Construction method, evaluation method and application of inflammatory nephropathy animal model

Abstract

The invention relates to a construction method, an evaluation method and application of an inflammatory nephropathy animal model, and relates to the technical field of nephropathy animal model construction. The construction method comprises the steps that a CRIPSR / Cas9 system is adopted to shear a first targeting site on an Smu region of a mouse immune globulin gene, and a second targeting site on an Sgamma2c region of the mouse immune globulin gene is sheared, so that a base sequence between the first targeting site and the second targeting site is knocked out, and the inflammatory nephropathy animal model is obtained. The application comprises an application of the inflammatory nephropathy animal model constructed by the construction method in screening drugs for treating inflammatory nephropathy and an application in researching a molecular mechanism of occurrence and development of inflammatory nephropathy.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the technical field of kidney disease animal model construction, in particular, to a method for constructing an inflammatory kidney disease animal model, an evaluation method and application thereof. BACKGROUND

[0002] Inflammatory kidney disease is a group of diseases originating from glomerulus, which is caused by multiple causes and multiple pathological types. If the nephritic syndrome is not treated in time, the renal fibrosis will progress rapidly, leading to fewer and fewer healthy nephrons, glomerular fibrosis and sclerosis, and finally forming scar tissue, and the kidney function is deteriorating. The cause of inflammatory kidney disease can be the destruction of the normal structure of glomerular basement membrane caused by immune or inflammatory-mediated red blood cells, white blood cells and other plasma components entering the urine. This inflammatory reaction can be caused by immune attack of circulating antibodies on the inherent components of glomerular basement membrane, or by the retention of circulating immune complexes when the glomerulus is filtered, and the activation of complement to attack the glomerulus and chemotaxis inflammatory cells. Most of the pathological mechanism research, drug screening, etc. are based on animal models, but there is no effective animal model of inflammatory kidney disease available at present.

[0003] It should be noted that the information disclosed in the above background section is only used to strengthen the understanding of the background of the present disclosure, and therefore can include information that does not constitute prior art known to those of ordinary skill in the art. SUMMARY

[0004] The purpose of the present disclosure is to overcome the shortcomings of the prior art, and to provide a method for constructing an inflammatory kidney disease animal model, an evaluation method and application thereof, by using a CRIPSR / Cas9 system to construct a spontaneous inflammatory kidney disease animal model.

[0005] According to one aspect of the present disclosure, a method for constructing an inflammatory kidney disease animal model is provided, which comprises knocking out the base sequence between a first target site and a second target site of a mouse immunoglobulin gene by using a CRIPSR / Cas9 system to obtain an inflammatory kidney disease animal model.

[0006] The first target site is located in the Sμ region of the mouse immunoglobulin gene, and the second target site is located in the Sγ2c region of the mouse immunoglobulin gene.

[0007] In an exemplary embodiment of the present disclosure, the method for constructing an inflammatory kidney disease animal model comprises the following steps:

[0008] S1, according to the first target site of the Sμ region in the immunoglobulin gene, a Sμ-gRNA is designed, and the base sequence of the Sμ-gRNA is shown in SEQ ID NO: 5;

[0009] According to a second targeting site of the Sγ2c region in the immunoglobulin gene, an Sγ2c-gRNA is designed, and a base sequence of the Sγ2c-gRNA is shown as SEQ ID NO: 15;

[0010] S2, Cas9 mRNA, Sμ-gRNA and Sγ2c-gRNA are simultaneously microinjected, and F0 mice are obtained by culture;

[0011] S3, the F0 mice are mated with wild type mice to obtain F1 mice, the F1 mice are screened, the F1 heterozygote mice are screened, the F2 mice are obtained by self-crossing, the homozygote mice are screened from the F2 mice, and the screened F2 homozygote mice are subjected to genotype identification, and the genotype of the base sequence knockout between the first targeting site and the second targeting site of the immunoglobulin gene is an animal model of inflammatory kidney disease.

[0012] In an exemplary embodiment of the present disclosure, in step S3, the screening of the F1 mice and the screening of the homozygote mice from the F2 mice are both detected by qPCR.

[0013] In an exemplary embodiment of the present disclosure, the primers used in the qPCR detection include:

[0014] the primer with the base sequence of SEQ ID NO: 27 and the primer with the base sequence of SEQ ID NO: 28 are used for identifying the Cμ region of the immunoglobulin gene;

[0015] the primer with the base sequence of SEQ ID NO: 31 and the primer with the base sequence of SEQ ID NO: 32 are used for identifying the Cγ1 region of the immunoglobulin gene;

[0016] The primers used in the qPCR detection further include:

[0017] the primer with the base sequence of SEQ ID NO: 37 and the primer with the base sequence of SEQ ID NO: 38 are used for identifying the Cε region of the immunoglobulin gene;

[0018] and / or the primer with the base sequence of SEQ ID NO: 39 and the primer with the base sequence of SEQ ID NO: 40 are used for identifying the Cα region of the immunoglobulin gene.

[0019] In an exemplary embodiment of the present disclosure, in step S3, the genotype identification of the screened F2 homozygote mice is detected by PCR;

[0020] The primers used in the PCR detection include:

[0021] a primer with the base sequence of SEQ ID NO: 27 and a primer with the base sequence of SEQ ID NO: 28, for identifying the Cμ region of the immunoglobulin gene;

[0022] a primer with the base sequence of SEQ ID NO: 29 and a primer with the base sequence of SEQ ID NO: 30, for identifying the Cγ3 region of the immunoglobulin gene;

[0023] a primer with the base sequence of SEQ ID NO: 31 and a primer with the base sequence of SEQ ID NO: 32, for identifying the Cγ1 region of the immunoglobulin gene;

[0024] a primer with the base sequence of SEQ ID NO: 33 and a primer with the base sequence of SEQ ID NO: 34, for identifying the Cγ2b region of the immunoglobulin gene;

[0025] a primer with the base sequence of SEQ ID NO: 35 and a primer with the base sequence of SEQ ID NO: 36, for identifying the Cγ2c region of the immunoglobulin gene;

[0026] The primers used in the PCR detection also include:

[0027] a primer with the base sequence of SEQ ID NO: 37 and a primer with the base sequence of SEQ ID NO: 38, for identifying the Cε region of the immunoglobulin gene;

[0028] and / or a primer with the base sequence of SEQ ID NO: 39 and a primer with the base sequence of SEQ ID NO: 40, for identifying the Cα region of the immunoglobulin gene.

