Construction method and application of spontaneous obesity model of systemic GPX3 knock-gene mouse

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a construction method and application of a spontaneous obesity model of a systemic GPX3 knock-gene mouse. The construction method comprises the following steps: preparing a precisely targeted GPX3 gene, knocking out a gene editing tool mixture of a specific segment (SEQ ID NO.1) of the GPX3 gene, transferring the gene editing tool mixture into a fertilized egg, and mating a mouse until a stably inherited GPX3 gene knockout homozygous mouse is obtained. The GPX3 is knocked out through the CRISPR / Cas9 technology, the spontaneous obese mouse model which cannot be achieved in the prior art is successfully obtained, the model can simulate obesity-related multi-organ lesions and diabetes mellitus progress, and a reliable tool is provided for obesity mechanism research and drug research and development.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and particularly relates to a construction method and application of a spontaneous obesity model of a systemic GPX3 knock-out mouse. BACKGROUND

[0002] Obesity is a complex endocrine and metabolic disease, which is jointly regulated by genetic susceptibility and environmental factors, often accompanied by abnormal eating behavior and energy metabolism disorder, leading to excessive accumulation of fat and abnormal increase of body weight in the body. The disease often complicates with type 2 diabetes, non-alcoholic fatty liver and other metabolic syndromes, and has been listed as one of the top ten chronic diseases in the world by the World Health Organization. At present, the incidence of obesity is rising globally, and the prevention and treatment of obesity has become a major challenge in the field of public health. In the study of obesity mechanism, animal models are still the key bridge connecting molecular discovery and clinical application. The current modeling methods are mainly divided into diet induction and genetic regulation. High-fat diet-induced obesity (DIO) mice are widely used as diet-induced models, and the leptin gene mutation (ob / ob) mice and leptin receptor gene mutation (db / db) mice are the most common genetic regulation models [1] . However, most of these existing models are driven by high food intake, and it is difficult to simulate the specific type of energy metabolism disorder of “low intake but still obese”. Therefore, the development of a spontaneous obesity genetic model independent of high food intake behavior has important technical value for deepening the understanding of the pathogenesis and promoting the development of intervention strategies.

[0003] Glutathione peroxidase 3 (GPX3) is an important selenoprotein that plays a key role in maintaining the redox homeostasis of the body. GPX3 is mainly synthesized by renal tubular epithelial cells and secreted into the circulation, and is involved in the occurrence and development of various kidney diseases [2] . Existing clinical studies and animal experiments have shown that GPX3 is down-regulated in obesity and related metabolic diseases, indicating that it may play a role as an endogenous anti-obesity factor [3-5] . However, adipocyte-specific knockout of GPX3 does not induce spontaneous obesity [6] , indicating that there may be other tissue-derived (such as kidney-secreted) GPX3 to compensate for the function. Therefore, it is of great significance to clarify the systemic effects of systemic GPX3 deletion on obesity, but it is technically dependent on the construction of an effective systemic knockout model.

[0004] The existing technology has disclosed a systemic GPX3 knockout model, which usually targets the deletion of the region of exons 3 to 5 [7-12] . The model shows increased susceptibility to specific stressors [8-12] , but does not have any spontaneous phenotype

[12] , indicating that traditional knockout strategies might retain GPX3 functional residues or compensatory mechanisms. This fundamental limitation makes existing models unsuitable for studying the core function of GPX3 in obesity. In summary, the existing technology cannot provide a GPX3 knockout animal model that directly simulates obesity, restricting related mechanism research and drug development.

[0005] [1] Suriano F, Vieira-Silva S, Falony G, et al. Novel insights into the genetically obese (ob / ob) and diabetic (db / db) mice: two sides of the same coin. Microbiome . 2021;9(1):147. Published 2021 Jun 28. [2] Wu Y, Shi H, Xu Y, et al. Targeted Restoration of GPX3 Attenuates Renal Ischemia / Reperfusion Injury by Balancing Selenoprotein Expression and Inhibiting ROS-mediated Mitochondrial Apoptosis. Transplantation . 2024;108(12):2351-2365. [3] Hauffe R, Stein V, Chudoba C, et al. GPx3 dysregulation impacts adipose tissue insulin receptor expression and sensitivity. JCI Insight . 2020;5(11):e136283. Published 2020 Jun 4. [4] Lee YS, Kim AY, Choi JW, et al. Dysregulation of adipose glutathione peroxidase 3 in obesity contributes to local and systemic oxidative stress. Mol Endocrinol . 2008;22(9):2176-2189. [5] Langhardt J, Flehmig G, Klöting N, et al. Effects of Weight Loss on Glutathione Peroxidase 3 Serum Concentrations and Adipose Tissue Expression in Human Obesity. Obes Facts . 2018;11(6):475-490. [6] Song Y, Zhu M, Islam MA, et al. Glutathione peroxidase 3 is essential for countering senescence in adipose remodelling by maintaining mitochondrial homeostasis. Redox Biol . 2024;77:103365. [7] Olson GE, Whitin JC, Hill KE, et al. Extracellular glutathione peroxidase (Gpx3) binds specifically to basement membranes of mouse renal cortex tubule cells. Am J Physiol Renal Physiol . 2010;298(5):F1244-F1253. [8] Pang P, Abbott M, Abdi M, et al. Pre-clinical model of severe glutathione peroxidase-3 deficiency and chronic kidney disease results in coronary artery thrombosis and depressed left ventricular function. Nephrol Dial Transplant . 2018;33(6):923-934. [9] Kim U, Kim CY, Lee JM, et al. Loss of glutathione peroxidase 3 induces ROS and contributes to prostatic hyperplasia in Nkx3.1 knockout mice. Andrology . 2020;8(5):1486-1493.

[10] Chang SN, Lee JM, Oh H, Park JH. Glutathione Peroxidase 3 Inhibits Prostate Tumorigenesis in TRAMP Mice. Prostate . 2016;76(15):1387-1398.

[11] Covington TA, Pilz PM, Mulhern RM, et al. GPx3 deficiency exacerbates maladaptive right ventricular remodeling in experimental pulmonary artery banding. Am J Physiol Lung Cell Mol Physiol . 2023;324(4):L550-L556.

