown in SEQ ID No. 23, specifically:
[0136] aaaaaaaaacaaaaacaggagtgtaaacaaatgaagaaagatgtattatacatgtagcatgcagtaaatatttagggtttcaaactgacacgcatagctttagtaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaaga GGAGGAGGAGGAGGttaagcccatacggccatgagggacatgcatccagcaccaagaaggagggagacagtggatttaagtcgaagtgcagcactcttttgcagttttgtgctcatgaaatcaacagccaagagatttacgagtgccatataaataagaattcc
[0137] The microsatellite molecular marker M4 corresponding to primer pair HWZ4 is shown in SEQ ID No. 24, specifically:
[0138] tcatgcgcttcgtattcccctagagtttgctcaataaaaattgagtgtacctatatgttatgacaattttactagctttgtattatatatttttatgagatgtatgaaaatatgtataaaatatgtataaatattttttatctcatttttTATAT ATATAataaaagtttatattcgtcttttagatttaagtatattccatcataaatttataattgtaaagattcaaatttttattttcatatcgtgaatttctttttatcttctatattattattatagggtgctaacgaagcctttcacaagg
[0139] The microsatellite molecular marker M5 corresponding to primer pair HWZ5 is shown in SEQ ID No. 25, specifically:
[0140] cttgatctttatcaactgggtttgcttcgagctagatggagaaaccctgtttgacagcggtgcttcatgaagacaacaaccaagagctcacttccagctttactgcaaatcttccggtaacttttcttcttctctttccttttcttttttTCTCT CTCTCtttaactgaagatggaatttgtgtataaagttaggatctttatggctatatcatgcccttcattacatggaaaatttaggcgtatttatatgtacttacttcgtttgttatgacaacaaaatggatcgcaccagcaccagcaccagcatc
[0141] The microsatellite molecular marker M6 corresponding to primer pair HWZ6 is shown in SEQ ID No. 26, specifically:
[0142] tgaattgctggaccatagctcggaaattcttggtgtcggtgttgagcaccggcgtggggagttcgcttggaggccctggaccggcggcgtgctggcttagccacgcggccttcagggttcatcaacaacgactgctgatggtgaccctgatGAGGAGG AGGAGGAGccgccgcttcgccttgaaaagagtacgacgacgacgacctacttggtagatgatttgagctagtagtagtcgtagtagagattgatcggcggcgaacatggcagaggcaggtacttcgtcggaagatgatcggaggacgtcgttatactga
[0143] The microsatellite molecular marker M7 corresponding to primer pair HWZ7 is shown in SEQ ID No. 27, specifically:
[0144] acggagatcttcaagtatgaaacagcagcccttgaagccgacaacaagctgcttgccattttcgttctctctgtaacttggaagaaggaaggagggtgaaaatggcgccgagggagggaagtcggtggtagggactgatgattgaaaccgACACA CACACcaaaaccaaaccttaaaacctaaacagtagcagtaaatgaaactgaaagcccactgactaaagattccaagacaccccccaccaccaccaaactctgtctctattagctatttatagtaaatcttcttcattttcgagacccttttttgga
[0145] The microsatellite molecular marker M8 corresponding to primer pair HWZ8 is shown in SEQ ID No. 28, specifically:
[0146] aaaaaaactaattaggtgttatcaacttagttggaatgactagtttttttatttataaataaatttagttattcttcaattaataattacatttcatacttcaataaaattaaatttaactacccattgattgattgtttcatcttaaatTTTATTTATT TATTTATTTAtagatgattatgagaaaaaatagatacttaaaaaaataaattaacgaactcaatttcgaatttaattagctaatccagatttgacttgattctgacttcggtttgaaaaaatcaaatttgaaattcaatttttttaatctagatccagtt
[0147] The microsatellite molecular marker M9 corresponding to primer pair HWZ9 is shown in SEQ ID No. 29, specifically:
[0148] ttgtcagtaactcattatttttctgatgatttttttttggttattcgttctggtacccgacgaagatgtgcagtgctggtgtttgtttcttcttttttttctgattaattaattaagtacattatatactttgctaagtaagaattcTATATATATAT ATATATATATAatattgttttttattaaaaatattacaatcccatcgttatgaatcaacaatctcactcccgatagatagatagatatatatatatatatattgtttttttattaaaaatattataatctcgtcttcattatgaatcgaccata
[0149] The microsatellite molecular marker M10 corresponding to primer pair HWZ10 is shown in SEQ ID No. 30, specifically:
[0150] ctgcaagacacttctaatggcccaatagatagatgctgtttacaacatcctcattatacacacacacaccaaaccactggtttaccatgtttgttttctcctcaacttccatctatatcattattctttcttctcgccttgaaatttataATATAT ATATATacttttaaagtacactttttatcgatcacacggttgttgctactgttctctaacaacctcattgatgccgtgatgcgtcctcatgcaactgtccagatctcacgttggattcatcctgcaacataaggaagcagctttcttcaagccgat