[0029] In an exemplary embodiment of the present disclosure, in step S2, the Cas9 mRNA, Sμ-gRNA and Sγ2c-gRNA are simultaneously microinjected, and the F0 mice are obtained by culturing.

[0030] The Cas9 mRNA, Sμ-gRNA and Sγ2c-gRNA are simultaneously microinjected into the zygotes of the mice, the zygotes are transplanted into the oviducts of surrogate mice, and the F0 mice are obtained by culturing.

[0031] In an exemplary embodiment of the present disclosure, the mice are C57BL / 6 mice.

[0032] According to another aspect of the present disclosure, there is provided an evaluation method of the inflammatory kidney disease animal model constructed by the above construction method, which uses the following detection results for evaluating the inflammatory kidney disease animal model: PCR identification of the genotype of the model animal; biochemical examination of the urine protein index and serum urea nitrogen index of the model animal.

[0033] According to another aspect of this disclosure, the application of the animal model of inflammatory nephropathy constructed by the above-described construction method in screening drugs for the treatment of inflammatory nephropathy is provided.

[0034] According to another aspect of this disclosure, the application of the animal model of inflammatory nephropathy constructed by the above-described method in studying the molecular mechanisms of the occurrence and development of inflammatory nephropathy is provided.

[0035] This disclosure describes the creation of an animal model of spontaneous inflammatory nephropathy by knocking out the base sequence between the first target site in the Sμ region and the second target site in the Sγ2c region of the mouse immunoglobulin gene. This model can be used in the biomedical field for drug screening, efficacy evaluation, and research on the molecular mechanisms of inflammatory nephropathy.

[0036] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and are not intended to limit this disclosure. Attached Figure Description

[0037] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with this disclosure and, together with the description, serve to explain the principles of this disclosure. It is obvious that the drawings described below are merely some embodiments of this disclosure, and those skilled in the art can obtain other drawings based on these drawings without any inventive effort.

[0038] Figure 1 This is a schematic diagram of the immunoglobulin gene knockout location in an animal model of inflammatory nephropathy, according to one embodiment of this disclosure.

[0039] Figure 2 This is a schematic diagram illustrating the screening results of gRNA targeting the Sμ region of the immunoglobulin gene in one embodiment of this disclosure.

[0040] Figure 3 This is a schematic diagram illustrating the screening results of gRNA targeting the Sγ2c region of the immunoglobulin gene in one embodiment of this disclosure.

[0041] Figure 4 This is an agarose gel electrophoresis image of the immunoglobulin gene knockout sequence of homozygous F2 mice, as shown in one embodiment of this disclosure.

[0042] Figure 5 This is a schematic diagram of the flow cytometry results of kidney B cells in normally growing wild-type mice and inflammatory nephropathy model mice, according to one embodiment of this disclosure.

[0043] Figure 6This is a schematic diagram of the detection of serum antibody levels in normally growing wild-type mice and inflammatory nephropathy model mice in one embodiment of the present disclosure; wherein (A) is a schematic diagram of the detection of serum total IgG antibody levels in wild-type mice and inflammatory nephropathy model mice, and (B) is a schematic diagram of the detection of serum total IgG2c antibody levels in wild-type mice and inflammatory nephropathy model mice.

[0044] Figure 7 This diagram illustrates the serum Anti-CGG levels in wild-type mice and inflammatory nephropathy model mice immunized with the TD antigen, according to one embodiment of this disclosure.

[0045] Figure 8 This is a comparison of survival time between wild-type mice and mice with inflammatory kidney disease in one embodiment of this disclosure.

[0046] Figure 9 This is a schematic diagram showing a comparison of the body weights of wild-type mice and dying inflammatory kidney disease model mice in one embodiment of this disclosure.

[0047] Figure 10 This is a schematic diagram comparing the kidneys of 20-week-old wild-type mice and mice with an inflammatory nephropathy model, according to one embodiment of this disclosure.

[0048] Figure 11 This is a schematic diagram of HE, PAS, and Masson sections of the kidneys of wild-type mice and inflammatory nephropathy model mice of different ages, stained according to one embodiment of this disclosure.

[0049] Figure 12 This is a schematic diagram illustrating the urinary protein level detection results of wild-type mice and inflammatory nephropathy model mice of different ages in one embodiment of this disclosure.

[0050] Figure 13 This is a schematic diagram illustrating the serum urea nitrogen level detection results of wild-type mice and inflammatory kidney disease model mice of different ages in one embodiment of this disclosure.

[0051] Figure 14 This is a schematic diagram illustrating the serum creatinine level detection results of wild-type mice and inflammatory kidney disease model mice of different ages in one embodiment of this disclosure.

[0052] Figure 15 In one embodiment of this disclosure, CD45-positive immune cells (CD45+) in the kidney cells of 20-week-old wild-type mice and inflammatory nephropathy model mice are used. + Schematic diagram of flow cytometry results; where (A) is a flow cytometry plot of the proportion of CD45-positive immune cells in kidney cells, and (B) is a statistical graph of the proportion and absolute number of CD45-positive immune cells in kidney cells.

[0053] Figure 16 This is a flow cytometry diagram of neutrophil counts in kidney cells of 20-week-old wild-type mice and inflammatory nephropathy model mice, according to one embodiment of this disclosure. (A) is a flow cytometry plot showing the proportion of neutrophils among CD45-positive immune cells, and (B) is a statistical graph showing the percentage of neutrophils among CD45-positive immune cells and the absolute number of neutrophils in kidney cells.

[0054] Figure 17 This is a schematic diagram of flow cytometry results of rMAC and iMAC in kidney cells of 20-week-old wild-type mice and inflammatory nephropathy model mice in one embodiment of this disclosure; wherein, Figure A shows the proportion of rMAC and iMAC in CD45-positive immune cells; Figure B shows a schematic diagram comparing the proportion of iMAC in CD45-positive immune cells and the absolute number of iMAC in kidney cells; Figure C shows a schematic diagram comparing the proportion of rMAC in CD45-positive immune cells and the absolute number of rMAC in kidney cells; Figure D shows a schematic diagram comparing the mean fluorescence intensity (MFI) of CD11b in rMAC.

[0055] Figure 18 This is a schematic diagram showing the detection results of IgG2c antibody levels on the surface of rMAC and iMAC in kidney cells of 20-week-old wild-type mice and inflammatory nephropathy model mice, according to one embodiment of this disclosure.

