Electrochemical sensor for detecting ibd protein markers and preparation method thereof

An electrochemical sensor with CNTs and deposited gold nanoparticles embedded on a flexible PDMS substrate, combined with aptamer detection of TNF-α, IL-6, IL-8 and TGF-β1, solves the problems of sensor modulus mismatch and signal instability with human body, and achieves high sensitivity and stable detection of IBD protein biomarkers, which is suitable for the early diagnosis of inflammatory bowel disease.

CN121324673BActive Publication Date: 2026-03-31NANJING UNIV OF POSTS & TELECOMM
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511902857.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-17
Publication Date
2026-03-31
Estimated Expiration
2045-12-17

AI Technical Summary

Technical Problem

Existing rigid electrochemical sensors are not compatible with human modulus, have poor biocompatibility, are difficult to accurately detect low concentrations of IBD protein biomarkers, and have unstable signals under strain conditions.

Method used

An electrochemical sensor constructed using a PDMS flexible substrate, embedded CNTs, and gold nanoparticles, combined with a single-chain aptamer modified with signaling molecules, was used to detect TNF-α, IL-6, IL-8, and TGF-β1. The electrochemical signal was enhanced by depositing gold nanoparticles on carbon nanotubes and modifying the aptamer.

Benefits of technology

Stable detection of IBD protein markers under stretching conditions was achieved, improving the biocompatibility and sensitivity of the sensor, enabling real-time monitoring of inflammatory status and guiding treatment decisions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121324673B_ABST
    Figure CN121324673B_ABST
Patent Text Reader

Abstract

The application discloses an electrochemical sensor for detecting IBD protein markers and a preparation method thereof. The electrochemical sensor is composed of a CNT-embedded semi-cured PDMS flexible substrate, deposited gold nanoparticles and a nucleic acid sensing layer. The nucleic acid sensing layer comprises a tumor necrosis factor-alpha sensor, an interleukin 6 sensor, an interleukin 8 sensor, a transforming growth factor beta 1 sensor, a reference electrode and a counter electrode. The tumor necrosis factor-alpha sensor, the interleukin 6 sensor, the interleukin 8 sensor and the transforming growth factor beta 1 sensor all adopt single-stranded aptamers modified by a signal molecule methylene blue, and the nucleotide sequences corresponding to the single-stranded aptamers are SEQ ID NO. 1-4. The application can improve the modulus matching of the sensor and human tissue and excellent biocompatibility, realize accurate detection of low-concentration biomarkers and stable signal output of the sensor under a strain working condition.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of electrochemical aptamer flexible sensor technology, specifically to a stretchable electrochemical sensor for monitoring relevant protein markers in inflammatory bowel disease, its preparation method, and its application. Background Technology

[0002] Inflammatory bowel disease (IBD) is a chronic inflammatory disease affecting the gastrointestinal tract, mainly including Crohn's disease (CD) and ulcerative colitis (UC). There are millions of IBD patients worldwide, and the incidence continues to rise. Therefore, early diagnosis is extremely important for the prevention and treatment of IBD. Approximately 30% to 40% of CD patients have already developed complications (such as intestinal fistula and intestinal stricture) at the time of diagnosis, leading to some patients even requiring surgical resection of the colon after diagnosis. Moreover, many IBD patients have poor drug response specificity, resulting in no treatment that can reverse the progressive characteristics of IBD. Intervention in the early stage of immune dysregulation can reverse the disease progression. Therefore, the importance of early diagnosis and intervention is self-evident.

[0003] Specifically, the pathogenesis of inflammatory bowel disease (IBD) is often accompanied by pro-inflammatory factors, including TNF-α, IL-6, and IL-8. These factors are significantly elevated in the serum of IBD patients and are positively correlated with the severity of intestinal mucosal damage and inflammation. For example, higher levels of TNF-α and IL-6 usually indicate a more severe condition. IL-8, as a chemokine, drives neutrophil infiltration and exacerbates tissue damage. Therefore, these factors can be detected by specialized sensors, which can quantify the intensity of inflammation and assist in the diagnosis of active IBD (such as acute exacerbations) without relying on invasive examinations.

[0004] In addition, TGF-β1, an important anti-inflammatory factor, is also present in the human body and is often used to participate in immune regulation and tissue repair. In IBD, its signaling pathway is often impaired or its expression is imbalanced, which may lead to persistent chronic inflammation. Therefore, monitoring TGF-β1 can help identify immune tolerance defects and provide a basis for early intervention.

[0005] Existing methods for detecting IBD include computed tomography (CT), confocal laser endoscopy (CLE), and magnetic resonance imaging (MRI). The main problems are high operating costs, large and inconvenient equipment, unsuitability for laboratory operation, and the need for professional personnel to operate the equipment. Furthermore, these methods can easily cause discomfort to patients during blood collection.

[0006] In addition, the antibody sensors commonly used for detecting IBD are generally used to detect proteins, but they have poor stability, are not easy to store, are prone to cross-reaction during detection, have poor selectivity, are expensive, have high detection limits, and cannot detect low concentrations of target substances.

[0007] Meanwhile, traditional rigid electrochemical sensors have poor biocompatibility and comfort, are susceptible to environmental noise, have a high risk of signal distortion, and cannot adapt to flexible deformation scenarios.