[12] Jin RC, Mahoney CE, Coleman Anderson L, et al. Glutathione peroxidase-3 deficiency promotes platelet-dependent thrombosis in vivo. Circulation . 2011;123(18):1963-1973. SUMMARY In view of the above, the present application provides a construction method and application of a spontaneous obesity model of a systemic GPX3 knockout mouse, the construction method of the present application can directly and stably simulate spontaneous obesity.

[0006] Terms: In the present application, the term "GPX3 gene" refers to a gene encoding glutathione peroxidase 3 in mice, the core function of which is to maintain the redox homeostasis of the body, and it is expressed in tissues such as the kidney and fat. In the present application, the region containing exon 2 and part of the upstream to exon 5 is targeted for knockout.

[0007] In the present application, the term "primary obesity" refers to obesity caused by internal factors such as genetic factors and metabolic disorders, without being secondary to other diseases such as endocrine diseases and genetic syndromes. The phenotype of primary obesity is not dependent on high food intake or external dietary induction, but still shows excessive accumulation of body fat and abnormal increase in body weight. The model of the present application simulates this type of obesity.

[0008] In the present application, the term "secondary obesity" refers to obesity caused by other diseases such as hypothyroidism and Cushing's syndrome, or specific factors such as long-term drug use and excessive diet. The obesity phenotype of secondary obesity is dependent on the presence of the primary disease or external factors. The model of the present application can be used to study the pathogenesis and intervention methods of this type of obesity.

[0009] In the present application, the term "exon" refers to a DNA segment in a gene that encodes a protein. It is a key region for the expression of a gene as a functional protein. Multiple exons are connected by introns to form a complete gene.

[0010] In the present application, the term "knockout" refers to a technique for precisely deleting a specific segment of a target gene in the genome of an organism through gene editing technology (CRISPR / Cas9 technology in the present application), so that the gene loses the ability to encode a specific functional protein, and ultimately achieves the loss of function of the target gene.

[0011] In the present application, the term "CRISPR / Cas9 technology" refers to a highly efficient and precise gene editing technology. The core consists of Cas9 enzyme (endonuclease) and guide RNA (sgRNA). The sgRNA specifically binds to the target gene sequence, guiding the Cas9 enzyme to cut the DNA at the target region, achieving modification such as knockout and insertion of the gene. The present application uses this technology to delete the specific functional region of the GPX3 gene.

[0012] In the present application, the term "sgRNA" refers to single guide RNA, which is an RNA molecule responsible for specific recognition of target gene sequences in CRISPR / Cas9 technology. It can precisely bind to the upstream and downstream sequences of the GPX3 gene knockout region, guiding the Cas9 enzyme to cut the DNA at the preset site. In the present application, two sgRNAs, gRNA-A1 (SEQ ID NO. 2) and gRNA-A2 (SEQ ID NO. 3), are designed.

[0013] In the present application, the term "homozygous and homozygous or heterozygous mating principle" refers to the mating strategy used to obtain stable hereditary GPX3 gene knockout homozygous mice: GPX3 gene knockout homozygous mice are mated with each other, or GPX3 gene knockout homozygous mice are mated with heterozygous mice, to ensure that homozygous mice are continuously produced in the offspring, and the homozygous phenotype can be stably inherited.

[0014] In the present application, the term "GPX3-KO" refers to a mouse obtained by the construction method of the present application, in which the target fragment of GPX3 gene is completely deleted and the genotype can be stably inherited, the function of GPX3 gene in vivo is lost and the spontaneous obesity phenotype is exhibited. GPX3 KO In the present application, the term "GPX3-KO" refers to a mouse obtained by the construction method of the present application, in which the target fragment of GPX3 gene is completely deleted and the genotype can be stably inherited, the function of GPX3 gene in vivo is lost and the spontaneous obesity phenotype is exhibited.

[0015] In the present application, the term "GPX3-KO" refers to a mouse obtained by the construction method of the present application, in which the target fragment of GPX3 gene is completely deleted and the genotype can be stably inherited, the function of GPX3 gene in vivo is lost and the spontaneous obesity phenotype is exhibited. WT In the present application, the term "GPX3-KO" refers to a mouse obtained by the construction method of the present application, in which the target fragment of GPX3 gene is completely deleted and the genotype can be stably inherited, the function of GPX3 gene in vivo is lost and the spontaneous obesity phenotype is exhibited. GPX3 KO In the present application, the term "GPX3-KO" refers to a mouse obtained by the construction method of the present application, in which the target fragment of GPX3 gene is completely deleted and the genotype can be stably inherited, the function of GPX3 gene in vivo is lost and the spontaneous obesity phenotype is exhibited.

[0016] The technical scheme of the present application is as follows: In one aspect, the present application provides a construction method of a spontaneous obesity model of a systemic GPX3 knockout mouse, which comprises the following steps: S1, preparing a precise targeting GPX3 gene and realizing a gene editing tool mixture for knocking out a specific fragment of GPX3 gene, wherein the sequence of the specific fragment of GPX3 gene is shown in SEQ ID NO. 1; S2, transferring the gene editing tool mixture into a fertilized egg to obtain a standby fertilized egg; S3, transplanting the standby fertilized egg into the oviduct of a surrogate mother mouse to produce a young mouse and obtain F0 generation mice; S4, mating the F0 generation mice with wild type mice of the opposite sex to obtain F1 generation heterozygous mice, and crossing the F1 generation heterozygous mice to obtain F2 generation homozygous mice; S5, mating the F2 generation homozygous mice until GPX3 gene knockout homozygous mice with stable inheritance are obtained.

[0017] Specifically, the preparation method of the gene editing tool mixture in step S1 comprises the following steps: mixing gRNA-A1, gRNA-A2 and Cas9 enzyme, and then incubating to obtain the gene editing tool mixture.

[0018] Preferably, the nucleotide sequence of gRNA-A1 is shown in SEQ ID NO. 2; and the nucleotide sequence of gRNA-A2 is shown in SEQ ID NO. 3.