[0056] Figure 19 This diagram illustrates the expression levels of inflammatory factors TNF-α, IL-1β, and complement C3 in the kidneys of 20-week-old wild-type mice and inflammatory nephropathy model mice, according to one embodiment of this disclosure. Detailed Implementation

[0057] Exemplary embodiments will now be described more fully with reference to the accompanying drawings. However, these exemplary embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, they are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the exemplary embodiments to those skilled in the art. The same reference numerals in the drawings denote the same or similar structures, and therefore detailed descriptions of them will be omitted. Furthermore, the drawings are merely illustrative of this disclosure and are not necessarily drawn to scale.

[0058] Unless otherwise stated, all terms used to disclose this invention (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Further guidance is provided below for a better understanding of the teachings of this invention. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0059] This disclosure provides a method for constructing an animal model of inflammatory nephropathy. The method includes knocking out the base sequence between a first target site and a second target site of a mouse immunoglobulin gene using a CRIPSR / Cas9 system to obtain an animal model of inflammatory nephropathy. The first target site is located in the Sμ region of the mouse immunoglobulin gene; the second target site is located in the Sγ2c region of the mouse immunoglobulin gene. Figure 1 As shown, the Sμ and Sγ2c regions of wild-type (WT) mice were "cut open" using the CRIPSR / Cas9 system, and then the remaining parts of the Sμ and Sγ2c regions were connected, so that the sequence from the Cμ region to the Cγ2b region was cut out, thus obtaining an animal model of inflammatory nephropathy. Figure 1 The mice shown in the diagram with the corresponding sequence knocked out between the first target site in the Sμ region of the immunoglobulin gene and the second target site in the Sγ2c region are inflammatory nephropathy model mice. The IgG antibodies of these inflammatory nephropathy model mice only express the IgG2c subtype, and they are Ighγ2c type mice. Figure 1 In this context, VDJ represents the variable region, C represents the constant region (e.g., Cμ, Cδ, Cγ3, Cγ1, Cγ2b, Cγ2c), and S represents the transition region (e.g., Sμ, Sγ3, Sγ1, Sγ2b, Sγ2c).

[0060] In one embodiment of this disclosure, the method for constructing an animal model of inflammatory nephropathy includes the following steps:

[0061] S1. Based on the first target site in the Sμ region of the immunoglobulin gene, Sμ-gRNA was designed and obtained, the base sequence of which is shown in SEQ ID NO: 5. Based on the second target site in the Sγ2c region of the immunoglobulin gene, Sγ2c-gRNA was designed and obtained, the base sequence of which is shown in SEQ ID NO: 15.

[0062] In one example, a method for designing Sμ-gRNA includes: designing a forward sequence as shown in SEQ ID NO: 5 and a reverse sequence as shown in SEQ ID NO: 6, annealing to obtain double-stranded DNA, cloning the double-stranded DNA into a vector (e.g., a plasmid or a viral vector), and performing in vitro transcription on the DNA in the vector to obtain the desired Sμ-gRNA, wherein the base sequence of the Sμ-gRNA is shown in SEQ ID NO: 5.

[0063] The method for designing and obtaining Sγ2c-gRNA includes: designing a forward sequence as shown in SEQ ID NO: 15 and a reverse sequence as shown in SEQ ID NO: 16, annealing to obtain double-stranded DNA, cloning the double-stranded DNA into a vector (e.g., a plasmid or a viral vector), and performing in vitro transcription on the DNA in the vector to obtain the desired Sγ2c-gRNA, wherein the base sequence of the Sγ2c-gRNA is shown in SEQ ID NO: 15.

[0064] S2. Cas9 mRNA, Sμ-gRNA and Sγ2c-gRNA were simultaneously microinjected to obtain F0 mice.

[0065] In one example, Cas9 mRNA, Sμ-gRNA, and Sγ2c-gRNA were mixed and simultaneously microinjected into mouse zygotes. The zygotes were then transferred to the ampulla of the oviduct of a surrogate mouse, which gave birth to F0 mice. Thus, after entering the zygote, Cas9 mRNA can be directly translated and expressed to produce the Cas9 protein. The Cas9 protein can form a complex, Cas9 protein / Sμ-gRNA, with the Sμ-gRNA shown in SEQ ID NO: 5; Cas9 protein / Sμ-gRNA cleaves the Sμ region of the mouse immunoglobulin gene. Cas9 protein can also form a complex, Cas9 protein / Sγ2c-gRNA, with the Sγ2c-gRNA shown in SEQ ID NO: 15; Cas9 protein / Sγ2c-gRNA cleaves the Sγ2c region of the mouse immunoglobulin gene.

[0066] In one example, the mouse is a C57BL / 6 mouse.

[0067] S3. F0 mice were mated with wild-type mice to obtain F1 mice. F1 mice were screened, and F1 heterozygous mice were self-crossed to obtain F2 mice. Homozygous mice were screened from F2 mice, and the genotypes of the selected F2 homozygous mice were identified. The genotype with the base sequence knocked out between the first and second target sites of the immunoglobulin gene is the animal model of inflammatory nephropathy.

[0068] In one embodiment of this disclosure, in step S3, the screening of F1 mice and the screening of homozygotes from F2 mice are both performed using quantitative real-time PCR (qPCR). F1 mice contain both heterozygotes and wild-type mice, while F2 mice contain heterozygotes, homozygotes, and wild-type mice. Using qPCR for genotype screening can effectively distinguish between heterozygotes and wild-type mice.

[0069] In one embodiment of this disclosure, the primers used for qPCR detection include: a first primer for identifying the Cμ region of the immunoglobulin gene, the base sequences of which are SEQ ID NO: 27 and SEQ ID NO: 28; and a second primer for identifying the Cγ1 region of the immunoglobulin gene, the base sequences of which are SEQ ID NO: 31 and SEQ ID NO: 32. It also includes a third primer for identifying the Cε region of the immunoglobulin gene, the base sequences of which are SEQ ID NO: 37 and SEQ ID NO: 38; and / or a fourth primer for identifying the Cα region of the immunoglobulin gene, the base sequences of which are SEQ ID NO: 39 and SEQ ID NO: 40. That is, the primers used for qPCR detection can be the first primer, the second primer, and the third primer; or the first primer, the second primer, and the fourth primer; or the first primer, the second primer, the third primer, and the fourth primer.