[0008] Therefore, this application proposes a stretchable electrochemical sensor for the detection of IBD protein biomarkers and a preparation method to solve the above-mentioned technical problems. Summary of the Invention

[0009] The main objective of this invention is to provide an electrochemical sensor for the detection of IBD protein biomarkers and its preparation method, in order to solve the technical problems mentioned in the background art, such as the mismatch between rigid sensor devices and human modulus, poor biocompatibility, low concentration of biomarkers making accurate detection difficult, and unstable signal under sensor strain.

[0010] The present invention solves the above-mentioned technical problems by adopting the following technical solutions:

[0011] An electrochemical sensor for detecting IBD protein markers comprises a PDMS flexible substrate, deposited gold nanoparticles, and a nucleic acid sensing layer. The PDMS flexible substrate achieves embedded interlocking by embedding CNTs into semi-cured PDMS to ensure normal operation of the nucleic acid sensing layer under the stretching conditions of the PDMS flexible substrate. The nucleic acid sensing layer includes: a tumor necrosis factor-α sensor, an interleukin-6 sensor, an interleukin-8 sensor, a transforming growth factor β1 sensor, a reference electrode, and a counter electrode.

[0012] Preferably, the tumor necrosis factor-α sensor, interleukin-6 sensor, interleukin-8 sensor, and transforming growth factor β1 sensor all use aptamer single chains modified with the signaling molecule methylene blue (MB), and the specific sequences are as follows:

[0013] The aptamer sequence corresponding to the tumor necrosis factor-α sensor is shown in SEQ ID NO.1: GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC;

[0014] The interleukin-6 sensor uses an aptamer sequence as shown in SEQ ID NO.2: GGTGGCAGGAGGACTATTTTTTGCTTTTCT;

[0015] The interleukin-8 sensor uses an aptamer sequence as shown in SEQ ID NO.3: GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC;

[0016] The aptamer sequence corresponding to the transforming growth factor β1 sensor is shown in SEQ ID NO.4: CGCTCGGCTTCACGAGATTCGTGTCGTTGTGTCCTGTACCCTTGACCAGTCACTCTAGAGCCCGGACTG.

[0017] The probe sequences are as shown in SEQ ID NO.1 to SEQ ID NO.3, where the 5' end is modified with HS-SH and the 3' end is added with MB; and as shown in SEQ ID NO.4, the 5' end is modified with MB and the 3' end is modified with HS-SH.

[0018] A method for preparing an electrochemical sensor for detecting any of the IBD protein biomarkers described above, comprising:

[0019] S1. Attach the polyethersulfone (PES) filter membrane to A4 paper, draw the specified electrode pattern, leave the pattern area blank, and print the rest onto the PES filter membrane using graphite. Due to the hydrophobicity of graphite, the aqueous solution is only retained in the blank area. The patterning is then achieved by filtration.

[0020] S2. Dissolve 0.1–0.5 g of SDS in 30–50 mL of deionized water, then add 0.005–0.01 g of SWNTs, and place the mixture in an integrated ultrasonic cell disruption apparatus. Under the condition of 35–50 W power, sonicate in an ice-water bath for 0.5–1.5 h to ensure uniform dispersion of SWNTs, and then prepare the SWNTs solution required for testing.

[0021] S3. Mix the PDMS monomer and crosslinking agent evenly at a specified mass ratio of 10:1. After mixing evenly, use a centrifuge to rotate at a speed of 7000-9000 rpm for 8-12 minutes to eliminate air bubbles. Then use a spin coater to spin coat it onto the surface of the silicon wafer (spin coat at a speed of 800 rpm for 50 seconds and at a speed of 500 rpm for 10 seconds). Place it in a 65℃ oven for 20-35 minutes to semi-cur the PDMS. Then remove it from the oven for later use.

[0022] S4. The prepared SWNTs solution is dropped onto the PES filter membrane with ink pattern treatment, filtered by vacuum filtration device, and then the residual SDS in the SWNTs is washed away by ethanol and water respectively. Then the SWNTs are transferred to semi-cured PDMS.

[0023] S5. Place the semi-cured PDMS after SWNT transfer into an oven at 65°C for 4-5 hours to cure, and peel off the PES filter membrane to achieve successful SWNT embedding and full curing of PDMS.

[0024] S6. Gold nanoparticles are deposited on the SWNTs / PDMS electrode to obtain the AuNPs / SWNTs / PDMS electrode, which is then combined with the nucleic acid sensing layer to obtain an electrochemical sensor for the detection of IBD protein biomarkers.

[0025] Preferably, the specific conditions for depositing gold nanoparticles on the SWNTs / PDMS electrode in step S6 are as follows: In a freshly prepared solution containing 0.5M H2SO4 and 2mM HAuCl4, the AuNPs layer is deposited on the SWNTs / PDMS electrode by a 100s chronoamperometry (it) (-0.2V vs Ag / AgCl), followed by rinsing with deionized water and drying to obtain the AuNPs / SWNTs / PDMS electrode.

[0026] Preferably, the AuNPs / SWNTs / PDMS electrode modifies the electrode surface with the reduced aptamer chain via Au-S bonds, and the specific process steps include:

[0027] The lyophilized aptamer was centrifuged at 3000-4000 r for 1-2 min, and then a specified amount of TEBuffer was added to prepare a 100 μM solution.

[0028] The diluted 1 μM aptamer was added to TM Buffer containing 1 mM TCEP and reduced at room temperature in the dark for 2–3.5 hours to cleave the SS bond.

[0029] Take 10 μL of the aptamer solution with 1 μM reduction and drop it onto the surface of AuNPs / SWNTs / PDMS electrode, and incubate it overnight at 4°C in the dark to fix the aptamer on the gold surface.

