Wheat powdery mildew resistance related MlIW92 protein and related biological material and application thereof

Abstract

The invention discloses MlIW92 protein related to wheat powdery mildew resistance as well as a related biological material and application thereof, and belongs to the technical field of biology. The invention aims to solve the technical problem of how to improve the resistance of wheat to powdery mildew. The MlIW92 protein disclosed by the invention is a protein of A1, A2 or A3 as follows: A1 is a protein of which the amino acid sequence is an amino acid sequence shown as SEQ ID No.2 in a sequence table; a2, a protein which is obtained by substitution and / or deletion and / or addition of amino acid residues on the amino acid sequence as shown in SEQ ID No.2 in the sequence table, has 80% or more of identity with the protein as shown in A1, and is related to wheat powdery mildew resistance; and A3, a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1 or A2. The protein disclosed by the invention is derived from wild two-grain wheat, and powdery mildew resistance gene resources of wheat disease resistance breeding work are enriched.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the MlIW92 protein related to wheat powdery mildew resistance and its related biomaterials and applications. Background Technology

[0002] Wheat powdery mildew, caused by the obligate parasitic fungus *Blumeria graminis* f.sp. tritici, is a devastating global disease affecting wheat, posing a serious threat to both yield and quality. In recent years, with the evolution of agricultural production patterns, particularly the widespread increase in high-density planting, intensive irrigation, and nitrogen fertilizer application, field microclimates have become more favorable for the spread of powdery mildew, leading to a significant increase in its affected area and severity.

[0003] In current disease management strategies, while chemical control can quickly control disease in the short term, its potential ecological and environmental impacts, pesticide residue problems, and the risk of pathogen resistance cannot be ignored. Therefore, exploring and utilizing wheat's inherent disease-resistant genes, and subsequently breeding and promoting disease-resistant wheat varieties, is widely considered the most economical, effective, and environmentally friendly fundamental approach to achieving green and sustainable management of wheat powdery mildew. However, powdery mildew populations exhibit high genetic plasticity, and the dynamic evolution of their virulence races frequently leads to the "overcoming" of crop variety resistance. Currently, key powdery mildew resistance genes, such as... Pm2 , Pm4 , Pm12 , Pm21 and Pm6 They are facing serious challenges. Among them, Pm2 and Pm4 In some regions, multiple alleles of powdery mildew have shown reduced resistance or even complete loss. This situation highlights the importance of continuously identifying and developing new, especially broad-spectrum and durable powdery mildew genes, for ensuring the sustainability of wheat breeding and food security.

[0004] To address these challenges, broadening the genetic base of wheat and discovering underutilized disease-resistant gene resources from its wild relatives has become a recognized effective approach. Wild emmer wheat (Triticum dicoccoides, 2n = 4x = 28, AABB), as the direct wild ancestor of modern hexaploid common wheat and tetraploid durum wheat, originated in the Fertile Crescent region of the Middle East. Under long-term natural selection pressure, its genome has accumulated extremely rich genetic diversity, especially showing great potential in resistance to powdery mildew and other diseases, making it a natural treasure trove for wheat disease resistance genetic improvement. To date, researchers have successfully identified and formally named several powdery mildew resistance gene loci from wild emmer wheat, including...Pm16 , Pm26 , Pm30 , Pm36 , Pm41 , Pm42 , Pm64 and Pm69 In addition, there are a number of disease resistance sites with provisional names or already reported in studies, such as MlZec1 , MlIW72 , PmG16 , Ml3D232 , MlIW170 These genes, among others, demonstrate the species' enormous genetic potential for resistance. Nevertheless, of these discovered genes, only a small fraction exhibit this potential. Pm41 , Pm26 , Pm36 While a very small number of genes have successfully achieved map-based cloning and functional verification, the mechanisms of action of the vast majority of genes remain to be elucidated. This greatly limits the efficient use of these valuable resources in molecular marker-assisted selection and genetic engineering breeding.