[0070] In one embodiment of this disclosure, in step S3, the genotyping of the selected F2 homozygotes is performed using PCR detection. The primers used for the PCR detection include: primers with the base sequence SEQ ID NO: 27 and SEQ ID NO: 28, used to identify the Cμ region of the immunoglobulin gene; primers with the base sequence SEQ ID NO: 29 and SEQ ID NO: 30, used to identify the Cγ3 region of the immunoglobulin gene; primers with the base sequence SEQ ID NO: 31 and SEQ ID NO: 32, used to identify the Cγ1 region of the immunoglobulin gene; primers with the base sequence SEQ ID NO: 33 and SEQ ID NO: 34, used to identify the Cγ2b region of the immunoglobulin gene; and primers with the base sequence SEQ ID NO: 35 and SEQ ID NO: 36, used to identify the Cγ2c region of the immunoglobulin gene. The primers used for PCR detection also include: primers with the base sequence SEQ ID NO: 37 and primers with the base sequence SEQ ID NO: 38, used to identify the Cε region of the immunoglobulin gene; and / or primers with the base sequence SEQ ID NO: 39 and primers with the base sequence SEQ ID NO: 40, used to identify the Cα region of the immunoglobulin gene.

[0071] This disclosure also provides an evaluation method for an animal model of inflammatory nephropathy constructed using the above-described method, including evaluating the animal model using the following detection results: PCR identification of the genotype of the model animal; and biochemical examination of the urinary protein and serum urea nitrogen levels of the model animal. For example, PCR is used to identify whether the genotype of the model animal is one that has knocked out the sequence between the first target site in the Sμ region and the second target site in the Sγ2c region of the immunoglobulin gene. The urinary protein and serum urea nitrogen levels can be used to determine the progression of inflammatory nephropathy in the model animal.

[0072] The following description, in conjunction with specific embodiments, provides further details.

[0073] I. Screening for guide RNA (gRNA)

[0074] Mouse immunoglobulin genes have two characteristics: (1) high repetition; and (2) a high proportion of GC base pairs in the immunoglobulin sequence. This makes it more difficult to obtain gRNAs with low off-target rates and high gene editing efficiency when editing mouse immunoglobulin genes. In this embodiment, the CRIPSR / Cas9 system was used to edit mouse immunoglobulin genes, and the CRIPSR / Cas9 system was also used for gRNA screening.

[0075] Principle explanation: For different target sites in the Sμ and Sγ2c regions, multiple sets of complementary base sequences (including complementary forward and reverse sequences) are designed. After annealing, the forward and reverse sequences form double-stranded DNA. Each DNA is integrated into the plasmid along with the Cas9 gene to obtain a plasmid with Cas9 / DNA. This plasmid can express Cas9 protein and gRNA.

[0076] 1. Screening of Sμ region-targeting gRNAs

[0077] The cSuKI cell line is a modified version of the B-cell lymphoma cell line (CH12F3). In cSuKI cells, the Sα region preceding the Cα region of the constant region is replaced with a core sequence of approximately 700 bp (Core Sμ, cSμ). Figure 2 The diagram shows a thumbnail of the cSuKI cell immunoglobulin gene (the genes from the Cδ region to the Cε region are omitted). Thus, simply introducing gRNA targeting the Sμ region into cSuKI cells can cause double bond breaks in the Sμ region before the Cμ region and the cSμ region before the Cα region, thereby inducing immunoglobulin gene recombination and changing the expressed antibody type from IgM to IgA.

[0078] In this embodiment, five base sequence sets (including complementary forward and reverse sequences) targeting different sites on the Sμ region were designed, namely Sμ-1, Sμ-2, Sμ-3, Sμ-4, and Sμ-5. These five base sequence sets were integrated into the PX330 plasmid, and the PX330 plasmids containing the integrated base sequence sets were introduced into cSuKI cells using a NEPA21 electroporation instrument. The cSuKI cells transfected with the PX330 plasmid were stained with anti-IgM and anti-IgA antibodies, and the antibody types on the surface of B cells were detected by flow cytometry (FACS) to determine whether antibody type switching had occurred at the protein level. Each gRNA group was measured three times, and the statistical results are shown in Table 1.

[0079] Table 1. Summary of antibody type switching efficiency targeting each base sequence group in the Sμ region

[0080]

[0081] See Table 1 and Figure 2 The CRIPSR / Cas9 system has a high feasibility in inducing antibody type switching in B cells. The Sμ-3 group has the highest antibody type switching efficiency for IgA. Therefore, the base sequence group corresponding to the Sμ-3 group was selected for in vitro transcription to obtain Sμ-gRNA. The base sequence of the Sμ-gRNA is shown in SEQ ID NO: 5.

[0082] 2. Screening of Sγ2c region-targeting gRNAs

[0083] Screening for Sγ2c region gRNAs was performed using an unmodified B-cell lymphoma cell line (CH12F3 cell line). For example... Figure 3 The diagram shows a thumbnail of the immunoglobulin gene in CH12F3 cells (the gene from the Cδ region to the Cγ2b region is omitted). Therefore, introducing gRNAs targeting the Sμ region and the Sγ2c region into CH12F3 cells will cause double bond breaks in the Sμ region before the Cμ region and the Sγ2c region before the Cγ2c region, thereby inducing immunoglobulin gene recombination and converting the antibody type from IgM to IgG2c. Based on the Sμ-gRNAs selected from the Sμ region, gRNAs targeting different sites in the Sγ2c region are further screened.

[0084] Eight sets of base sequences (including complementary forward and reverse sequences) were designed for different target sites on the Sγ2c region, namely Sγ2c-1, Sγ2c-2, Sγ2c-3, Sγ2c-4, Sγ2c-5, Sγ2c-6, Sγ2c-7 and Sγ2c-8. Based on the screening results of Sμ region gRNAs, the Sμ-3 group was combined with the above-mentioned 8 base sequence groups targeting the Sγ2c region to obtain the following groups: Group 1 (Sμ-3 + Sγ2c-1), Group 2 (Sμ-3 + Sγ2c-2), Group 3 (Sμ-3 + Sγ2c-3), Group 4 (Sμ-3 + Sγ2c-4), Group 5 (Sμ-3 + Sγ2c-5), Group 6 (Sμ-3 + Sγ2c-6), Group 7 (Sμ-3 + Sγ2c-7), and Group 8 (Sμ-3 + Sγ2c-8). Groups 1 through 8 were integrated into PX330 plasmids, and the PX330 plasmids integrated with Groups 1 through 8 were introduced into CH12F3 cells using a NEPA21 electroporation system. CH12F3 cells were stained with anti-IgM and anti-IgG2c antibodies, and the types of antibodies on the surface of B cells were detected by flow cytometry (FACS) to determine whether antibody type switching had occurred at the protein level. The measurements were repeated three times for groups 1 through 8, and the statistical results are shown in Table 2.