[0030] Preferably, the AuNPs / SWNTs / PDMS electrode is modified with different sensor aptamers, and after overnight incubation at 4°C, the aptamers are fixed on the electrode surface.

[0031] Preferably, the sensor aptamers modified by the AuNPs / SWNTs / PDMS electrodes are all 1 μM.

[0032] Preferably, the specific operation procedure for modifying the sensor aptamer with AuNPs / SWNTs / PDMS includes:

[0033] The electrodes are washed with ionized water based on the aptamer fixed on the gold surface.

[0034] A 1-5 mM solution of 6-mercapto-1-hexanol (MCH) was added to the electrode and treated in the dark at room temperature for 2-3 hours to obtain a well-aligned aptamer monolayer. The electrode was then washed with deionized water to remove non-specifically adsorbed thiols, resulting in an aptamer-modified gold electrode.

[0035] Aptamer-modified gold electrodes are denoted as Aptamer / AuNPs / SWNTs / PDMS.

[0036] Preferably, the amount of MCH solution added is set to 1 mM.

[0037] As can be seen from the above technical solution, the present invention provides an electrochemical sensor for the detection of IBD protein biomarkers and a preparation method thereof. Compared with the prior art, the present invention has the following advantages:

[0038] 1. The electrochemical sensor of this invention can monitor the level of target factors in real time, thereby helping to assess the inflammatory state and guide treatment decisions.

[0039] 2. The electrochemical sensor of the present invention can detect the target object within a 50% stretch range, and the output signal remains basically unchanged. Therefore, it has high biocompatibility and is suitable for in-situ detection.

[0040] 3. The PDMS substrate of the electrochemical sensor of the present invention has excellent flexibility and good affinity with biological tissues, making it less likely to cause inflammation or rejection; and it has a low Young's modulus to achieve high conformal contact and reduce tissue damage.

[0041] 4. This invention enhances the sensor's sensitivity and response speed by depositing gold nanoparticles on carbon nanotubes and then modifying them with aptamers. This is achieved by utilizing the high specific surface area of ​​gold nanoparticles to enhance electrochemical signals.

[0042] 5. The electrochemical sensor constructed in this invention can maintain electrochemical stability under stretching and bending conditions.

[0043] It should be understood that the descriptions in this section are not intended to identify key or essential features of embodiments of the invention, nor are they intended to limit the scope of the invention. Other features of the invention will become readily apparent from the following description. Of course, implementing any product of the invention does not necessarily require achieving all of the advantages described above simultaneously. Attached Figure Description

[0044] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0045] Figure 1 This is a schematic diagram illustrating the detection principle of the flexible electrochemical aptamer sensor of the present invention;

[0046] Figure 2 This is a schematic diagram of the flexible electrochemical aptamer sensor structure of the present invention;

[0047] Figure 3 The images shown are scanning electron microscope (SEM) images of the CNT / PDMS flexible sensing electrode before and after AuNP deposition in the second embodiment of the present invention. In the images, A is a scanning electron microscope image of PDMS / CNT, B is a scanning electron microscope image of AuNP after deposition, and C and D are both scanning electron microscope images of the cross-section of PDMS / CNT.

[0048] Figure 4 This is a schematic diagram of the resistance change curves of the electrode under different degrees of stretching in the third embodiment of the present invention;

[0049] Figure 5 The figures shown are CV test graphs of the electrode under different stretching degrees in the fourth embodiment of the present invention. A is the voltammetric cycle graph of the SWNTs / PDMS thin film electrode with a CNT concentration of 0.2 mg / mL in 5 mM K3Fe(CN)6 from 0-50%, and B is the CV curve of the SWNTs / PDMS thin film electrode with a CNT concentration of 0.2 mg / mL in 5 mM K3Fe(CN)6 at different cycles from 0-50%.

[0050] Figure 6 This is a schematic diagram of the correlation curve of target concentration before and after modification of the flexible aptamer sensor in the second embodiment of the present invention. When the target concentration is 200 pg / mL, the sensor is stretched to 0%, 10%, 20%, 30%, 40%, and 50%, respectively. A and D represent the SWV curves of the prepared sensor electrode stretched from 0% to 50%, respectively. C is the corresponding calibration curve of the prepared sensor with the increase of IL-8 protein concentration in the stretched 0% and 50% states. B is the different SWV curves obtained by modifying the prepared sensor with different concentrations of IL-6 protein in the stretched 50% state.

[0051] Figure 7 This is a schematic diagram of the correlation curve of target concentration before and after modification of the flexible aptamer sensor in the third embodiment of the present invention. When the target concentration is 200 pg / mL, the sensor is stretched to 0%, 10%, 20%, 30%, 40%, and 50%, respectively. A and D represent the SWV curves of the prepared sensor electrode stretched from 0% to 50%, respectively. C is the corresponding calibration curve of the prepared sensor with the increase of IL-6 protein concentration in the stretched 0% and 50% states. B is the different SWV curves obtained by modifying the prepared sensor with different concentrations of TGF-β1 protein in the stretched 50% state.

[0052] Figure 8This is a schematic diagram of the correlation curves of target concentration before and after modification of the flexible aptamer sensor in the second embodiment of the present invention. When the target concentration is 200 pg / mL, the sensor is stretched to 0%, 10%, 20%, 30%, 40%, and 50%, respectively. A and D represent the SWV curves of the prepared sensor electrode stretched from 0% to 50%, respectively. C is the corresponding calibration curve of the prepared sensor with increasing TNF-α protein concentration in the stretched 0% and 50% states. B is the different SWV curves obtained by modifying the prepared sensor with different concentrations of TNF-α protein in the stretched 50% state.

