Goose parvovirus Real-time RPA (recombinase polymerase amplification) detection primer, probe and detection method

Abstract

The invention discloses a primer and a probe for real-time RPA (recombinase polymerase amplification) detection of goose parvovirus and a detection method. The primer comprises an upstream primer G-F1 and a downstream primer G-R1, the sequences of the upstream primer G-F1 and the downstream primer G-R1 are as shown in SEQ ID No.1-2, the probe is an Exo probe, and the sequence of the Exo probe is as shown in SEQ ID No.3. The detection limit of the detection method established by using the primer and the probe is as low as 3.0 * 10 < 1 > copy number / mu L, cross reaction with other waterfowl viruses is avoided, the clinical coincidence rate reaches 98.1%, detection is completed within 30 min in the whole process, a thermal cycler is not needed, and the method is suitable for field application. The matched kit comprises a primer pair, a probe and an RPA basic reagent, is simple and convenient to operate and controllable in cost, can be used for rapid diagnosis and epidemiological monitoring of GPV classical strains and variants (MDGPV and SBDSV), and has important application value.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of nucleic acid detection, and particularly relates to a primer and a probe for real-time RPA (Real-time recombinase polymerase amplification) detection of goose parvovirus and a detection method. BACKGROUND

[0002] Goose parvovirus (GPV) is an important pathogenic virus that endangers the waterfowl industry, and can cause an acute, contagious, septicemic infectious disease, mainly attacking 4-20-day-old goslings and ducklings, and easily causing acute enteritis and inflammation of organs such as heart, liver and kidney. The disease has strong infectivity, high morbidity and mortality, and irregular sporadic prevalence, causing huge economic losses to the poultry industry and seriously restricting the healthy development of the poultry industry. It belongs to the Dependoparvovirus of the Parvoviridae family, is a non-enveloped single-stranded DNA virus, contains a positive strand DNA and a negative strand DNA virus particle number, and the genome size is about 5.0 kb, which is composed of two open reading frames (ORF) on the left and right sides. The left ORF (LORF) encodes non-structural proteins (NS) NS1 and NS2, and the right ORF (RORF) encodes three structural proteins (viral capsid protein, VP) VP1, VP2 and VP3. The NS protein and the VP protein have a common carboxyl end, forming a nested structure. Like other autonomous parvoviruses, the NS protein of GPV is involved in the regulation of viral replication and the pathogenic process, while the VP protein is responsible for the packaging of single-stranded viral daughter DNA to form infectious daughter virus particles.

[0003] GPV can cause Derzsy disease in goslings and ducklings, with a mortality rate of more than 50% in acute outbreaks; in recent years, variant strains of GPV (such as SBDSV causing short-beak dwarf syndrome, and MDGPV, a duck-derived recombinant strain) continue to appear, with chronic growth retardation and decreased production performance as the main clinical symptoms, and the traditional vaccine has low cross-protection rate, further exacerbating industry losses. Therefore, establishing an early and accurate GPV detection technology is a key prerequisite for disease prevention and control.

[0004] The existing GPV nucleic acid detection technology has obvious limitations:

[0005] Conventional PCR / fluorescence PCR (qPCR): relying on precise thermal cycler, going through "denaturation-annealing-extension" temperature cycle (95℃ pre-denaturation, 35 cycles of temperature switching), high equipment cost, complex operation, and long reaction time (≥1h), which cannot meet the on-site detection needs of farms;

[0006] Loop-mediated isothermal amplification (LAMP): although no thermal cycler is needed, 4-6 specific primers need to be designed, which is difficult, and false positives may occur due to non-specific binding between primers, which is not stable for clinical application;

[0007] Existing RPA technology: the reported GPV-RPA method needs to combine vertical flow test strips, CRISPR / Cas12a or Pyrococcus furiosus argonaute protein (PfAgo protein) and other auxiliary components, and needs additional post-processing steps (such as nucleic acid hybridization and enzyme cutting), which not only prolongs the detection time (≥30min), but also increases the operation complexity and cost, making it difficult to popularize and apply.