[0085] Table 2. Summary of antibody type switching efficiency targeting each base sequence group in the Sγ2c region

[0086]

[0087] In the screening of Sμ region gRNAs, Sμ-gRNA (base sequence SEQ ID NO: 5) has been selected. Therefore, Table 2 shows the antibody conversion efficiency targeting different base sequence sets in the Sγ2c region when the Sμ region gRNA has been selected, in order to screen suitable Sγ2c region gRNAs. See Table 2 and... Figure 3 The antibody type conversion efficiency of the Sγ2c-3 group to IgG2c is the highest. Therefore, the base sequence group corresponding to the Sγ2c-3 group is selected for in vitro transcription to obtain Sγ2c-gRNA. The base sequence of the Sγ2c-gRNA is shown in SEQ ID NO: 15.

[0088] II. Methods for constructing a mouse model of inflammatory nephropathy

[0089] C57BL / 6 mice were used to construct an animal model of inflammatory nephropathy. During the experiment, the C57BL / 6 mice were raised under specific pathogen-free conditions. All animal experiments and procedures were approved by the Animal Experimentation Committee of the Chinese Academy of Sciences and the Animal Ethics Committee of the School of Basic Medical Sciences of Fudan University.

[0090] Sμ-gRNA, Sγ2c-gRNA, and Cas9 mRNA were mixed and injected into fertilized eggs via microinjection. The fertilized eggs were then transferred to the ampulla of the oviduct of surrogate mice to obtain F0 mice (F0 generation mice). F0 mice were bred with wild-type mice to obtain F1 mice (F1 generation mice). Most F1 mice were wild-type, with a small portion being heterozygous. Tail samples were taken from F1 mice, and heterozygotes were screened using qPCR. Specific primers for qPCR genotyping are shown in Table 3.

[0091] Table 3. Specific primers for qPCR genotyping

[0092] Name SEQ ID NO Base sequence qCμ-F1 SEQ ID NO: 27 GCGAGGCCACGAACTTCAC qCμ-R1 SEQ ID NO: 28 TGTTCTCGATGGTCACCGGAT qCγ1-F1 SEQ ID NO: 31 TGGAGCACACAGAATAAGCTCCTG qCγ1-R1 SEQ ID NO: 32 CAGAAACCTCAGTTCCCCAAAGT qCε-F1 SEQ ID NO: 37 GAGGTCGCCAAGACACTCTG qCε-R1 SEQ ID NO: 38 AGGTGTTACCAAGGCTCGTG qCα-F4 SEQ ID NO: 39 ACCACCGTAAACTTCCCACC qCα-R4 SEQ ID NO: 40 TCCAATTCTTGGACGGCGTT

[0093] The primer pair for the Cε region (upstream primer sequence as shown in SEQ ID NO: 37, downstream primer sequence as shown in SEQ ID NO: 38) and the primer pair for the Cα region (upstream primer sequence as shown in SEQ ID NO: 39, downstream primer sequence as shown in SEQ ID NO: 40) can be used selectively, or both can be used.

[0094] The selected heterozygous F1 mice were self-crossed to obtain F2 mice (F2 generation mice). In the F2 mice, 25% of the mice were homozygous, 25% were wild-type, and 50% were heterozygous. Tail samples were taken from the F2 mice, and homozygous mice were screened using qPCR. The primers used for the qPCR are shown in Table 3.

[0095] PCR was used to screen for homozygotes in F2 mice for genotyping (WT type was used as a control) to confirm whether the homozygous F2 mice had knocked out the base sequences of the constant regions and transition regions between the first target site on the Sμ region and the second target site on the Sγ2c region of the immunoglobulin gene. The specific primers for the PCR are shown in Table 4, SEQ ID NO: 27 to SEQ ID NO: 40.

[0096] Table 4. Specific primers for PCR genotyping

[0097] Name SEQ ID NO Base sequence Cμ-F1 SEQ ID NO: 27 GCGAGGCCACGAACTTCAC Cμ-R1 SEQ ID NO: 28 TGTTCTCGATGGTCACCGGAT Cγ3-F1 SEQ ID NO: 29 CCCTCTATGCCTAAGCCCCTA Cγ3-R1 SEQ ID NO: 30 ATATTGTGAGGATGGTGGAGGAAA Cγ1-F1 SEQ ID NO: 31 TGGAGCACACAGAATAAGCTCCTG Cγ1-R1 SEQ ID NO: 32 CAGAAACCTCAGTTCCCCAAAGT Cγ2b-F1 SEQ ID NO: 33 AGCACCACGGTGGACAAAA Cγ2b-R1 SEQ ID NO: 34 CAAACCAGAGAGAGGAAAGTTTG Cγ2c-F1 SEQ ID NO: 35 CCATGCGCAGGTAAGTCACTA Cγ2c-R1 SEQ ID NO: 36 ACAGCAATTTCGGCAGGTAAGAA Cε-F1 SEQ ID NO: 37 GAGGTCGCCAAGACACTCTG Cε-R1 SEQ ID NO: 38 AGGTGTTACCAAGGCTCGTG Cα-F4 SEQ ID NO: 39 ACCACCGTAAACTTCCCACC Cα-R4 SEQ ID NO: 40 TCCAATTCTTGGACGGCGTT

[0098] In Table 3, PCR amplification of Cμ-F1 and Cμ-R1 yielded a product of 105 bp; PCR amplification of Cγ3-F1 and Cγ3-R1 yielded a product of 699 bp; PCR amplification of Cγ1-F1 and Cγ1-R1 yielded a product of 108 bp; PCR amplification of Cγ2b-F1 and Cγ2b-R1 yielded a product of 293 bp; PCR amplification of Cγ2c-F1 and Cγ2c-R1 yielded a product of 676 bp; PCR amplification of Cε-F1 and Cε-R1 yielded a product of 118 bp; and PCR amplification of Cα-F1 and Cα-R1 yielded a product of 146 bp. The PCR reaction system and procedure are shown in Tables 4 and 5.