[0019] Preferably, the amount ratio of gRNA-A1, gRNA-A2 and Cas9 enzyme is 0.8-1.2 poml: 0.8-1.2 poml: 15 ng.

[0020] Further preferably, the use amount ratio of the gRNA-A1, the gRNA-A2 and the Cas9 enzyme is 0.8-0.9, 0.9-1.0, 1.0-1.1 or 1.1-1.2 poml: 0.8-0.9, 0.9-1.0, 1.0-1.1 or 1.1-1.2 poml: 15 ng.

[0021] Still further preferably, the use amount ratio of the gRNA-A1, the gRNA-A2 and the Cas9 enzyme is 1 poml: 1 poml: 15 ng.

[0022] Preferably, the incubation comprises 20-30℃ incubation for 10-20 min.

[0023] Further preferably, the incubation comprises 25℃ incubation for 10 min.

[0024] Specifically, the zygote in step S2 is derived from any one or more of C57BL / 6J mice, BALB / c mice, DBA strain mice, C3H / He mice, nude mice, NOD-SCID mice, Kunming mice.

[0025] Preferably, the zygote in step S2 is derived from C57BL / 6J mice.

[0026] Preferably, the method for obtaining the zygote in step S2 is to select 3-4 week old C57BL / 6J female mice, inject pregnant horse serum, and then inject chorionic gonadotropin at an interval of 48 h. Then the female mice are mated with adult fertile mice of the same strain to fertilize the female mice. The next day, the zygote in the oviduct is collected and placed in a 37℃ constant temperature 5% CO2 incubator for use.

[0027] Specifically, the amount of the gene editing tool mixture introduced in step S2 is: the gene editing tool mixture is introduced into the zygote at a dose of 1.5-2.5 pL per zygote.

[0028] Preferably, the amount of the gene editing tool mixture introduced in step S2 is: the gene editing tool mixture is introduced into the zygote at a dose of 1.5-1.6, 1.6-1.7, 1.7-1.8, 1.8-1.9, 1.9-2.0, 2.0-2.1, 2.1-2.2, 2.2-2.3, 2.3-2.4 or 2.4-2.5 pL per zygote.

[0029] Further preferably, the amount of the gene editing tool mixture introduced in step S2 is: the gene editing tool mixture is introduced into the zygote at a dose of 2 pL per zygote.

[0030] Specifically, the amount of the backup zygotes transplanted in step S3 is 25-30 backup zygotes into the oviduct of the surrogate mother mouse.

[0031] Preferably, the amount of the backup zygotes transplanted in step S3 is 25 backup zygotes into the oviduct of the surrogate mother mouse.

[0032] Preferably, the spontaneous obesity model of the systemic GPX3 knockout mouse exhibits any one or more of the following: (1) The systemic GPX3 knockout mouse increases in weight under normal diet or high-fat diet feeding conditions; (2) The systemic GPX3 knockout mouse shows obvious hypertrophy of adipocytes in subcutaneous fat and visceral fat, and transformation of lipid droplets in brown adipose tissue from a multi-locular form to a single-locular form under normal diet or high-fat diet feeding conditions; (4) The systemic GPX3 knockout mouse shows hyperlipidemia under normal diet or high-fat diet feeding conditions; (5) The systemic GPX3 knockout mouse shows abnormal liver function, liver steatosis, and liver fibrosis under normal diet or high-fat diet feeding conditions; (6) The systemic GPX3 knockout mouse shows increased kidney weight, kidney lipid deposition, kidney fibrosis, or kidney function impairment under normal diet or high-fat diet feeding conditions; (7) The systemic GPX3 knockout mouse shows pancreatic structure remodeling under normal diet or high-fat diet feeding conditions; (8) The systemic GPX3 knockout mouse shows insulin resistance under normal diet feeding conditions; (9) The systemic GPX3 knockout mouse shows insulin resistance and persistent fasting hyperglycemia under high-fat diet feeding conditions; (10) The systemic GPX3 knockout mouse shows a systemic chronic inflammatory state under normal diet or high-fat diet feeding conditions.

[0033] Preferably, the use of the spontaneous obesity model includes any one or more of the following: (1) Studying the pathogenesis of primary obesity or secondary obesity; (2) Studying treatment methods for primary obesity or secondary obesity; (3) Screening drugs or vaccines for treating primary obesity or secondary obesity; (4) Testing the safety and effectiveness of drugs or vaccines for treating primary obesity or secondary obesity.

[0034] In another aspect, the present invention provides the application of any of the above-described methods in constructing a spontaneous obesity model of systemic GPX3 knockout mice.

[0035] Preferably, the spontaneous obesity model can be used for any one or more of the following purposes: (1) To study the pathogenesis of primary obesity or secondary obesity; (2) To study the pathogenesis of primary obesity or the treatment methods for secondary obesity; (3) Screening for drugs or vaccines to treat primary obesity or secondary obesity; (4) Test the safety and efficacy of drugs or vaccines for treating primary or secondary obesity.

[0036] The beneficial effects of this invention are as follows: The core technical effect of this invention is to achieve GPX3 gene knockout by deleting a specific fragment using CRISPR / Cas9 technology, and successfully construct a spontaneously obese mouse model without high food intake dependence. This model can simulate obesity-related multi-organ lesions and the progression of diabetes, providing a reliable tool for obesity mechanism research and drug development.

[0037] Beneficial Effect 1: This invention targets and deletes a key region of the GPX3 gene, including exon 2 and a portion upstream to exon 5 (SEQ ID NO. 1), which is completely different from existing known exon 3 to exon 5 deletion models. This avoids potential functional protein residues and ensures the loss of specific GPX3 function. Verification was conducted at the gene, transcription, and protein levels: homozygous knockout mice ( GPX3 KO The target segment was successfully deleted. The levels of GPX3 mRNA in the kidney and GPX3 protein in the serum were both below the detection limit, and no GPX3 positive signal was found in multiple tissue immunohistochemistry.