[0008] In view of the above technical problems, the present application aims to develop a real-time RPA detection technology without a thermal cycler, without additional auxiliary components, fast and high specificity, by optimizing primer probe design and reaction system, to realize the "sampling-detection-interpretation" integrated on-site diagnosis of GPV, and to fill the gap between the existing technology in convenience and accuracy. SUMMARY

[0009] The purpose of the present application is to overcome the technical defects of the existing GPV detection technology, such as "high dependence on equipment, complex operation, and long time-consuming", to provide a primer and probe for goose parvovirus Real-time RPA detection, a detection method and a matching kit, to meet the GPV detection needs of farms, grass-roots veterinary stations and other on-site scenes, and to realize the detection accuracy comparable to qPCR.

[0010] The purpose of the present application is achieved by the following technical solutions:

[0011] The technical solution of the present application is based on the highly conserved region of GPV VP1 gene, and specific primer pairs and Exo probes are designed to construct a real-time RPA reaction system, and the amplification process is monitored in real time by fluorescence signal to realize the qualitative and quantitative detection of GPV.

[0012] Specifically includes the following core content:

[0013] The present application provides a primer and probe for goose parvovirus Real-time RPA detection, the primer includes upstream primer G-F1 and downstream primer G-R1, and the sequences are respectively:

[0014] Upstream primer G-F1: 5'-CAGGCAGTATCTCCTACAACCCGGACCTGTG-3' (SEQ ID No. 1),

[0015] Downstream primer G-R1: 5'-CAAGAACATCAAGATCTGAACTCGTAGGAGC-3' (SEQ ID No. 2);

[0016] The probe is an Exo probe, and the sequence is:

[0017] 5'-TCTGGCAGCACTACAGCAGGAATAAGTGA[FAM-dT][THF][BHQ1-dT]TATGGTCACGGACG-C3-3' (SEQ ID No. 3), wherein the 31st base "A" from the 5' end of the Exo probe is replaced with THF (tetrahydrofuran), the base upstream of the THF site is labeled with a FAM fluorescent group, the base downstream of the THF site is labeled with a BHQ1 quenching group, and the 3' end is labeled with a C3 spacer to block polymerase extension and avoid non-specific amplification.

[0018] The application further provides application of the primer and the probe in preparation of a reagent or kit for detecting goose parvovirus.

[0019] The application further provides a reagent for Real-time RPA detection of goose parvovirus, wherein the reagent comprises the primer and the probe.

[0020] The application further provides a kit for Real-time RPA detection of goose parvovirus, wherein the kit comprises the primer and the probe.

[0021] The kit further comprises an RPA basic reagent and a control reagent; the RPA basic reagent comprises a rehydration buffer, a 280 mM magnesium acetate solution and lyophilized RPA enzyme particles; and the control reagent comprises a GPV positive standard plasmid and a negative control.

[0022] DNA / RNA enzyme-free water.

[0023] The application further provides a method for detecting goose parvovirus for non-diagnostic purposes, that is, using the primer and the probe, or the reagent or the kit, performing Real-time RPA reaction on nucleic acid of a sample to be tested, and then analyzing the reaction product.

[0024] The method for detecting goose parvovirus for non-diagnostic purposes specifically comprises the following steps:

[0025] 1. Nucleic acid extraction: Viral DNA was extracted from the samples to be tested (oropharyngeal / cloacal swabs, tissue homogenates) using commercially available viral nucleic acid extraction kits (such as TransGen EasyPure ViralDNA / RNAKit);

[0026] 2. Preparation of the reaction system: Add 29.5 μL of rehydration buffer (TwistAmp) to a 50 μL system. TM The following ingredients are mixed: 2.1 μL LG-F1 (10 μM), 2.1 μL G-R1 (10 μM), 0.6 μL Exo probe (10 μM), 12.2 μL enzyme-free water, and 1 μL nucleic acid template to be tested. The mixture is then added to a reaction tube containing lyophilized enzyme particles and resuspended thoroughly.

[0027] 3. Start the reaction and monitor the signal: Add 2.5 μL of 280 mM magnesium acetate solution to start the RPA reaction. Place the reaction tube in a quantitative fluorescence detector (such as Roche LightCycler 96) and incubate at 40°C for 40 cycles (30 s per cycle). Acquire the fluorescence signal of the FAM channel once per cycle.

[0028] 4. Result Interpretation:

[0029] Qualitative judgment: If the fluorescence signal shows a clear upward inflection point within 20 minutes and the Ct value is less than 35, it is judged as GPV positive; if the fluorescence signal does not show a clear inflection point or the Ct value is greater than 36, it is judged as negative; if the fluorescence signal shows a clear inflection point but the Ct value is between 35 and 36, it is recommended to repeat the test for judgment.