[0099] Table 5. PCR reaction system

[0100]

[0101]

[0102] Table 6. PCR reaction procedure

[0103]

[0104] See Figure 4 The image shows agarose gel electrophoresis results for genotyping after PCR. The results for wild-type (WT) mice after PCR were as follows: Cμ-F1 and Cμ-R1 yielded a product of approximately 105 bp; Cγ3-F1 and Cγ3-R1 yielded a product of approximately 699 bp; Cγ1-F1 and Cγ1-R1 yielded a product of approximately 108 bp; Cγ2b-F1 and Cγ2b-R1 yielded a product of approximately 293 bp; Cγ2c-F1 and Cγ2c-R1 yielded a product of approximately 676 bp; Cε-F1 and Cε-R1 yielded a product of approximately 118 bp; and Cα-F1 and Cα-R1 yielded a product of approximately 146 bp. The PCR results of homozygous F2 mice were as follows: Cγ2c-F1 and Cγ2c-R1 yielded a product of approximately 676 bp; Cε-F1 and Cε-R1 yielded a product of approximately 118 bp; and Cα-F1 and Cα-R1 yielded a product of approximately 146 bp. Based on the bands of the PCR products on the agarose gel electrophoresis image, Figure 4 The F2 mice in this study are homozygous mice with the Cμ, Cγ3, Cγ1, and Cγ2b regions of immunoglobulins knocked out, which are the inflammatory kidney disease model mice.

[0105] III. Immune Characteristics Analysis of Inflammatory Nephropathy Model Mice

[0106] Experimental groups: including wild-type group and nephropathy model group. The wild-type group consisted of wild-type mice, and the nephropathy model group consisted of inflammatory nephropathy model mice (Ighγ2c type mice) constructed using the above-mentioned animal model construction method for inflammatory nephropathy.

[0107] 1. Blood was collected from the orbital cavity of normally growing wild-type mice and mice with inflammatory nephropathy (8-12 weeks old). The supernatant was collected by centrifugation to obtain serum samples. At the same time, spleen samples were collected from wild-type mice and mice with inflammatory nephropathy, and B cells were extracted from the spleen. The proportion of IgG2c positive B cells in the spleen was analyzed.

[0108] B cells were analyzed using flow cytometry. Figure 5 As shown, a small fraction of B cells in wild-type mice express IgG2c, while all B cells in mice with inflammatory nephropathy express IgG2c. This result is consistent with... Figure 1 The immunoglobulin gene structures of the inflammatory nephropathy model mice (Ighγ2c type mice) shown are consistent.

[0109] like Figure 6 As shown, the ELISA method was used to detect total IgG antibodies and IgG2c subtype antibodies in serum. Figure 6 As shown in (B), under normal growth conditions, the expression level of IgG2c subtype antibody in inflammatory nephropathy model mice was significantly higher than that in wild-type mice (P < 0.0001). Figure 6 As shown in (A), the total IgG level in the inflammatory nephropathy model mice (the inflammatory nephropathy model mice only express the IgG2c subtype, so the total IgG in these mice is only IgG2c) is higher than the total IgG level (including IgG1, IgG3, IgG2b, and IgG2c subtypes) in wild-type mice. This indicates that although the inflammatory nephropathy model mice only express the IgG2c subtype, under normal conditions, the expression level of the IgG2c subtype in serum is much higher than the total IgG level in wild-type mice (P < 0.001). Therefore, it can be concluded that after knocking out the gene regions corresponding to IgG1, IgG3, and IgG2b antibodies, the expression level of the IgG2c subtype antibody specifically increases.

[0110] In other words, in pathogen-free inflammatory nephropathy model mice, the levels of IgG2c subtype antibodies were significantly higher than those in wild-type mice, even without external antigen stimulation. Furthermore, the levels of IgG2c subtype antibodies in the inflammatory nephropathy model mice were also significantly higher than the total IgG levels in wild-type mice. This indicates that IgG2c subtype antibodies have a stronger pathogen-clearing function, and that the inflammatory nephropathy model mice themselves possess stronger anti-infection capabilities.

[0111] 2. Both wild-type mice and mice with inflammatory nephropathy were injected with NP-CGG antigen to perform TD antigen immunization experiments.

[0112] The NP-CGG antigen is a T-cell-dependent antigen (TD antigen), where NP stands for the hapten nitrophenyl and CGG for chicken gamma globulin. Orbital blood was collected from wild-type mice and inflammatory nephropathy model mice weekly before and after TD antigen immunization (continuous sampling until week 11 post-immunization in wild-type mice, and until week 9 post-immunization in inflammatory nephropathy model mice). Serum anti-CGG antibody levels were measured using ELISA. Figure 7 As shown, after immunization with the NP-CGG antigen, the level of anti-CGG antibodies produced by the inflammatory nephropathy model mice against the NP-CGG antigen was comparable to that in wild-type mice. According to... Figure 7 The results indicate that, on the one hand, the cellular immune function of the inflammatory nephropathy model mice is normal, which can assist B cells in recognizing the TD antigen. On the other hand, the inflammatory nephropathy model mice can produce specific IgG2c antibodies against the NP-CGG antigen, and the level of specific antibodies produced is comparable to that of wild-type mice, indicating that the humoral immune function of the inflammatory nephropathy model mice is normal.

[0113] IV. Evaluation of the Inflammatory Nephropathy Model in Mice

[0114] Experimental groups: including wild-type group and inflammatory nephropathy model group. The wild-type group consisted of wild-type mice, and the inflammatory nephropathy model group consisted of inflammatory nephropathy model mice (Ighγ2c type mice) constructed using the above-mentioned inflammatory nephropathy animal model construction method.

[0115] Experimental conditions: Mice in the wild-type group and mice in the inflammatory nephropathy model group were raised under normal pathogen-free conditions.

[0116] Analysis of experimental results:

[0117] 1. Compared with wild-type mice, mice in the inflammatory nephropathy model group died naturally within 20-30 weeks. Figure 8 As shown, mice in the inflammatory nephropathy model group died naturally between 150 and 200 days, while mice in the wild-type group grew normally.

[0118] 2. Compared with the wild-type group, the mice in the inflammatory nephropathy model group had a smaller body weight.

[0119] Mice in the inflammatory nephropathy model group showed reduced food intake, decreased activity, and kyphosis after 20 weeks. Significant weight loss was also observed in the later stages of the disease. Figure 9 The image shows a comparison between the average body weight of mice in the inflammatory nephropathy model group at the point of death and the average body weight of mice in the wild-type group. Figure 9It was found that the average weight of mice in the inflammatory nephropathy model group that were on the verge of death was significantly lower than that of mice in the wild-type group (P < 0.001).

[0120] 3. Compared with the wild-type mice, the mice in the inflammatory nephropathy model group showed significant kidney lesions.

[0121] Autopsies were performed on mice that died naturally in the inflammatory nephropathy model group. The autopsies revealed that while other organs were normal, the kidneys showed significant lesions. Figure 10 As shown, compared with the kidneys of 20-week-old wild-type mice, the kidneys of 20-week-old inflammatory nephropathy model mice were pale, with hemorrhages on the surface and overall atrophy.