[0053] Figure 9 This is a schematic diagram of the correlation curve of target concentration before and after modification of the flexible aptamer sensor in the second embodiment of the present invention. When the target concentration is 200 pg / mL, the sensor is stretched to 0%, 10%, 20%, 30%, 40%, and 50%, respectively. A and D represent the SWV curves of the prepared sensor electrode stretched from 0% to 50%, respectively. C is the corresponding calibration curve of the prepared sensor with increasing TGF-β1 protein concentration in the stretched 0% and 50% states. B is the different SWV curves obtained by modifying the prepared sensor with different concentrations of IL-8 protein in the stretched 50% state.

[0054] Figure 10 The images shown are actual test images of the flexible aptamer sensor integrated test of the present invention. In the images, A is the sensor electrode array, B is the actual image of the electrodes under bending, and C is the actual image of the electrodes under stretching. Detailed Implementation

[0055] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Unless otherwise specified, the embodiments and features in the embodiments of this application can be combined with each other. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0056] For details in the embodiments, please refer to Figures 1 to 10 .

[0057] For the first embodiment

[0058] Antibody sensors commonly used for IBD detection are generally designed to detect proteins, but they suffer from poor stability, are difficult to preserve, are prone to cross-reactivity during detection, have poor selectivity, are costly, have high detection limits, and cannot detect low concentrations of target analytes. Aptamers, on the other hand, are composed of short-chain DNA, RNA, or peptide chains, and are much smaller than antibodies. When they bind to target proteins, they produce more significant signal changes. Their tiny size allows for direct detection in physiological fluids, improving the response to low concentrations of target analytes. Furthermore, aptamers can achieve highly specific binding to single proteins, effectively avoiding cross-reactivity. Aptamer sensors exhibit strong specificity and can be integrated into various sensing platforms, including electrochemical, optical, and electrochemical transistor sensors.

[0059] Therefore, the present invention provides a stretchable electrochemical sensor for the detection of IBD protein biomarkers, a preparation method and an application, which can improve the matching of sensor modulus with human tissue and excellent biocompatibility, accurate detection of low-concentration biomarkers and stable signal output of sensor under strain conditions.

[0060] The electrochemical sensor consists of a PDMS flexible substrate, deposited gold nanoparticles, and a nucleic acid sensing layer, as shown in the image. Figure 10 As shown in A, B, and C, these are designated protein biomarkers used to monitor inflammatory bowel disease.

[0061] Here, CNTs are embedded in semi-cured PDMS to achieve internal interlocking, ensuring the normal operation of the nucleic acid sensing layer under the stretching conditions of the flexible PDMS substrate. This guarantees that the sensor can still stably output sensing results even under strong stretching conditions (after 50% stretching). The principle is as follows: under stretching, the flexible PDMS substrate dissipates most of the stress, while the semi-embedded structure of SWCNTs enhances the interfacial bonding between the flexible substrate and the conductive network, preventing the conductive network from detaching under stretching and improving the structural stability of the conductive network. Simultaneously, the slippage and torsion between SWNTs ensure the integrity of the conductive network during stretching. Therefore, this SWCNTs / PDMS electrode still exhibits excellent electrical and electrochemical activity within a 50% stretching range.

[0062] Furthermore, the nucleic acid sensing layer includes: a tumor necrosis factor-α sensor, an interleukin-6 sensor, an interleukin-8 sensor, a transforming growth factor β1 sensor, a reference electrode, and a counter electrode. These sensors, by monitoring the levels of target factors in real time, can help assess the inflammatory state and guide treatment decisions. The tumor necrosis factor-α sensor, interleukin-6 sensor, interleukin-8 sensor, and transforming growth factor β1 sensor all use aptamer single-stranded molecules modified with the signaling molecule methylene blue (MB). Specific sequences are provided in the sequence listing provided in this application. In the sequence listing, in the RNA sequence shown in SEQ ID NO. 3, T in the sequence listing actually represents U. By specifying the aptamer single-stranded molecules modified with the signaling molecule methylene blue, targeted sensing and monitoring of relevant protein markers in inflammatory bowel disease can be achieved.

[0063] The detection principle of the electrochemical sensor here is as follows: Figure 1 As shown.

[0064] The fabrication of the electrochemical sensor includes the following steps:

[0065] Step 1: Add a solution of 0.1–0.45 mg / mL single-walled carbon nanotubes dropwise onto a PES membrane and filter it using a vacuum filtration device.

[0066] Step 2: The electrode filtered in Step 1 is cleaned with ethanol and water and then transferred to the semi-cured PDMS substrate;

[0067] Step 3: Deposit AuNPs on the SWNTs / PDMS electrode prepared in Step 2, rinse with deionized water and dry. The deposition time of AuNPs is 100s, and the parameters are: chronoamperometry (it) (-0.2 V vs Ag / AgCl).

[0068] Step 4: Modify different sensor aptamers on the AuNPs / SWNTs / PDMS electrode prepared in Step 3. After incubating overnight at 4°C, fix the aptamers on the electrode surface. The aptamers are 1 μM in size.

[0069] Step 5: After rinsing the electrode with deionized water, add 1-5 mM 6-mercapto-1-hexanol (MCH) solution to the electrode and incubate at room temperature in the dark for 2-3 hours. Then rinse the electrode with deionized water to remove non-specifically adsorbed thiols, and obtain the aptamer-modified gold electrode, denoted as Aptamer / AuNPs / SWNTs / PDMS. Finally, drop different concentrations of protein onto each working electrode and incubate at room temperature for 2 hours, with the amount of 6-mercapto-1-hexanol added being 1 mM.