[0038] Beneficial Effect 2: The most crucial technical advantage of the spontaneous obesity mouse model constructed in this invention is that it exhibits completely spontaneous obesity characteristics: under conditions without any special dietary intervention (only given conventional basal feed), obesity-related phenotypes can spontaneously appear, thus breaking away from the dependence of existing models on "high food intake" or "high-fat diet induction." Specifically, this is manifested as follows: (1) GPX3 KO Mice from 10 weeks of age had significantly higher body weights than their littermate wild-type counterparts. WT Mice were subjected to various tests, and the weight difference continued to widen with age, reaching a maximum weight of 24 weeks at age 60. WT Approximately 150% of mice developed a stable obesity phenotype.

[0039] (2) Full-process monitoring shows that GPX3 KODaily food intake of mice and WT There was no statistical difference between the mice, which proved that their obesity was not driven by excessive food intake, but by an inherent disorder in energy metabolism itself, simulating primary metabolic abnormal obesity in clinical practice with good diet control; (3) The "spontaneity" of the model is not only limited to obesity itself, but also reflected in the natural occurrence and progression of obesity-related complications. Specifically, the model mice showed spontaneous fat accumulation, hyperlipidemia, and insulin resistance; after high-fat diet intervention, persistent fasting hyperglycemia occurred, and eventually entered the overt diabetic state. This pathological chain completely covers the whole process of obesity from the compensatory stage to the decompensatory stage. At the same time, the model systematically reproduces liver steatosis and fibrosis, kidney lipid deposition and functional impairment, pancreatic structural remodeling, and chronic inflammatory state marked by elevated TNF-α and IL-6, highly consistent with the multi-organ involvement characteristics of clinical complications of obesity.

[0040] (4) The existing obesity animal models have obvious limitations: diet-induced models (such as DIO mice) rely on high-fat diet and cannot simulate "low intake obesity"; traditional genetic models (such as ob / ob and db / db mice) are driven by "high food intake" and do not match some clinical obesity types. The spontaneous phenotype of the present application completely breaks through this limitation, does not require external dietary intervention, eliminates interference factors such as feed composition and food intake, and is more suitable for analyzing the internal molecular mechanisms of "energy metabolism disorder dominant obesity". BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 For the construction of whole-body GPX3 knockout mice; A in the figure is the knockout strategy of the gene knockout mice, the knockout region is between the two "scissors" (specifically targeted by gRNA-A1 and gRNA-A2), and the identification region is between F1-R1; B is the PCR identification banding chart of the mouse tail genomic DNA, water represents the negative control without template; C is the relative level of mouse kidney GPX3 mRNA (n=7); D is the relative level of mouse serum GPX3 protein (n=7); in the figure GPX3 KO For homozygous GPX3 knockout mice, WT For littermate wild-type mice (specifically refers to mice derived from the same litter but with complete GPX3 genes); E is the Sanger sequencing result of the tail DNA of the F0 generation of whole-body GPX3 knockout mice; the red bold solid line specifically refers to the missing part; in the figure, **** represents a significant difference between groups (P<0.0001). P <0.0001).

[0042] Figure 2Figure 1 is the result of immunohistochemical analysis of GPX3 in the kidney, brain (choroid plexus), liver, subcutaneous fat, visceral fat, and brown fat of mice; A is the immunohistochemical staining of GPX3 protein, from left to right are the kidney, brain (choroid plexus), liver, subcutaneous fat, visceral fat, and brown fat of mice; B is the relative amount of positive area of GPX3 protein, n = 7; **** represents a significant difference between groups (P < 0.0001). GPX3 KO Figure 2 is the result of immunohistochemical analysis of GPX3 in the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; A is the immunohistochemical staining of GPX3 protein, from left to right are the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; B is the relative amount of positive area of GPX3 protein, n = 7; **** represents a significant difference between groups (P < 0.0001). WT Figure 3 is the result of immunohistochemical analysis of GPX3 in the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; A is the immunohistochemical staining of GPX3 protein, from left to right are the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; B is the relative amount of positive area of GPX3 protein, n = 7; **** represents a significant difference between groups (P < 0.0001). P <0.0001).

[0043] Figure 3 Figure 4 is the result of immunohistochemical analysis of GPX3 in the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; A is the immunohistochemical staining of GPX3 protein, from left to right are the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; B is the relative amount of positive area of GPX3 protein, n = 7; **** represents a significant difference between groups (P < 0.0001). GPX3 KO Figure 5 is the result of immunohistochemical analysis of GPX3 in the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; A is the immunohistochemical staining of GPX3 protein, from left to right are the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; B is the relative amount of positive area of GPX3 protein, n = 7; **** represents a significant difference between groups (P < 0.0001). WT Figure 6 is the result of immunohistochemical analysis of GPX3 in the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; A is the immunohistochemical staining of GPX3 protein, from left to right are the stomach, duodenum, ileum, soleus muscle, and epididymis of mice; B is the relative amount of positive area of GPX3 protein, n = 7; **** represents a significant difference between groups (P < 0.0001). P <0.001); **** represents a significant difference between groups (P < 0.0001). P <0.0001).

[0044] Figure 4 Figure 7 is the result of whole-body GPX3 deficiency causing spontaneous obesity in mice; A is the feeding cycle of mice and the appearance of mice at the age of 24 weeks, the ruler is 1 cm; B is the body weight of mice, 7 ≤ n ≤ 15; C is the daily food intake of mice, n = 7; D is the appearance (left) and weight (right) of subcutaneous fat and visceral fat of mice, the ruler is 1 cm, n = 7; E is the HE staining of subcutaneous fat, visceral fat, and brown fat of mice, the ruler is 100 μm; F is the content of serum triglyceride, free fatty acid, and cholesterol of mice, n = 7; ** represents a significant difference between groups (P < 0.01). P <0.01); *** represents a significant difference between groups (P < 0.001). P <0.001); **** represents a significant difference between groups (P < 0.0001). P <0.0001).