[0030] Quantitative judgment: using a known concentration of GPV standard plasmid (3.0 × 10⁻⁶). 0 ~3.0×10 6 Construct a standard curve (log plasmid concentration versus cycle threshold Ct) to show the linear relationship between the number of copies / μL and the number of copies / μL. 2 =0.99), substitute the cyclic threshold (Ct value) of the sample to be tested into the linear equation Y = -3.288X + 39.48, where X: the logarithmic value of plasmid copy number; Y: Ct value, to calculate the GPV loading.

[0031] The reaction system used in the method is as follows: a 50 μL reaction system contains: 29.5 μL rehydration buffer, 2.1 μL of 10 μM upstream primer G-F1, 2.1 μL of 10 μM downstream primer G-R1, 0.6 μL of 10 μM Exo probe, 12.2 μL of enzyme-free water, 1 μL of nucleic acid template to be tested, and 2.5 μL of 280 mM magnesium acetate solution.

[0032] The reaction conditions of the method are: constant temperature incubation at 40 DEG C for 40 cycles, 30 seconds for each cycle, and collecting FAM channel fluorescence signal once for each cycle.

[0033] Compared with the prior art, the advantages of the present application are:

[0034] 1. Isothermal convenience: the whole reaction only needs constant temperature at 40 DEG C, without the need for a thermal cycler, and a portable constant temperature device (such as a metal bath) can be used to meet the needs of on-site detection.

[0035] 2. Fast and efficient: the whole process from nucleic acid extraction to result interpretation is less than 30 minutes, and the RPA reaction only needs 20 minutes, which is significantly faster than qPCR (≥ 1 hour) and existing RPA methods (≥ 30 minutes).

[0036] 3. High sensitivity: the detection limit is as low as 3.0 x 10 1 copies / μL, which is 100 times more sensitive than conventional PCR (detection limit ≈ 10 3 copies / μL), and can detect early low-load infection samples.

[0037] 4. High specificity: only reacts with c-GPV, MDGPV and SBDSV, and does not cross-react with other avian viruses such as duckling parvovirus (MDPV), duck plague virus (DPV), duck paramyxovirus (DPMV), etc., with a specificity of 100%;

[0038] 5. High stability: clinical verification of 53 samples showed that the overall coincidence rate with qPCR was 98.1% (positive coincidence rate 97.4%, negative coincidence rate 100%), and the standard curve was linear (R 2 = 0.99), with high quantitative accuracy.

[0039] 6. Controllable cost: no additional auxiliary components (such as vertical flow test paper, PfAgo protein, CRISPR enzyme) are needed, and the cost of raw materials for the kit is lower than that of existing RPA detection products, making it suitable for large-scale promotion.

[0040] 7. The detection method established by the present application is suitable for rapid and accurate detection of GPV classical strains (c-GPV), duck-derived recombinant strains (MDGPV) and short-beaked dwarf syndrome-related strains (SBDSV), and can be widely used in on-site diagnosis, epidemiological monitoring and port quarantine of farms. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 is the sensitivity result graph of real-time RPA detection of GPV; wherein, Figure 1 A is the fluorescence amplification curve of different concentrations of standard plasmid (1-7: 3.0 x 10 6 ~ 3.0 x 10 0Copy number / μL, 8: negative control); Figure 1 B represents linear regression analysis (x-axis: log(plasmid concentration), y-axis: Ct value, R0). 2 =0.99).

[0042] Figure 2 This is a graph showing the specificity results of real-time RPA detection of GPV; where 1-4 are standard plasmid, c-GPV, MDGPV, and SBDSV samples, respectively; 5-10 are MDPV, DPV, DPMV, DHV-I, NDRV, and DTMUV samples, respectively; and 11 is the negative control; the results show that only 1-4 show specific fluorescence curves. Detailed Implementation

[0043] The present invention will now be described in detail with reference to the accompanying drawings and embodiments:

[0044] 1. Experimental Materials

[0045] 1.1 Virus strains and samples: c-GPV, MDGPV, SBDSV, MDPV, DPV, DPMV, duck hepatitis virus type I (DHV-I), novel duck reovirus (NDRV), and duck Tembusu virus (DTMUV) were all preserved in our laboratory; 53 clinically suspected samples (28 oropharyngeal swabs and 25 tissue samples) were collected from waterfowl farms in Fujian Province;