[0070] The PDMS substrate constructed in this step has excellent flexibility and good affinity with biological tissues, making it less likely to cause inflammation or rejection; the low Young's modulus achieves high conformal contact and reduces tissue damage.

[0071] In practical use, the electrochemical sensor employed in this application utilizes PDMS with a low elastic modulus (0.1–3 MPa), which can withstand tensile deformation exceeding 1000% without breaking. It can conform to the skin, thus the sensor based on PDMS-CNTs composite material maintains a stable signal output after multiple cycles of stretching. Furthermore, the aptamer has been modified to further improve detection sensitivity. In summary, this sensor can detect target analytes within a 50% stretch range, and the output signal remains essentially unchanged. It exhibits high biocompatibility and can be widely applied in analytical equipment for clinical diagnosis and human health monitoring.

[0072] Furthermore, the aforementioned application of the stretchable electrochemical sensor for monitoring relevant protein markers in inflammatory bowel disease is also within the scope of protection of this invention.

[0073] Specifically, the present invention further proposes other embodiments. In other embodiments, a stretchable electrochemical sensor for monitoring related protein markers in inflammatory bowel disease was prepared by the above preparation method, which can realize the detection of multiple inflammatory factors TNF-α, IL-6, IL-8 and TGF-β1.

[0074] In further embodiments, comparative experiments can be used to verify the advantages of the above-mentioned sensor, such as tensile stability, high sensitivity, and strong specificity, and to demonstrate the application prospects of the stretchable electrochemical sensor provided by the present invention for monitoring related protein markers in inflammatory bowel disease in chemical molecular instruments.

[0075] In further embodiments, the experimental methods used, unless otherwise specified, are conventional methods; the reagents and materials, unless otherwise specified, are experimental materials conventionally obtained in the art.

[0076] In further embodiments, the nucleotide sequences of SEQ ID NO.1 to SEQ ID NO.4 used are shown in Table 1 below:

[0077] Table 1:

[0078]

[0079] The probe sequences shown in SEQ ID NO.1 to SEQ ID NO.3 are modified with HS-SH at the 5' end and MB added at the 3' end; SEQ ID NO.4 shows a 5' end modified with MB and a 3' end modified with HS-SH.

[0080] It should be noted that since computer-readable vectors of conventional nucleotide or amino acid sequence listings cannot recognize SH-, C6-, and MB-, the sequences in the following examples are based on the modified sequences described herein.

[0081] For the second embodiment

[0082] The flexible electrochemical aptamer sensor of this embodiment uses PDMS as a substrate, embeds CNTs in PDMS, deposits gold nanoparticles on the electrode surface, and then modifies the corresponding aptamers for tumor necrosis factor-α, interleukin-6, interleukin-8, and transforming growth factor β1.

[0083] The nucleic acid sensing layer contains a sensing region, which specifically includes four inflammatory factor sensors, a reference electrode (RE), and a counter electrode (CE). The four inflammatory factor sensors include a tumor necrosis factor-α (TNF-α) sensor, an interleukin-6 (IL-6) sensor, an interleukin-8 (IL-8) sensor, and a transforming growth factor β1 (TNF-β) sensor. Their integrated structure is shown below. Figure 2 As shown, where:

[0084] In the sensing area, electrode leads and sensor leads are provided at the bottom. The outer two ends of the leads are connected to RE and CE respectively (in this sensing area, the left lead is connected to the reference electrode). RE and CE are combined to form an obtuse arc with an opening on one side (set as the left side in this sensing area). The central area is provided with an array of TNF-α, IL-6, IL-8 and TNF-β, which are connected to the sensor leads.

[0085] The aptamers for tumor necrosis factor-α, interleukin-6 sensor, interleukin-8, and transforming growth factor β1 are shown in Table 2 below:

[0086] Table 2:

[0087]

[0088] Table 2 above shows the four aptamer chains for four types of inflammatory factor sensors. The specific steps for preparing this flexible electrochemical aptamer sensor are as follows:

[0089] (1) Dissolve 0.28g SDS in 40mL of deionized water, add 0.008g SWNTs, and put the mixed solution into an integrated ultrasonic cell disruption device. Under the condition of 45W power, use an ice water bath for ultrasonic treatment for 1h to ensure that the SWNTs are evenly dispersed, and a 0.2mg / mL SWNTs solution can be obtained.

[0090] (2) A SWNTs solution with a concentration of 0.2 mg / mL was added dropwise onto a 0.22 μm PES membrane with an ink pattern and filtered using a vacuum filtration device. The residual SDS in the SWNTs was then washed away with ethanol and water, respectively. The SWNTs were then transferred to semi-cured PDMS.

[0091] (3) Mix PDMS monomer and crosslinking agent at a mass ratio of 10:1, stir evenly, and place in a centrifuge. Rotate at 8000 rpm for 10 min to eliminate air bubbles. Then, spin coat the mixture onto the silicon wafer surface using a spin coater (spin coat at 800 rpm for 50 s and at 500 rpm for 10 s), and place it in a 65℃ oven for 30 min to semi-cur the PDMS. Then remove it from the oven for later use.