[0045] Figure 5Results of organology analysis of spontaneous obesity and related metabolic disorders induced by systemic GPX3 deletion in mice; A, appearance of mouse liver (left) and its weight (right), scale bar, 1 cm; B, contents of alanine aminotransferase (left) and aspartate aminotransferase (right) in mouse serum, n = 7; C, content of triglyceride in mouse liver, n = 7; D, HE staining (left) and Masson staining (right) of mouse liver, scale bar, 100 μm; E, appearance of mouse kidney (left) and its weight (right), scale bar, 1 cm; F, contents of creatinine (left) and urine albumin / urine creatinine ratio (right) in mouse serum, n = 7; G, content of triglyceride in mouse kidney, n = 7; H, HE staining (left) and Masson staining (right) of mouse kidney, scale bar, 100 μm; I, appearance of mouse pancreas, scale bar, 1 cm; J, HE staining of mouse pancreas, scale bar, 100 μm; K, glucose tolerance test (left) and insulin tolerance test (right) of mouse, n = 7; L, fasting blood glucose content of mouse, n = 7; M, contents of IL-6 (left) and TNF-α (right) in mouse serum, n = 7; *, significant difference between groups (P < 0.05); **, significant difference between groups (P < 0.01); ***, significant difference between groups (P < 0.001); ****, significant difference between groups (P < 0.0001). P P P P

[0046] Figure 6 Results of aggravation of obesity in GPX3 deletion mice by high-fat diet; A, feeding cycle of mouse and appearance of mouse body shape at 24 weeks of age, scale bar, 1 cm; B, body weight of mouse, n = 7; C, daily food intake of mouse, n = 7; D, appearance (left) and weight (right) of subcutaneous fat and visceral fat of mouse, scale bar, 1 cm, n = 7; E, HE staining of subcutaneous fat, visceral fat and brown fat of mouse, scale bar, 100 μm; F, contents of triglyceride, free fatty acid and cholesterol in serum of mouse, n = 7; ns, no significant difference between groups (P > 0.05); **, significant difference between groups (P < 0.01); ****, significant difference between groups (P < 0.0001). P P P

[0047] Figure 7 ​​​​​​​This image shows the organological analysis of the results of a high-fat diet accelerating the progression of diabetes and end-organ damage in GPX3-deficient mice. Figure A shows the appearance (left) and weight (right) of the mouse liver, with a scale bar of 1 cm. Figure B shows the serum alanine aminotransferase (left) and aspartate aminotransferase (right) levels, n=7. Figure C shows the triglyceride content in the mouse liver, n=7. Figure D shows HE staining (left) and Masson staining (right) of the mouse liver, with a scale bar of 100 μm. Figure E shows the appearance (left) and weight (right) of the mouse kidney, with a scale bar of 1 cm. Figure F shows the serum creatinine content (left). The figures show the following: ) and urine albumin / creatinine ratio (right), n=7; G represents the triglyceride content in mouse kidneys, n=7; H represents HE staining (left) and Masson staining (right) of mouse kidneys, with the scale bar at 100 μm; I represents the appearance of mouse pancreas, with the scale bar at 1 cm; J represents HE staining of mouse pancreas, with the scale bar at 100 μm; K represents the glucose tolerance test (left) and insulin tolerance test (right) of mice; L represents the fasting blood glucose level of mice; M represents the serum IL-6 level (left) and TNF-α level (right) of mice, n=7; ** in the figure represent significant differences between groups. P <0.01); *** in the figure represent significant differences between groups ( P <0.001); **** in the figure represents a significant difference between groups ( P <0.0001).

[0048] Figure 8 The results show that GPX3 deficiency inhibits lipolysis and thermogenesis in mice; A in the figure represents differentially expressed proteins between groups in mouse serum ultra-deep proteomic analysis, and W represents... WT Group, KO representative GPX3 KO Group, HW representative WT +HFD Group, HKO Representative GPX3 KO +HFD group; B represents KEGG analysis of differentially expressed proteins; C represents mouse serum non-targeted quantitative lipid analysis of differentially expressed lipids among groups; W represents... WT Group, KO representative GPX3 KO Group, HW representative WT +HFD Group, HKO Representative GPX3 KO +HFD group; D represents KEGG analysis of differentially expressed lipids; EF represents the relative mRNA expression levels of UCP1 in subcutaneous and brown adipose tissue, and ATGL and HSL in subcutaneous, visceral, and brown adipose tissue, n=7. * in the figure indicates significant differences between groups. P <0.05); ** in the figure represent significant differences between groups ( P<0.01); *** in the figure represent significant differences between groups ( P <0.001); **** in the figure represents a significant difference between groups ( P <0.0001). Detailed Implementation

[0049] The following non-limiting embodiments are intended to enable those skilled in the art to gain a more comprehensive understanding of the present invention, but do not limit the invention in any way. The following content is merely an exemplary description of the scope of protection claimed by the present invention, and those skilled in the art can make various changes and modifications to the present invention based on the disclosed content, and such changes should also fall within the scope of protection claimed by the present invention.

[0050] The present invention will be further described below by way of specific embodiments. Unless otherwise specified, all instruments, devices, equipment, reagents, products, etc., used in the embodiments of the present invention are obtained through conventional commercial means.

[0051] Example 1: Construction of systemic GPX3 gene knockout mice In this embodiment, a systemic GPX3 gene knockout mouse was constructed using CRISPR / Cas9 technology.

[0052] 1. Gene sequence localization and knockout region determination Based on the NCBI sequence number (NM_008161) and Ensembl number (ENSMUST00000082430) of the GPX3 gene, the complete sequence of the gene in the mouse genome (including exons, introns, promoters, etc.) was obtained from the database. The knockout range was determined: the target region was the area including exon 2 and up to part of exon 5 (gene knockout mouse knockout strategy as follows). Figure 1 (As shown in A in SEQ ID NO. 1). The sequence comprising exon 2 and a portion of the region upstream to exon 5 is shown in SEQ ID NO. 1: SEQ ID NO.1 (5'→3'):

[0053] 2. sgRNA design Two sgRNAs (gRNA-A1 and gRNA-A2) were designed targeting the upstream (near exon 2) and downstream (near part of exon 5) regions of the knockout region to ensure that the entire sequence of exons 2-4 and part of exon 5 of the mouse GPX3 gene can be knocked out after cleavage.