[0046] 1.2 Reagents: TwistAmp TM exo kit (TwistDx UK), TransGen EasyPure Viral DNA / RNA Kit, EasyScript First-Strand cDNA Synthesis SuperMix, pUC57 vector (Shanghai Sangon Biotech), TB Premix Ex Taq TM (TaKaRa);

[0047] 1.3 Instruments: Roche LightCycler 96 Real-Time PCR System, NanoDrop 2000 Spectrophotometer, Clean Bench, High-Speed ​​Centrifuge.

[0048] 2. Experimental Procedure

[0049] 2.1 Design of Specific Primer Pairs and Probes

[0050] Based on the VP1 gene sequence alignment results of representative GPV strains (KU844283, HQ891825, JF926695, KY511292, OR777281, KT343253) in GenBank, a 266bp conserved fragment across strains was selected (using the VP1 gene of strain KU844283 as a reference), and the resulting fragment was designed and optimized.

[0051] Primer pair (G-F1 / G-R1):

[0052] Upstream primer G-F1: 5'-CAGGCAGTATCTCCTACAACCCGGACCTGTG-3' (GC content 58.6%, avoiding 5' end multi-G structure, no secondary structure);

[0053] Downstream primer G-R1: 5'-CAAGAACATCAAGATCTGAACTCGTAGGAGC-3' (GC content 55.2%, co-amplifies 266bp target fragment with G-F1);

[0054] Exo probe:

[0055] 5'-TCTGGCAGCACTACAGCAGGAATAAGTGA[FAM-dT][THF][BHQ1-dT]TATGGTCACGGACG-C3-3' (The Exo probe replaces the 31st base "A" at the 5' end with THF (tetrahydrofuran), labels the base upstream of the THF site with the FAM fluorescent group, labels the base downstream of the THF site with the BHQ1 quenching group, and labels the 3' end with the C3 spacer to block polymerase extension and avoid non-specific amplification).

[0056] All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0057] 2.2 Construction of Standard Plasmids

[0058] Based on the VP1 gene sequence of the SBDSV strain (GenBank accession number KU844283), its full-length coding region sequence (2199 bp) was artificially synthesized. The synthesized VP1 target gene and the pUC57 vector were digested with enzymes, purified, and then directionally ligated using T4 DNA ligase. The ligation product was transformed into competent E. coli cells, and after antibiotic resistance screening and sequencing verification, the recombinant plasmid pUC-FJ15 was successfully constructed. The gene synthesis and vector construction of this recombinant plasmid were both completed by Shanghai Sangon Biotech Co., Ltd.

[0059] The plasmid concentration was determined using NanoDrop 2000 and converted to 3.0 × 10⁻⁶. 8Copy number / μL, 10-fold serial dilution to 3.0×10 6 ~3.0×10 0 Copy number / μL, used as a standard.

[0060] 2.3 Real-time RPA Sensitivity Detection

[0061] With 3.0×10 6 ~3.0×10 0 Using standard plasmids with copy number / μL as templates, real-time RPA reactions were performed as follows, with 3 replicates for each concentration;

[0062] Reaction system preparation: Add 29.5 μL of rehydration buffer (TwistAmp) to a 50 μL system. TM The following ingredients are mixed: 2.1 μL G-F1 (10 μM), 2.1 μL G-R1 (10 μM), 0.6 μL Exo probe (10 μM), 12.2 μL enzyme-free water, and 1 μL nucleic acid template to be tested. After mixing, add the mixture to a reaction tube containing lyophilized enzyme particles and resuspend thoroughly.

[0063] Reaction initiation and signal monitoring: Add 2.5 μL of 280 mM magnesium acetate solution to start the RPA reaction. Place the reaction tube in a quantitative fluorescence detector (such as Roche LightCycler 96) and incubate at 40°C for 40 cycles (30 s per cycle). Acquire the fluorescence signal of the FAM channel once per cycle.

[0064] Using a known concentration of GPV standard plasmid (3.0 × 10⁻⁶) 0 ~3.0×10 6 Construct a standard curve using copies per μL.