[0092] (4) Place the semi-cured PDMS with transferred SWNTs in an oven at 65°C for 4-5 hours to cure, then peel off the PES filter membrane to achieve successful SWNT embedding and full curing of PDMS, such as Figure 3 In Figure A, the embedding of CNTs under the PDMS substrate is demonstrated in the SEM image;

[0093] (5) Deposition of gold nanoparticles on the SWNTs / PDMS electrode: The specific conditions are as follows: AuNPs layer is deposited on the SWNTs / PDMS electrode in a freshly prepared solution containing 0.5M H2SO4 and 2mM HAuCl4 by 100s chronoamperometry (it) (-0.2V vs Ag / AgCl), followed by rinsing with deionized water and drying to obtain the AuNPs / SWNTs / PDMS electrode, as shown below. Figure 3 B, C, and D in the image demonstrate the successful deposition of gold nanoparticles in the SEM image.

[0094] (6) The reduced aptamer chain was modified onto the surface of the AuNPs / SWNTs / PDMS electrode via Au-S bonds and incubated overnight at 4°C. The next day, the electrode was taken out and rinsed with deionized water 2-3 times. Then, 10 mM MCH solution was added to the electrode and incubated at room temperature for 2 h.

[0095] The flexible sensing electrode of this embodiment was applied to TNF-α analysis. 10 μL of the target analyte was added to the electrode, and electrochemical testing was performed after incubation at room temperature for 1 hour. The specific procedure is as follows: A three-electrode pattern was designed, controlling the active area of ​​the electrode to be a circle with a diameter of 3 mm. The electrode stalk was then connected to an electrochemical workstation using conductive silver paste. In the electrochemical test, SWNTs / PDMS was used as the counter electrode, and Ag / AgCl as the reference electrode. The three electrodes were then immersed in PBS solution and tested using square wave voltammetry. The results are as follows: Figure 6 As shown in A, from Figure 6As can be seen from A, the current decreases as the concentration of the target substance increases.

[0096] After stretching the electrode by 50%, tests were conducted on different target concentrations, and the results are as follows. Figure 6 As shown in D, from Figure 6 As can be seen from D, the current decreases with increasing target concentration. Linear fitting was then performed on the two test results, showing a strong correlation, as shown in the figure. Figure 6 As shown in C, this demonstrates that the sensor can stably detect the target material both before and after stretching, and can output a stable electrochemical signal.

[0097] At a target concentration of 200 pg / mL, the electrode was stretched by 0%, 10%, 20%, 30%, 40%, and 50%, respectively, and the results are as follows. Figure 6 As shown in Figure B, the peak current and peak spacing of the electrode remain basically unchanged before and after stretching, proving that the sensor can stably detect the target object before and after stretching.

[0098] For the third embodiment

[0099] The difference between this embodiment and the second embodiment is that the flexible electrochemical aptamer sensor constructed in this embodiment is embedded in PDMS using silver nanowires, while the other structures and preparation methods are the same as in the second embodiment.

[0100] The specific differences are as follows:

[0101] (1) Weigh 0.2 mg / mL silver nanowires, add 20 wt% sodium dodecyl sulfate to the aqueous solution, and sonicate for 60 min; vacuum filter through a polyethersulfone filter membrane with a pore size of 0.45 μm to form a silver nanowire layer; spin on a silicon substrate at 1000 rpm for 180 s; semi-cur at 65 °C for 40 min;

[0102] (2) The silver nanowire layer was attached to the surface of the flexible semi-cured PDMS coating and then heat-cured at 70°C for 300 min before peeling off the polyethersulfone filter membrane.

[0103] (3) In 0.5M H2SO4 and 2mM HAuCl4 solution, AuNPs layer was deposited on the electrode by 200s chronoamperometry (it) (-0.2VvsAg / AgCl) to prepare a flexible sensing electrode with integrated elastomer and electrochemical interface design.

[0104] The prepared electrode (i.e., the flexible sensing electrode with integrated elastomer and electrochemical interface design obtained in this third embodiment) was fixed on an automatic stretching stage. Both ends of the electrode were connected to a digital source meter via liquid metal wires. The resistance of the electrode was tested after repeated bending cycles. The results are as follows: Figure 4 As shown, from Figure 4 It can be seen that the resistance change rate of the electrode within a 50% stretch range remains stable under repeated bending, which proves the good electrical performance of the flexible sensing electrode.

[0105] The flexible sensing electrode of this third embodiment was applied to IL-6 analysis. Under the same test conditions and test scenario, the results are as follows: Figure 7 As shown in A, from Figure 7 As can be seen from A, the current decreases as the concentration of the target substance increases.

[0106] After stretching the electrode by 50%, tests were conducted on different target concentrations, and the results are as follows. Figure 7 As shown in D, from Figure 7 As can be seen from D, the current decreases with increasing target concentration. Linear fitting was then performed on the two test results, showing a strong correlation, as shown in the figure. Figure 7 As shown in C, this demonstrates that the sensor can stably detect the target material both before and after stretching, and can output a stable electrochemical signal.

[0107] At a target concentration of 200 pg / mL, the electrode was stretched by 0%, 10%, 20%, 30%, 40%, and 50%, respectively, and the results are as follows. Figure 7 As shown in B, the peak current and peak spacing of the electrode remain basically unchanged before and after stretching, proving that the sensor can stably detect the target object before and after stretching.

[0108] For the fourth embodiment

[0109] The difference between this embodiment and the second embodiment is that the flexible electrochemical aptamer sensor constructed in this embodiment uses gold nanowires embedded in PDMS, while the other structures and preparation methods are the same as in the second embodiment.