[0054] gRNA-A1 (SEQ ID NO.2): CCTGGGCTAGGTGACCAGGAAGG; gRNA-A2 (SEQ ID NO. 3): CAATTGTCACGTGTCCAGTGG.

[0055] 3. Construction of spare fertilized eggs S1. Prepare gRNA-A1 and gRNA-A2 (synthesized by GenScript), and prepare Cas9 enzyme (purchased from NEB, catalog number M0646M). S2. Using sterile, enzyme-free water as the dilution system, mix gRNA-A1 (1 pmol / μL), gRNA-A2 (1 pmol / μL), and Cas9 enzyme (15 ng / μL) in a 20 μL dilution system and incubate at 25°C for 10 min to form a ribonucleic acid protein (RNP) complex, i.e., a gene editing tool mixture. S3. Select 3-4 week old C57BL / 6J female mice, inject them with pregnant mare serum, and then inject them with human chorionic gonadotropin (hCG) 48 hours later. Then, mate the female mice with adult, fertile male mice of the same strain to achieve fertilization. The next day, collect the fertilized eggs from the oviducts and place them in a 37°C, 5% CO2 incubator for later use. S4. The RNP complex (gene editing tool mixture) obtained in step S2 was transferred into the fertilized egg in step S3 by electrotransfection at a dose of 2 pL / fertilized egg to obtain multiple spare fertilized eggs.

[0056] 4. Microinjection and genotyping (1) Twenty-five spare fertilized eggs were transferred into the oviducts of surrogate mother mice, resulting in the birth of pups. One week after birth, DNA was extracted from the tails of the pups, and PCR identification was performed using the following primers, and Sanger sequencing was performed using the following sequencing primers to obtain F0 generation mice: PCR identification primers: F1 (SEQ ID NO.4): 5'-TATGCTCCTTCCCTCATTCTCCTG-3'; R1 (SEQ ID NO.5): 5'-CCCCAAGAATGATGTTCAGGTTTG-3'; Sanger sequencing primers (SEQ ID NO.6): 5'-TATGCTCCTTCCCTCATTCTCCTG-3'; like Figure 1 As shown in E, after comparison with the original genome, the deleted region (3056bp) is consistent with the designed deletion SEQ ID NO.1.

[0057] (2) F0 generation mice were mated with wild-type mice of the opposite sex to obtain F1 generation heterozygous mice. F1 generation heterozygous mice were then crossed to obtain F2 generation homozygous mice. Based on the principle of pairing homozygotes with homozygotes or heterozygotes, this process was repeated until stable GPX3 gene knockout homozygous mice were obtained. PCR identification was performed using the following primers: F1 (SEQ ID NO.4) and R1 (SEQ ID NO.5).

[0058] If it is a band of approximately 428 bp, it indicates a positive homozygote. GPX3 KO If it is a band of approximately 3484, it is a wild-type from the same nest ( WT ) control mice. PCR identification using tail genomic DNA was performed on wild-type mice from the same litter. WT A specific band of approximately 3484 bp was detected in mice, while in homozygous GPX3 knockout mice... GPX3 KO A deletion band of approximately 428 bp was detected in mice. Figure 1 (B in the text) confirms that the target segment has been successfully deleted.

[0059] 5. Verification of the systemic knockout effect of GPX3 at the transcriptional and protein levels. The systemic knockout effect of GPX3 was further verified at the transcriptional and protein levels. The methodological steps are as follows: (1) Selected after gene identification GPX3 KO Mice (male) and WT Male mice were housed in SPF-grade laminar flow animal rooms, provided with sterilized conventional animal feed (Chow) and sterile water, with free access to food and water. The room temperature was 20-26℃; the daily temperature difference was ≤4℃; the relative humidity was 40%-70%, and the lighting was provided in a half-day and half-night cycle.

[0060] (2) at GPX3 KO mice and WT At 8 weeks of age, mouse kidneys were collected, and total RNA was extracted. Primer information for GPX3 mRNA was as follows: F (SEQ ID NO.7): 5'-AGGAGATGTGAACGGGGAGA-3'; R (SEQ ID NO. 8): 5'-TTGACGTTGCTGACTGTGGT-3'.

[0061] GPX3 mRNA expression was analyzed by RT-PCR; mouse serum was collected and GPX3 protein levels were analyzed by ELISA (using commercially available kits such as Abcam). Mouse kidneys, brain (choroid plexus), liver, subcutaneous fat, visceral fat, brown fat, stomach, duodenum, ileum, and soleus muscle were collected, prepared into paraffin sections, and GPX3 protein levels were detected by immunohistochemical staining (using commercially available kits such as Abcam).

[0062] RT-PCR results showed that, compared with WT Compared to mice, GPX3 KO The mRNA level of GPX3 in mouse kidney tissue was below the detection limit. Figure 1 (C in the text). ELISA testing also showed that... GPX3 KO GPX3 protein was also undetectable in mouse serum. Figure 1 (D in the text). Furthermore, immunohistochemical analysis showed that... WT Significant positive signals were observed in the kidneys, brain (choroid plexus), liver, subcutaneous fat, visceral fat, brown fat, stomach, duodenum, ileum, and soleus muscle of mice—organs or tissues known to contain GPX3 protein. GPX3 KO This signal was relatively lost in mice ( Figures 2-3 ).

[0063] The above results confirm, from multiple levels including gene, transcription and protein, that this invention has successfully constructed a systemic GPX3 gene knockout mouse model.

[0064] Example 2: Effects of systemic GPX3 gene knockout mice on the development and progression of obesity 1. Experimental Methods Based on the gene knockout mouse model constructed in Example 1, the effects of systemic GPX3 gene knockout mice on the development and progression of obesity were investigated. The methods and steps are as follows: Selected after gene identification GPX3 KO Mice and littermates WT Mice were housed in SPF-grade laminar flow animal rooms, provided with sterilized conventional animal feed (Chow) and sterile water, with free access to food and water. The room temperature was 20-26℃; the daily temperature difference was ≤4℃; the relative humidity was 40%-70%, and the lighting was provided in a half-day and half-night cycle.