[0065] Result: 3.0×10 1 ~3.0×10 6 Specific fluorescence signals were observed in all groups with copy number / μL concentration, 3.0×10 0 The copy number / μL and the negative control showed no signal; the detection limit was 3.0 × 10⁻⁶. 1 Copy number / μL; linear regression analysis results of standard curve log(plasmid concentration) and Ct value: linear equation Y = -3.288X + 39.48, where X: logarithmic value of plasmid copy number; Y: Ct value, R 2 =0.99 (see Figure 1 ).

[0066] 2.4 Real-time RPA specificity detection

[0067] Using the nucleic acids of nine avian viruses, including c-GPV, MDDPV, SBDSV, MDPV, and DPV, as templates, a real-time RPA reaction was performed. The specific method is as follows:

[0068] 1. Nucleic acid extraction: Using a commercially available viral nucleic acid extraction kit (such as TransGen EasyPure ViralDNA / RNA Kit), the DNA of the above viruses was extracted as a nucleic acid template;

[0069] 2. Preparation of the reaction system: Add 29.5 μL of rehydration buffer (TwistAmp) to a 50 μL system. TM The following ingredients are mixed: 2.1 μL G-F1 (10 μM), 2.1 μL G-R1 (10 μM), 0.6 μL Exo probe (10 μM), 12.2 μL enzyme-free water, and 1 μL nucleic acid template to be tested. After mixing, add the mixture to a reaction tube containing lyophilized enzyme particles and resuspend thoroughly.

[0070] 3. Start the reaction and monitor the signal: Add 2.5 μL of 280 mM magnesium acetate solution to start the RPA reaction. Place the reaction tube in a quantitative fluorescence detector (such as Roche LightCycler 96) and incubate at 40°C for 40 cycles (30 s per cycle). Acquire the fluorescence signal of the FAM channel once per cycle.

[0071] Results: Fluorescent signals were only observed in c-GPV, MDDPV, and SBDSV samples; no signals were observed in other viruses and the negative control. No cross-reaction was observed (see [link to results]). Figure 2 ).

[0072] 2.5 Clinical Sample Validation

[0073] The real-time RPA detection method established in this invention and the traditional qPCR detection method were simultaneously performed on 53 clinical samples.

[0074] The real-time RPA detection method is as follows:

[0075] 1. Nucleic acid extraction: Viral DNA was extracted from the samples to be tested (oropharyngeal / cloacal swabs, tissue homogenates) using commercially available viral nucleic acid extraction kits (such as TransGen EasyPure ViralDNA / RNA Kit);

[0076] 2. Preparation of the reaction system: Add 29.5 μL of rehydration buffer (TwistAmp) to a 50 μL system. TMThe following ingredients are included in the exo kit: 2.1 μL upstream primer G-F1 (10 μM), 2.1 μL downstream primer G-R1 (10 μM), 0.6 μL Exo probe (10 μM), 12.2 μL enzyme-free water, and 1 μL nucleic acid template to be tested. After mixing, add the mixture to a reaction tube containing lyophilized enzyme particles and resuspend thoroughly.

[0077] 3. Start the reaction and monitor the signal: Add 2.5 μL of 280 mM magnesium acetate solution to the system in step 2 to start the RPA reaction. Place the reaction tube in a quantitative fluorescence detector (such as Roche LightCycler 96) and incubate at 40°C for 40 cycles (30 s per cycle). Acquire the fluorescence signal of the FAM channel once per cycle.

[0078] 4. Result Interpretation:

[0079] Qualitative judgment: If the fluorescence signal shows a clear upward inflection point within 20 minutes and the Ct value is less than 35, it is judged as GPV positive; if the fluorescence signal does not show a clear inflection point or the Ct value is greater than 36, it is judged as negative; if the fluorescence signal shows a clear inflection point but the Ct value is between 35 and 36, it is recommended to repeat the test for judgment.

[0080] Quantitative judgment: Substitute the cycle threshold (Ct value) of the sample to be tested into the linear equation obtained in 2.3 to calculate the GPV load corresponding to the sample.

[0081] The traditional qPCR detection method involves adding [a certain ingredient] to a 50 μL system. Premix Ex Taq TM 25 μL of (TliRNaseH Plus), 1 μL each of 10 μM upstream / downstream primers (upstream primer G5-F: GAGGTAGACAGCAACAGAAA, downstream primer G5-R: GCTCGTCGTCCGTGACCATA), 1 μL of DNA template, and sterile deionized water to a final volume of 50 μL; reaction conditions: 95℃ for 5 min pre-denaturation; 95℃ for 15 s, 60℃ for 10 s, and 72℃ for 15 s, for a total of 40 cycles; after the reaction, a melting curve was plotted.