[0122] Kidneys of mice in different age groups with inflammatory nephropathy were sampled and analyzed. The results are as follows: Figure 11 As shown in the diagram, based on the results of HE staining, PAS staining, and Masson staining, compared with wild-type mice, at week 5, the kidneys of mice in the inflammatory nephropathy model group showed no obvious lesions; the morphology of renal tubules and glomeruli was normal, but the mesangial matrix showed slight enlargement. At week 10, the glomeruli of the mice in the inflammatory nephropathy model group began to show signs of collapse, and mesangial and parietal epithelial cells proliferated. At week 15, the glomeruli of the mice in the inflammatory nephropathy model group were enlarged and lobulated, the glomerular basement membrane thickened, and varying degrees of mesangial proliferation began to appear, with inflammatory cells infiltrating the tubulointerstitium. At week 20, most glomerular lobes of the mice in the inflammatory nephropathy model group showed sclerosis and mesangial proliferation. The dead mice in the inflammatory nephropathy model group showed diffuse glomerular sclerosis, severe arteriosclerosis, and tubulointerstitial scarring, accompanied by tubular loss and cortical retraction. Figure 11 The yellow arrows indicate crescentic glomeruli, the blue arrows indicate mesangial proliferation, and the green arrows indicate glomerulosclerosis.

[0123] The progressive changes in the kidneys of mice in the inflammatory nephropathy model group indicate that mice with inflammatory nephropathy can spontaneously develop inflammatory nephritis when growing under normal pathogen-free conditions, making them an ideal animal model for inflammatory nephropathy.

[0124] 4. Compared with the wild-type mice, the renal chemical indicators of the mice in the inflammatory nephropathy model group were specifically increased.

[0125] Urine and blood samples were collected from wild-type mice and mice in the inflammatory nephropathy model group. The levels of urinary protein (UP), serum blood urea nitrogen (BUN), and serum creatinine (SCR) in the samples were measured. Figure 12 As shown, compared with wild-type mice, the average level of urinary protein in the inflammatory nephropathy model group increased from week 5 and was significantly higher than that in the wild-type group after week 15 (P < 0.05).Figure 13 As shown, compared with wild-type mice, the average serum urea nitrogen level in the inflammatory nephropathy model group mice significantly increased from week 15 (P < 0.0001), and in the deceased mice, the average serum urea nitrogen level exceeded 100 mmol / L. Figure 14 As shown, compared with wild-type mice, the average serum creatinine level of mice in the inflammatory nephropathy model group began to increase at week 20, reaching a high level in the dead mice in the inflammatory nephropathy model group, which was significantly different from that of wild-type mice of the same age (P < 0.05).

[0126] 5. Compared with the wild-type mice, the levels of immune cells and inflammatory factors in the kidneys of mice in the inflammatory nephropathy model group were increased.

[0127] Flow cytometry was used to analyze kidney cells from 20-week-old wild-type mice and mice in an inflammatory nephropathy model group. Figure 15 (A) shows CD45-positive immune cells in kidney cells (CD45... + The flow cytometry scatter plots showed that the proportion of CD45-positive immune cells in the kidney cells of wild-type mice was 0.87%, while the proportion of CD45-positive immune cells in the kidney cells of mice in the inflammatory nephropathy model group was 2.46%. FIG. 15 (B) shows the percentage and absolute number of CD45-positive immune cells in kidney cells of wild-type mice and mice in the inflammatory nephropathy model group. FIG. 15 The results showed that, compared with the wild-type mice, the proportion (P<0.05) and absolute number (P<0.01) of CD45-positive immune cells in kidney cells were significantly increased in the inflammatory nephropathy model group.

[0128] like FIG. 16 As shown in (A), 0.43% of the CD45-positive immune cells in the wild-type mice were neutrophils; 1.35% of the CD45-positive immune cells in the inflammatory nephropathy model mice were neutrophils, of which Ly6G was a marker. FIG. 16 (B) shows the percentage of neutrophils in CD45-positive immune cells and the absolute number of neutrophils in kidney cells in wild-type mice and mice in the inflammatory nephropathy model group. FIG. 16 The results showed that, compared with the wild-type mice, the kidneys of the mice in the inflammatory nephropathy model group contained a large number of neutrophils.

[0129] FIG. 17As shown in (A), in the wild-type mice, 7.75% of the CD45-positive immune cells were infiltrative macrophages (iMAC) and 38.0% were resident macrophages (rMAC); in the inflammatory nephropathy model mice, 45.0% of the CD45-positive immune cells were infiltrative macrophages (iMAC) and 12.8% were resident macrophages (rMAC). CD11b and F4 / 80 were used as markers. FIG. 17 (B) shows a statistical comparison of the proportion of iMAC in CD45-positive immune cells and the absolute number of iMAC in kidney cells between wild-type mice and mice in the inflammatory nephropathy model group. FIG. 17 As shown in (C), this diagram illustrates the statistical comparison of the percentage of rMAC in CD45-positive immune cells and the absolute number of rMAC in kidney cells between wild-type mice and mice in the inflammatory nephropathy model group. FIG. 17 As shown in (D), this is a schematic diagram comparing the mean fluorescence intensity (MFI) of CD11b in rMAC of wild-type mice and mice in the inflammatory nephropathy model group, using CD11b as a marker. FIG. 17 The results showed that although the proportion of rMAC in the kidney cells of mice in the inflammatory nephropathy model group decreased, the absolute number did not change significantly; and rMAC upregulated the expression level of CD11b, suggesting that rMAC was in an activated state.

[0130] like FIG. 18 As shown, using FMO iso as a control and IgG2c as a marker, the mean fluorescence intensity (MFI) of IgG2c on the surface of rMAC and iMAC cells in wild-type mice and mice in the inflammatory nephropathy model group was detected. The results showed that a large amount of IgG2c was bound to the cell surface of iMAC and rMAC.

[0131] like FIG. 19 The image shows a comparison of the expression levels of inflammatory cytokines TNF-α, IL-1β, and complement C3 in the kidneys of wild-type mice and mice in the inflammatory nephropathy model group, detected by qPCR. The results indicate that the kidneys of mice in the inflammatory nephropathy model group produced large amounts of inflammatory cytokines such as TNF-α, IL-1β, and C3.

[0132] according to FIGS. 15-19As mice aged, a large number of CD45-positive immune cells, including neutrophils and infiltrating macrophages (iMACs), migrated to the kidneys of mice in an inflammatory nephropathy (INN) animal model. Furthermore, while the number of resident macrophages in the kidneys remained unchanged, CD11b expression was upregulated, indicating an activated state. Both infiltrating and resident macrophages had large amounts of IgG2c antibody bound to their surfaces. The increased number of neutrophils and infiltrating macrophages, along with the activation of resident macrophages, ultimately led to the production of large amounts of inflammatory factors in the kidneys, including TNF-α, IL-1β, and complement C3, thereby triggering INN.