[0110] (1) Weigh 0.5 mg / mL gold nanowires, add 10 wt% sodium dodecyl sulfate to the aqueous solution, and sonicate for 45 min; vacuum filter through a polyethersulfone filter membrane with a pore size of 0.22 μm to form a gold nanowire layer; spin-coat on a silicon substrate at 500 rpm for 60 s; semi-cur at 55 °C for 40 min.

[0111] (2) The gold nanowire layer was attached to the surface of the flexible semi-cured PDMS coating and then heat-cured at 50°C for 400 min before peeling off the polyethersulfone filter membrane.

[0112] (3) In 0.5M H2SO4 and 2mM HAuCl4 solution, AuNPs layer was deposited on the electrode by 50s chronoamperometry (it) (-0.2VvsAg / AgCl) to prepare a flexible sensing electrode with integrated elastomer and electrochemical interface design.

[0113] Subsequently, the aforementioned flexible aptamer electrode was used as the working electrode, a 1 cm × 1 cm platinum sheet was used as the counter electrode, and Ag / AgCl was used as the reference electrode. The three electrodes were then immersed in an electrolyte solution (3 mmol / L K₄Fe(CN)₆ + 0.5 mol / L Na₂SO₄ aqueous solution) for electrochemical testing. The results are as follows: Figure 5 As shown in Figure A, the peak current and peak spacing of the electrode remain essentially unchanged before stretching and after stretching by 10%, 20%, 30%, 40%, and 50%. Figure 5 In the image, B represents the CV plots at different stretching cycles, where the peak current and peak spacing of the electrode remain essentially unchanged. This image comparison demonstrates the excellent chemical performance of the flexible sensing electrode.

[0114] The flexible sensing electrode of this fourth embodiment was applied to the analysis of IL-8 and TGF-β1. Under the same test conditions and test scenarios, the results are as follows: Figure 8 A and Figure 9 As shown in the comparison of A in the figure, from Figure 8 A and Figure 9 As can be seen from A, the current decreases as the concentration of the target substance increases.

[0115] After stretching the electrode by 50%, tests were conducted on different target concentrations, and the results are as follows. Figure 8 D and Figure 9 As shown in the comparison of D in the figure, from Figure 8 D and Figure 9 As can be seen from D, the current decreases with increasing target concentration. Linear fitting was then performed on the two test results, showing a strong correlation, as shown in the figure. Figure 8 C and Figure 9 The comparison of C in the figure demonstrates that the sensor can stably detect the target material before and after stretching and can output a stable electrochemical signal.

[0116] At a target concentration of 200 pg / mL, the electrode was stretched by 0%, 10%, 20%, 30%, 40%, and 50%, respectively, and the results are as follows. Figure 8 B and Figure 9 As shown in the comparison of B, the peak current and peak spacing of the electrodes remain basically unchanged before and after stretching, proving that the sensor can stably detect the target object before and after stretching.

[0117] Therefore, based on the above embodiments, it can be seen that depositing gold nanoparticles on carbon nanotubes and then modifying the aptamer has the following advantages: (1) The high specific surface area of ​​gold nanoparticles can enhance the electrochemical signal, such as the significant increase in redox peak current and the reduction in electron transfer resistance in this application, which can improve the sensor sensitivity and response speed; (2) Gold particles serve as connection points, and the aptamer is firmly fixed by gold-sulfur bonds; (3) The aptamer itself has the characteristics of efficient screening, low-cost synthesis, high thermal stability and small molecular weight, which can achieve ultrasensitive detection.

[0118] In summary, this application provides a stretchable electrochemical sensor for monitoring relevant protein biomarkers in inflammatory bowel disease, its preparation method, and its practical application in inflammatory bowel disease. Many methods and approaches exist to implement this technical solution; the above descriptions are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

[0119] In the above embodiments, implementation can be achieved entirely or partially through software, hardware, firmware, or any combination thereof. When implemented using software, it can be implemented entirely or partially in the form of a computer program product. The computer program product includes one or more computer instructions. When the computer program instructions are loaded and executed on a computer, all or part of the processes or functions described in the embodiments of this application are generated. The computer can be a general-purpose computer, a special-purpose computer, a computer network, or other programmable device. The computer instructions can be stored in a computer-readable storage medium or transmitted from one computer-readable storage medium to another. For example, the computer instructions can be transmitted from one website, computer, server, or data center to another website, computer, server, or data center via wired or wireless means. The computer-readable storage medium can be any available medium accessible to a computer or a data storage device such as a server or data center that integrates one or more available media. The available medium can be a magnetic medium, an optical medium, or a semiconductor medium, etc.

[0120] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0121] Furthermore, it should be noted that if any directional indication (such as up, down, left, right, front, back, etc.) is involved in the embodiments of the present invention, the directional indication is only used to explain the relative positional relationship and movement of each component in a specific posture. If the specific posture changes, the directional indication will also change accordingly.

[0122] Furthermore, if the embodiments of this invention involve descriptions such as "first" or "second," these descriptions are for descriptive purposes only and should not be construed as indicating or implying their relative importance or implicitly specifying the number of technical features indicated. Therefore, a feature defined with "first" or "second" may explicitly or implicitly include at least one of those features. Additionally, the meaning of "and / or" throughout the text includes three parallel solutions; for example, "A and / or B" includes solution A, solution B, or a solution where both A and B are satisfied simultaneously. Furthermore, in the embodiments of this invention, "multiple" refers to two or more. Moreover, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by this invention.