[0151] In addition, during the genetic structure analysis, the results of the double PCR amplification can be digitized. Specifically, Gene Marker software can be used to read the PCR products, and MEGA software can be used to analyze, calculate, and construct a UPGMA cluster analysis diagram. The UPGMA cluster analysis diagram is shown below. Figure 1As shown, the numbers 1-30 correspond to samples 1-30 in the examples. The 30 *Myriophyllum sp.* populations were divided into three branches: 1-6 and 13-18 clustered in one branch, 7-12 clustered in another, and 19-24 and 25-30 clustered in yet another. Therefore, it can be determined that the clustering analysis results are consistent with the sampling classification (1-6 clustered in one branch, indicating that the 6 *Myriophyllum sp.* strains from the base population, which consisted of mature individuals with longer body lengths, vigorous growth, and faster growth, were closely related; 13-18 clustered in one branch, indicating that the 6 *Myriophyllum sp.* strains from the East Lake Wetland in Wuhan were closely related; 1-6 and 13-18 clustered in one branch, indicating that the 6 *Myriophyllum sp.* strains from the East Lake Wetland in Wuhan were closely related to the 6 selected base *Myriophyllum sp.* strains; 7-1 Clustering into one group indicates that the six randomly selected *Myriophyllum sp.* strains from Tangxun Lake in Wuhan are closely related; clustering into one group from 19 to 24 indicates that the six randomly selected *Myriophyllum sp.* strains from Panlong Lake in Wuhan are closely related; clustering into one group from 25 to 30 indicates that the six randomly selected *Myriophyllum sp.* strains from Jinyinhu Lake in Wuhan are closely related. This demonstrates that this technique can accurately determine the phylogenetic relationships of *Myriophyllum sp.* strains, with the six *Myriophyllum sp.* strains from East Lake in Wuhan showing a close phylogenetic relationship to the six selected basic *Myriophyllum sp.* strains.
[0152] Therefore, it can be determined that the 10 pairs of Myriophyllum microsatellite primers provided in this application can be used to assess the genetic relationships of Myriophyllum, providing new technical methods and means for studying the genetic diversity and phylogenetic analysis of Myriophyllum.
[0153] In some embodiments, to verify the efficiency of *Myriophyllum spicatum* in different regions on wetland ecological restoration, five wetland areas of equal size can be selected, and 50% of each area can be planted with *Myriophyllum spicatum*. The water quality data for each wetland area measured three months after planting is shown in Table 1 below:
[0154] Table 1
[0155]
[0156] As can be seen from Table 1, this application, through experiments of planting different populations of Myriophyllum spicatum, can determine that the populations of Myriophyllum spicatum and the selected basic populations of Myriophyllum spicatum in the East Lake Wetland of Wuhan have the best ecological restoration effects.
[0157] In summary, the above experiments verify that the *Myriophyllum spicatum* population selected in this experiment in the East Lake Wetland of Wuhan has a higher capacity and efficiency in improving wetland restoration than other selected populations. This experiment also shows that the genetic distance between the *Myriophyllum spicatum* population in the East Lake Wetland of Wuhan and the basic population is the closest. Therefore, using this technology to screen for *Myriophyllum spicatum* populations with longer individual body lengths, more vigorous growth, and faster growth can effectively improve the efficiency of wetland ecological restoration.
[0158] The above description is merely a specific embodiment of this application, but the scope of protection of this application is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in this application, and these modifications or substitutions should all be covered within the scope of protection of this application. Therefore, the scope of protection of this application should be determined by the scope of the claims.