[0082] Test results: 38 samples were positive and 15 were negative by real-time RPA test, and 39 samples were positive and 14 were negative by qPCR test, with an overall concordance rate of 98.1% (see Table 2).

[0083] Table 2. Comparison of RPA and qPCR methods for the detection of GPV in clinical samples

[0084]

[0085] 3. Experimental Conclusions

[0086] The real-time RPA detection method and kit established in this invention have the advantages of being isothermal, rapid, highly sensitive, and highly specific. They can effectively detect GPV (including classic and variant strains), have strong clinical applicability, and are suitable for on-site diagnosis and epidemiological monitoring.

Claims

1. Primers and probes for real-time RPA detection of goose parvovirus, characterized in that: The primers include an upstream primer G-F1 and a downstream primer G-R1, whose sequences are as follows: Upstream primer G-F1: 5'-CAGGCAGTATCTCCTACAACCCGGACCTGTG-3', Downstream primer G-R1: 5'-CAAGAACATCAAGATCTGAACTCGTAGGAGC-3'; The probe is an Exo probe, and its sequence is as follows: 5'-TCTGGCAGCACTACAGCAGGAATAAGTGA[FAM-dT][THF][BHQ1-dT]TATGGTCA CGGACG-C3-3', wherein the Exo probe replaces the 31st base "A" at the 5' end with THF (tetrahydrofuran), the base upstream of the THF site is labeled with the FAM fluorescent group, the base downstream of the THF site is labeled with the BHQ1 quenching group, and the 3' end is labeled with a C3 spacer.

2. The use of the primers and probes as described in claim 1 in the preparation of reagents or kits for detecting goose parvovirus.

3. A reagent for real-time RPA detection of goose parvovirus, characterized in that: The reagents include the primers and probes as described in claim 1.

4. A kit for real-time RPA detection of goose parvovirus, characterized in that: The kit includes the primers and probes as described in claim 1.

5. The reagent kit according to claim 4, characterized in that: It also includes RPA basic reagents and control reagents; the RPA basic reagents include rehydration buffer, 280mM magnesium acetate solution, and lyophilized RPA enzyme particles; the control reagents include GPV positive standard plasmids and negative controls: DNA / RNA enzyme-free water.

6. A method for detecting goose parvovirus for non-diagnostic purposes, characterized in that: Using the primers and probes of claim 1, or the reagents of claim 3, or the kits of any one of claims 4-5, a real-time RPA reaction is performed on the nucleic acids of the sample to be tested, and then the reaction products are analyzed.

7. The method according to claim 6, characterized in that: The reaction system used in the method is as follows: a 50 μL reaction system contains: 29.5 μL rehydration buffer, 2.1 μL of 10 μM upstream primer G-F1, 2.1 μL of 10 μM downstream primer G-R1, 0.6 μL of 10 μM Exo probe, 12.2 μL of enzyme-free water, 1 μL of nucleic acid template to be tested, and 2.5 μL of 280 mM magnesium acetate solution.

8. The method according to claim 6, characterized in that: The reaction conditions of the method are: constant temperature incubation at 40℃ for 40 cycles, each cycle for 30 seconds, and acquisition of FAM channel fluorescence signal once per cycle.

9. The method according to claim 6, characterized in that: Analysis of the reaction products includes: Qualitative judgment: If the fluorescence signal shows a clear upward inflection point within 20 minutes and the Ct value is less than 35, it is judged as GPV positive; if the fluorescence signal does not show a clear inflection point, or the Ct value is greater than 36, it is judged as negative. Quantitative judgment: using a known concentration of GPV standard plasmid (3.0 × 10⁻⁶). 0 ~3.0×10 6 Construct a standard curve (log plasmid concentration versus cycle threshold Ct) to show the linear relationship between the number of copies / μL and the number of copies / μL. 2 =0.99), substitute the cyclic threshold (Ct value) of the sample to be tested into the linear equation Y = -3.288X + 39.48, where X: the logarithmic value of plasmid copy number; Y: Ct value, to calculate the GPV loading.

Images