[0133] This disclosure also provides an application of the animal model of inflammatory nephropathy constructed by the above-described method in screening drugs for the treatment of inflammatory nephropathy.

[0134] This disclosure also provides an application of the animal model of inflammatory nephropathy constructed by the above method in studying the molecular mechanisms of the occurrence and development of inflammatory nephropathy.

[0135] The inflammatory nephropathy animal model disclosed herein involves knocking out the expression genes corresponding to IgG1, IgG2b, and IgG3 in the immunoglobulin genes, resulting in the animal model expressing only IgG2c. This inflammatory nephropathy animal model can spontaneously develop inflammatory nephropathy and can be used in biomedical fields such as drug screening, efficacy evaluation, and research on the molecular mechanisms of inflammatory nephropathy.

[0136] Other embodiments of this disclosure will readily occur to those skilled in the art upon consideration of the specification and practice of the invention disclosed herein. This application is intended to cover any variations, uses, or adaptations of this disclosure that follow the general principles of this disclosure and include common knowledge or customary techniques in the art not disclosed herein. The specification and examples are to be considered exemplary only, and the true scope and spirit of this disclosure are indicated by the appended claims.

Claims

1. A method for constructing an animal model of inflammatory nephropathy, characterized in that, This includes using the CRIPSR / Cas9 system to knock out the base sequence between the first and second target sites of mouse immunoglobulin genes to obtain an animal model of inflammatory kidney disease; The first target site is located in the Sμ region of the mouse immunoglobulin gene; the second target site is located in the Sγ2c region of the mouse immunoglobulin gene.

2. The method for constructing an animal model of inflammatory nephropathy according to claim 1, characterized in that, Includes the following steps: S1. Based on the first target site of the Sμ region in the immunoglobulin gene, Sμ-gRNA was designed and obtained. The base sequence of the Sμ-gRNA is shown in SEQ ID NO:

5. Based on the second target site in the Sγ2c region of the immunoglobulin gene, Sγ2c-gRNA was designed and obtained. The base sequence of the Sγ2c-gRNA is shown in SEQ ID NO:

15. S2. Simultaneously microinject Cas9 mRNA, Sμ-gRNA and Sγ2c-gRNA to culture and obtain F0 mice. S3. F0 mice were mated with wild-type mice to obtain F1 mice. F1 mice were screened, and F1 heterozygous mice were self-crossed to obtain F2 mice. Homozygous mice were screened from F2 mice, and the genotypes of the selected F2 homozygous mice were identified. The genotype with the base sequence knocked out between the first and second target sites of the immunoglobulin gene is the animal model of inflammatory nephropathy.

3. The method for constructing an animal model of inflammatory nephropathy according to claim 2, characterized in that, In step S3, the screening of F1 mice and the screening of homozygotes from F2 mice are both performed using qPCR detection.

4. The method for constructing an animal model of inflammatory nephropathy according to claim 3, characterized in that, The primers used for the qPCR detection include: Primers with the base sequence SEQ ID NO: 27 and primers with the base sequence SEQ ID NO: 28 are used to identify the Cμ region of the immunoglobulin gene; Primers with the base sequence SEQ ID NO: 31 and primers with the base sequence SEQ ID NO: 32 are used to identify the Cγ1 region of the immunoglobulin gene; The primers used in the qPCR detection also include: Primers with the base sequence SEQ ID NO: 37 and primers with the base sequence SEQ ID NO: 38 are used to identify the Cε region of the immunoglobulin gene; Primers with and / or the base sequence of SEQ ID NO: 39 and the base sequence of SEQ ID NO: 40 are used to identify the Cα region of the immunoglobulin gene.

5. The method for constructing an animal model of inflammatory nephropathy according to claim 2, characterized in that, Step S3, the genotyping of the selected F2 homozygotes is performed using PCR detection; The primers used in the PCR detection include: Primers with the base sequence SEQ ID NO: 27 and primers with the base sequence SEQ ID NO: 28 are used to identify the Cμ region of the immunoglobulin gene; Primers with the base sequence SEQ ID NO: 29 and primers with the base sequence SEQ ID NO: 30 are used to identify the Cγ3 region of the immunoglobulin gene; Primers with the base sequence SEQ ID NO: 31 and primers with the base sequence SEQ ID NO: 32 are used to identify the Cγ1 region of the immunoglobulin gene; Primers with the base sequence SEQ ID NO: 33 and primers with the base sequence SEQ ID NO: 34 are used to identify the Cγ2b region of the immunoglobulin gene; Primers with the base sequence SEQ ID NO: 35 and primers with the base sequence SEQ ID NO: 36 are used to identify the Cγ2c region of the immunoglobulin gene; The primers used in the PCR detection also include: Primers with the base sequence SEQ ID NO: 37 and primers with the base sequence SEQ ID NO: 38 are used to identify the Cε region of the immunoglobulin gene; Primers with and / or the base sequence of SEQ ID NO: 39 and the base sequence of SEQ ID NO: 40 are used to identify the Cα region of the immunoglobulin gene.

6. The method for constructing an animal model of inflammatory nephropathy according to claim 2, characterized in that, In step S2, the simultaneous microinjection of Cas9 mRNA, Sμ-gRNA, and Sγ2c-gRNA to cultivate F0 mice is as follows: Cas9 mRNA, Sμ-gRNA, and Sγ2c-gRNA were simultaneously microinjected into mouse zygotes, and the zygotes were transferred to the oviducts of surrogate mice to obtain F0 mice.

7. The method for constructing an animal model of inflammatory nephropathy according to claim 1, characterized in that, The mice in question were C57BL / 6 mice.

8. An evaluation method for an animal model of inflammatory nephropathy constructed using the construction method described in any one of claims 1-7, characterized in that, The following test results were used to evaluate the animal model of inflammatory nephropathy: PCR was used to identify the genotype of the model animals; biochemical tests were performed on the urinary protein and serum urea nitrogen levels of the model animals.

9. The use of the animal model of inflammatory nephropathy constructed by the construction method according to any one of claims 1-7 in screening drugs for the treatment of inflammatory nephropathy.

10. The application of the animal model of inflammatory nephropathy constructed by the construction method according to any one of claims 1-7 in the study of the molecular mechanisms of the occurrence and development of inflammatory nephropathy.

Images