Claims
1. A method for screening of cattail for improving the efficiency of wetland ecological restoration, characterized in that, The method comprises: Providing five groups of primers of microsatellite marker technology to analyze the genetic relationship of the Myriophyllum spicatum population identified as high water purification efficiency and the Myriophyllum spicatum population to be identified, so as to screen the Myriophyllum spicatum population with close genetic relationship with the Myriophyllum spicatum population with high water purification efficiency; The primers of the microsatellite marker technology are ten pairs, and the ten pairs of primers are divided into five groups for double PCR reaction. HWZ1-F, the sequence is shown as SEQ ID No. 1, HWZ1-R, the sequence is shown as SEQ ID No. 2; HWZ2-F, the sequence is shown as SEQ ID No. 3, HWZ2-R, the sequence is shown as SEQ ID No. 4; HWZ3-F, the sequence is shown as SEQ ID No. 5, HWZ3-R, the sequence is shown as SEQ ID No. 6; HWZ4-F, the sequence is shown as SEQ ID No. 7, HWZ4-R, the sequence is shown as SEQ ID No. 8; HWZ5-F, the sequence is shown as SEQ ID No. 9, HWZ5-R, the sequence is shown as SEQ ID No. 10; HWZ6-F, the sequence is shown as SEQ ID No. 11, HWZ6-R, the sequence is shown as SEQ ID No. 12; HWZ7-F, the sequence is shown as SEQ ID No. 13, HWZ7-R, the sequence is shown as SEQ ID No. 14; HWZ8-F, the sequence is shown as SEQ ID No. 15, HWZ8-R, the sequence is shown as SEQ ID No. 16; HWZ9-F, the sequence is shown as SEQ ID No. 17, HWZ9-R, the sequence is shown as SEQ ID No. 18; HWZ10-F, the sequence is shown as SEQ ID No. 19, HWZ10-R, the sequence is shown as SEQ ID No. 20; The annealing temperature of each pair of primers is 56°C.
2. The method for screening of Myriophyllum spicatum for improving the efficiency of wetland ecological restoration according to claim 1, characterized in that, HWZ1 is used in cooperation with HWZ2; HWZ3 is used in cooperation with HWZ4; HWZ5 is used in cooperation with HWZ6; HWZ7 is used in cooperation with HWZ8; and HWZ9 is used in cooperation with HWZ10.
3. A kit characterized in that, The primers used in the Myriophyllum spicatum screening method for improving the efficiency of wetland ecological restoration in claim 1 or 2.
4. Use of a primer of a microsatellite marker for identifying the genetic relationship of a Myriophyllum spicatum population, characterized in that, The primers used in the Myriophyllum spicatum screening method for improving the efficiency of wetland ecological restoration in claim 1 or 2 are applied to identify the genetic relationship of Myriophyllum spicatum populations.
5. A method of identifying the genetic relationship of a population of Myriophyllum spicatum, characterized by, It comprises: S1, respectively extracting the Myriophyllum spicatum genomic DNA of the Myriophyllum spicatum population identified as high water purification efficiency and the Myriophyllum spicatum population to be identified; S2, using the Myriophyllum spicatum genomic DNA extracted in S1 as a DNA template, and using the five groups of primers provided in the Myriophyllum spicatum screening method for improving the efficiency of wetland ecological restoration in claim 1 or 2 to perform PCR amplification, to obtain an amplification product; S3, using polyacrylamide gel for electrophoresis and silver staining of the amplification product, to obtain a silver staining result; S4, based on the silver staining results, using genetic analysis software to draw UPGMA cluster analysis chart to get clustering results, and identifying and distinguishing the genetic relationship of the group of fox tail reed according to the clustering results.
6. The method of identifying the genetic relationship of a population of Myriophyllum spicatum of claim 5, wherein, The reaction system of the PCR amplification has a capacity of 25 μL, which respectively includes: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL of upper and lower primers of two pairs of primers, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water.
7. The method of identifying the genetic relationship of a population of Myriophyllum spicatum of claim 5, wherein, The reaction procedure of the PCR amplification is as follows: Pre-denaturation at 94 ℃ for 3 minutes; Denaturation at 94 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, and extension at 72 ℃ for 45 seconds in turn, for 35 cycles; Extension at 72 ℃ for 10 minutes, and preservation at 4 ℃.
8. The method of identifying the genetic relationship of a population of Myriophyllum spicatum of claim 5, wherein, The amplification product is subjected to electrophoresis and silver staining by using 12% polyacrylamide gel.
9. The method of identifying the genetic relationship of a population of Myriophyllum spicatum of claim 5, wherein, The genetic analysis software includes MEGA software.
Citation Information
Patent Citations
Hi-C high-throughput sequencing library building method suitable for watermifoil
CN109913529A
Method for reconstructing brackish water lake composite ecological restoration system by taking myriophyllum verticillatum as dominant species
CN114620837A