[0065] Furthermore, based on GPX3 KO The mice weighed more WT The increase in mice began at 10 weeks of age, and the difference was more pronounced at 16 weeks of age. Figure 4 The discovery of B) in the study, at 16 weeks of age GPX3 KO mice and WT The mice were divided into four groups, with seven mice in each group. One group... GPX3 KO mice and WT The mice continued to be given a normal diet, while another group... GPX3 KO mice and WT Mice were fed a high-fat diet (HFD) containing 60% fat for energy. Mouse body weight, food intake, and fasting blood glucose were recorded. Body weight was recorded weekly from 2 weeks of age until 24 weeks of age; food intake and fasting blood glucose were recorded every four weeks from 8 weeks of age until 24 weeks of age.

[0066] Starting at 24 weeks of age, mice underwent glucose tolerance test (GTT) and insulin tolerance test (ITT); mouse urine was collected, and the urine albumin / creatinine ratio (UACR) was measured and calculated.

[0067] At 24 weeks of age, mouse serum was collected. One portion was used to assess alanine aminotransferase (ALT), aspartate aminotransferase (AST), serum creatinine (Scr), blood urea nitrogen (BUN), free fatty acids (FFA), cholesterol, and triglyceride levels; the other portion was used for ultra-deep blood proteomics and non-targeted quantitative lipidomics analysis. Subcutaneous fat, visceral fat, and brown adipose tissue were collected from mice, and a portion was analyzed using RT. The relative expression levels of lipid metabolism-related gene mRNAs were detected by PCR, and another portion was prepared into paraffin sections for hematoxylin-eosin (HE) staining to observe fatty liver lesions. Mouse livers were collected; one portion was analyzed for triglyceride content using ELISA, and the other portion was prepared into paraffin sections for HE and Masson staining to observe liver lesions. Mouse kidneys were collected; one portion was analyzed for triglyceride content using ELISA, and the other portion was prepared into paraffin sections for HE and Masson staining to observe kidney lesions. Mouse pancreas was collected, prepared into paraffin sections, and stained with HE to observe pancreatic lesions.

[0068] 2. Experimental Results 2.1 Systemic GPX3 deficiency induces spontaneous obesity and related metabolic disorders in mice. Under standard diet (Chow) feeding conditions, GPX3KO Mice weighed significantly more than their littermates from 10 weeks of age. WT The differences were more significant in control mice at 16 weeks of age and reached [a certain level] at 24 weeks of age. WT Approximately 150% of the mouse's body weight ( Figure 4 (A and B in the text), but there was no difference in food intake ( Figure 4 C in the middle). Body composition analysis showed that, GPX3 KO The subcutaneous fat and visceral fat weight of mice were both lower than those of mice. WT Mice increased ( Figure 4 (D in the text). Furthermore, with... WT Mouse comparison, GPX3 KO Adipocytes in the subcutaneous and visceral fat of mice showed significant hypertrophy. Lipid droplets in brown adipose tissue transformed from a multilocular to a unilocular morphology. Figure 4 (E in the text). Serological testing further suggests that... GPX3 KO Mice exhibited hyperlipidemia, characterized by elevated levels of triglycerides, free fatty acids, and cholesterol. WT Mice rise ( Figure 4 (F in the text).

[0069] Further organological analysis revealed pathological changes in multiple organs. Although there was no significant difference in liver weight ( Figure 5 (A in the middle), but GPX3 KO The mice exhibited abnormal liver function (elevated serum transaminase levels). Figure 5 B) Hepatic steatosis (elevated triglyceride levels in the liver) Figure 5 C in the middle), and early signs of fibrosis ( Figure 5 (D in the text). Regarding the kidneys, this manifests as weight gain (…). Figure 5 E), lipid deposition (increased triglyceride content) Figure 5 G in the middle), and obvious fibrosis ( Figure 5 (H in the figure). Although serum creatinine and blood urea nitrogen levels are still within the normal range, the urine protein / creatinine ratio has increased (F in 5), indicating early renal impairment. The pancreas has also undergone structural remodeling, manifested as overall organ enlargement (5I in the figure) and interstitial edema (H in the figure). Figure 5 (J in the text). At the functional level, glucose tolerance tests and insulin tolerance tests indicate... GPX3 KO Mice developed insulin resistance ( Figure 5 (K in the middle), but during this period their fasting blood glucose remains normal ( Figure 5 (L in the middle). Furthermore, GPX3 KO The mice also showed elevated serum TNF-α and IL-6 levels.Figure 5 The presence of M indicates a systemic chronic inflammatory state.

[0070] In summary, systemic GPX3 deficiency can lead to spontaneous obesity in mice, accompanied by insulin resistance, multi-organ lesions, and systemic inflammation.

[0071] 2.2 High-fat diets accelerate the progression of diabetes and end-organ damage in GPX3-deficient mice. To investigate the compensatory limits under metabolic stress, this invention implemented an 8-week high-fat diet (HFD) intervention in 16-week-old mice. The results showed that, compared with littermates... WT Compared with mice, the HFD diet significantly aggravated the effects of HFD. GPX3 KO The obesity phenotype in mice is characterized by increased body weight, fat mass, adipocyte hypertrophy, and further exacerbation of hyperlipidemia. Figure 6 ).

[0072] More importantly, the HFD diet makes GPX3 KO The mice rapidly transitioned from the compensated phase to the decompensated phase and developed diabetes. WT Compared to mice, under HFD intervention, GPX3 KO Mice exhibited impaired glucose tolerance and severe insulin resistance, along with persistent fasting hyperglycemia (>200 mg / dL). Pancreatic analysis revealed a transition from relative enlargement to relative atrophy, accompanied by significant loss of pancreatic parenchyma. The liver showed severe steatosis and fibrosis. Kidney damage progressed to renal insufficiency, with elevated serum creatinine and blood urea nitrogen levels, severe proteinuria, and tissue fibrosis. Systemic inflammation was also further exacerbated. Figure 7 ).

[0073] The above results indicate that GPX3-deficient mice rapidly progress to diabetes under high-fat diet intervention, accompanied by severe multi-organ complications.