Claims

1. An electrochemical sensor for the detection of IBD protein markers, characterized in that, The PDMS flexible substrate is composed of a single-walled CNT embedded in semi-solid PDMS through interlocking, and a nucleic acid sensing layer, which ensures normal use of the nucleic acid sensing layer under the stretching condition of the PDMS flexible substrate; The nucleic acid sensing layer comprises a tumor necrosis factor-alpha sensor, an interleukin 6 sensor, an interleukin 8 sensor, a transforming growth factor beta 1 sensor, a reference electrode and a counter electrode, wherein: The tumor necrosis factor-alpha sensor corresponds to an aptamer sequence of SEQ ID NO. 1; The interleukin 6 sensor corresponds to an aptamer sequence of SEQ ID NO. 2; The interleukin 8 sensor corresponds to an aptamer sequence of SEQ ID NO. 3; The transforming growth factor beta 1 sensor corresponds to an aptamer sequence of SEQ ID NO. 4, which is CGCTCGGCTTCACGAGATTCGTGTCGTTGTGTCCTGTACCCTTGACCAGTCACTCTAGAGCCCGGACTG. The aptamer sequences are all modified by a signal molecule methylene blue.

2. A method for preparing an electrochemical sensor for detecting IBD protein markers according to claim 1, characterized in that, It comprises: S1. Attach the PES filter membrane to the A4 paper, draw the specified electrode pattern, leave the pattern area blank, and print the rest of the PES filter membrane with graphite; S2. Dissolve 0.1-0.5g of SDS in 30-50mL of deionized water, then add 0.005-0.01g of SWNTs, and place the mixed solution in an integrated ultrasonic cell crusher, and use an ice water bath to ultrasonically treat the SWNTs to make them uniformly dispersed, to obtain a SWNTs solution; S3. Mix the PDMS monomer and crosslinking agent at a specified mass ratio, then use a centrifuge, and then use a spin coater to spin coat them on the surface of a silicon wafer, and place them in a 65℃ oven for 20-35min to semi-solidify the PDMS for standby use; S4. Add the obtained SWNTs solution to the PES filter membrane treated with ink pattern, and perform vacuum filtration through a vacuum filtration device, then wash the residual SDS in the SWNTs with ethanol and water, and then transfer the SWNTs to the semi-solidified PDMS; S5. Place the semi-solidified PDMS after SWNTs transfer into a 65℃ oven for 4-5h, peel off the PES filter membrane, to realize successful embedding of SWNTs and full solidification of PDMS; S6. Deposit gold nanoparticles on the SWNTs / PDMS electrode to obtain an AuNPs / SWNTs / PDMS electrode, and finally combine it with a nucleic acid sensing layer to obtain an electrochemical sensor for IBD protein marker detection.

3. The method of claim 2, wherein the step of applying the first and second electrodes to the substrate is performed by screen printing. The specific conditions for depositing gold nanoparticles on the SWNTs / PDMS electrode in the S6 step are as follows: depositing an AuNPs layer on the SWNTs / PDMS electrode by chronoamperometry for 100 s in a newly configured solution containing 0.5 M H2SO4 and 2 mM HAuCl4, and then rinsing with deionized water and drying to obtain an AuNPs / SWNTs / PDMS electrode.

4. The method of claim 2, wherein the step of forming the working electrode is performed by depositing a layer of the working electrode material on the substrate and patterning the layer of the working electrode material. The AuNPs / SWNTs / PDMS electrode is modified with a reduced aptamer chain on the electrode surface through an Au-S bond, and the specific process steps include: Centrifuging the freeze-dried aptamer at 3000-4000 r for 1-2 min, and then adding a specified amount of TE Buffer to prepare a solution with a concentration of 100 μM; Adding the diluted 1 μM aptamer to TM Buffer containing 1 mM TCEP, and reducing at room temperature for 2-3.5 hours in the dark to cleave the S-S bond; Taking 10 μL of the reduced 1 μM aptamer solution and dropping it on the AuNPs / SWNTs / PDMS electrode surface, and incubating overnight at 4°C in the dark for fixing the aptamer on the gold surface.

5. The method of claim 4, wherein the step of applying the first and second electrodes to the substrate comprises applying the first and second electrodes to the substrate by screen printing. The AuNPs / SWNTs / PDMS electrode is modified with different sensor aptamers, and after overnight incubation at 4°C, the aptamer is fixed on the electrode surface.

6. The method of claim 5, wherein the step of applying the second electrode material is performed by applying a second electrode material to the surface of the substrate. The sensor aptamer modified by the AuNPs / SWNTs / PDMS electrode is 1 μM.

7. The method of claim 5, wherein the step of forming the working electrode is performed by depositing a layer of silver on the substrate and then depositing a layer of silver chloride on the silver layer. The specific operation process of the AuNPs / SWNTs / PDMS modified sensor aptamer includes: Using ionized water to rinse the electrode based on the aptamer fixed on the gold surface; Dropping 1-5 mM MCH solution on the electrode, treating at room temperature for 2-3 hours in the dark, and then rinsing the electrode with deionized water to remove non-specifically adsorbed mercaptans to obtain an aptamer-modified gold electrode; The aptamer-modified gold electrode is denoted as Aptamer / AuNPs / SWNTs / PDMS.

8. The method of claim 7, wherein the step of applying the second electrode material is performed by applying a second electrode material to the surface of the substrate. The addition amount of the MCH solution is set to 1 mM.

Citation Information

Patent Citations

  • Preparation method and application of tension sensor for monitoring cortisol in sweat

    CN119375323A

  • In-situ self-amplification nucleic acid-based flexible wound sensor and preparation method thereof

    CN119845363A