[0074] 2.3 GPX3 deficiency inhibits lipolysis and thermogenesis in mice To elucidate the mechanism of action of GPX3 in the development of obesity, this invention investigated the effects of a conventional diet (Chow) and a high-fat diet (HFD) on individuals fed with these diets. GPX3 KO mice and WT Serum samples from mice (four groups in total) underwent ultra-deep blood proteomics and non-targeted quantitative lipidomics analysis. In proteomics, differentially expressed proteins were screened at a 1.5-fold difference threshold, identifying a total of 829 common differentially expressed proteins across the four groups. Figure 8 A in the text). KEGG enrichment analysis showed that these proteins were mainly enriched in the "thermogeneity"-related pathway (…). Figure 8(B in the text). In lipidomics, differentially expressed lipids were screened using a 2-fold difference threshold, and a total of 68 common differentially expressed lipids were found across the four groups. Figure 8 C in fat is mainly enriched in the pathways of "thermogenesis", "lipolysis", and "fat digestion and absorption". Figure 8 (D in the middle).

[0075] Based on the above omics results, RT-PCR was used to detect the mRNA expression of the key thermogenesis gene (UCP1) in subcutaneous and brown adipose tissue of mice in each group, as well as the key lipolysis genes (ATGL and HSL) in subcutaneous, visceral, and brown adipose tissue. The results showed that, regardless of whether under a conventional (Chow) diet or a high-fat (HFD) diet, the expression of thermogenesis genes (UCP1) in subcutaneous and brown adipose tissue of mice in each group was significantly reduced. WT Compared to mice, GPX3 KO UCP1 expression was significantly downregulated in both subcutaneous and brown adipose tissue of mice; meanwhile, ATGL and HSL expression was also significantly decreased in visceral adipose tissue, while no significant difference was observed in subcutaneous and brown adipose tissue. Figure 8 (EF in the text).

[0076] These results indicate that GPX3 deficiency inhibits the thermogenesis of subcutaneous and brown adipose tissue and the breakdown of visceral fat, which may be the main reason for systemic fat accumulation.

[0077] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A method for constructing a spontaneous obesity model in systemic GPX3 knockout mice, characterized in that, The construction method includes the following steps: S1. Prepare a mixture of gene editing tools that precisely target the GPX3 gene and knock out a specific fragment of the GPX3 gene, wherein the sequence of the specific fragment of the GPX3 gene is shown in SEQ ID NO.1; S2. The gene editing tool mixture is transferred into the fertilized egg to obtain a spare fertilized egg; S3. Spare fertilized eggs are transferred into the oviduct of a surrogate mother mouse, resulting in the birth of pups and the generation of F0 mice. S4 and F0 generation mice were mated with wild-type mice of the opposite sex to obtain F1 generation heterozygous mice. F1 generation heterozygous mice were then crossed to obtain F2 generation homozygous mice. S5 and F2 generation homozygous mice were mated until stable GPX3 gene knockout homozygous mice were obtained.

2. The construction method according to claim 1, characterized in that, The preparation method of the gene editing tool mixture described in step S1 includes the following steps: mixing gRNA-A1, gRNA-A2, and Cas9 enzyme and incubating to obtain the gene editing tool mixture; the nucleotide sequences of gRNA-A1 and gRNA-A2 are shown in SEQ ID NO.2-3.

3. The construction method according to claim 2, characterized in that, The ratio of gRNA-A1, gRNA-A2, and Cas9 enzymes used is 0.8-1.2 poml: 0.8-1.2 poml: 15 ng.

4. The construction method according to claim 2, characterized in that, The incubation process includes incubation at 20-30℃ for 10-20 minutes.

5. The construction method according to claim 1, characterized in that, The fertilized eggs mentioned in step S2 are derived from any one or more of the following: C57BL / 6J mice, BALB / c mice, DBA mice, C3H / He mice, nude mice, NOD-SCID mice, and Kunming mice.

6. The construction method according to claim 1, characterized in that, The amount of gene editing tool mixture introduced in step S2 is 1.5-2.5 pL per fertilized egg.

7. The construction method according to claim 1, characterized in that, The number of spare fertilized eggs to be transferred in step S3 is 25-30 spare fertilized eggs to the oviduct of the surrogate mother mouse.

8. The construction method according to claim 1, characterized in that, The spontaneous obesity model of the whole-body GPX3 knockout mouse includes any one or more of the following: (1) Under normal or high-fat diet conditions, the body weight of systemic GPX3 knockout mice increased; (2) Under normal or high-fat diet conditions, the adipocytes in the subcutaneous fat and visceral fat of the systemic GPX3 knockout mice showed obvious hypertrophy, and the lipid droplets in the brown adipose tissue changed from multilocular to single-locular morphology. (4) Under normal or high-fat diet conditions, systemic GPX3 knockout mice exhibited hyperlipidemia; (5) Under normal or high-fat diet conditions, systemic GPX3 knockout mice showed abnormal liver function, hepatic steatosis and liver fibrosis. (6) Under normal or high-fat diet conditions, systemic GPX3 knockout mice showed increased kidney weight, kidney lipid deposition, kidney fibrosis or kidney function impairment. (7) Under normal or high-fat diet conditions, systemic GPX3 knockout mice showed pancreatic structural remodeling; (8) Under normal dietary conditions, systemic GPX3 knockout mice exhibited insulin resistance; (9) Under high-fat diet conditions, systemic GPX3 knockout mice exhibited insulin resistance and persistent fasting hyperglycemia; (10) Under normal or high-fat diet conditions, systemic GPX3 knockout mice exhibited a state of systemic chronic inflammation.

9. The application of the construction method according to any one of claims 1-8 in constructing a spontaneous obesity model of systemic GPX3 knockout mice.

10. The application according to claim 9, characterized in that, The spontaneous obesity model described herein can be used for any one or more of the following purposes: (1) To study the pathogenesis of primary obesity or secondary obesity; (2) To study the pathogenesis of primary obesity or the treatment methods for secondary obesity; (3) Screening for drugs or vaccines to treat primary obesity or secondary obesity; (4) Test the safety and efficacy of drugs or vaccines for treating primary or secondary obesity.

Images