[0005] Currently, several wheat powdery mildew resistance genes have been successfully cloned from wheat and its wild relatives, such as... Pm1 , Pm2 , Pm3 , Pm4 , Pm5 , Pm8 , Pm13 , Pm17 , Pm21 , Pm24 , Pm26 , Pm36 , Pm38 / Lr34 / Yr18 / Sr57 , Pm41 , Pm46 / Lr67 / Yr46 / Sr55 , Pm57 , Pm60 , Pm69 and WTK4 These findings not only deepen our understanding of the molecular mechanisms of wheat-powdery mildew interactions but also lay a solid theoretical and technological foundation for aggregating multiple disease-resistant genes and cultivating durable disease-resistant varieties through precision breeding techniques. However, given the ongoing evolutionary pressures of powdery mildew, further in-depth exploration of novel disease-resistant genes in wild resources such as wild emmer wheat, and accelerating their functional analysis and breeding applications, remains an urgent and important long-term task in the fields of plant pathology and crop genetics and breeding. Summary of the Invention

[0006] The technical problem to be solved by this invention is how to improve the resistance of wheat to powdery mildew.

[0007] To address the above technical problems, this invention provides a wheat powdery mildew resistance-related protein, named MlIW92 protein, which is a protein of type A1, A2, or A3: A1. The amino acid sequence is the protein that is the amino acid sequence shown in SEQ ID No. 2 of the sequence listing; A2, a protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, which has more than 80% identity with the protein shown in A1 and is associated with wheat powdery mildew resistance; A3. A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1 or A2.

[0008] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0009] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0010] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0011] In the aforementioned proteins, the 80% or more identity can be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0012] The proteins mentioned above are derived from wild emmer wheat.

[0013] Biomaterials related to the protein are also within the scope of protection of this invention.

[0014] The biomaterial related to the protein provided by this invention is any one of B1 to B5 below: B1. The nucleic acid molecule encoding the protein; B2, an expression cassette containing the nucleic acid molecule described in B1; B3, a recombinant vector containing the nucleic acid molecule described in B1, or a recombinant vector containing the expression cassette described in B2; B4. Recombinant microorganisms containing the nucleic acid molecules described in B1, or recombinant microorganisms containing the expression cassette described in B2, or recombinant microorganisms containing the recombinant vector described in B3; B5. Transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B1.

[0015] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0016] In the aforementioned biological materials, the nucleic acid molecule described in B1) can specifically be C1 or C2: C1. The coding sequence is the DNA molecule of SEQ ID No. 1 in the sequence listing; C2, The sequence is the DNA molecule of SEQ ID No. 3 in the sequence listing.

[0017] In the aforementioned biological materials, the expression cassette described in B2) refers to DNA capable of expressing MlIW92 in host cells, and this DNA may include not only the promoter but also... MlIW92 The promoter of gene transcription may also include a terminator. MlIW92 A terminator for gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: Ubi ProConstitutive promoters of cauliflower mosaic virus (CCV) include: 35S; a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology 120:979-992); a chemically induced promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by jasmonic acid methyl ester); heat shock promoter (US Patent 5,187,267); tetracycline-inducible promoter (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007)). 10099169.7), seed storage protein-specific promoters (e.g., promoters of bean globular protein, napin, oleosin, and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (I 985 Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0018] Existing plant expression vectors can be used to construct structures containing the aforementioned... MlIW92Recombinant expression vectors for gene expression cassettes. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pLGY-OE3, pCAMBIA1300, pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor, such as Agrobacterium crown gall induction (Ti) plasmid genes (e.g., carmine synthase genes). Nos The untranslated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) have similar functions. When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (e.g., those encoding enzymes that produce color changes). GUS Genes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes that confer resistance to the antibiotic hygromycin hph Genes, and the genes that confer resistance to methatrexate dhfr Genes such as EPSPS genes (which confer resistance to glyphosate) or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose, can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.

[0019] In the aforementioned biological materials, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.

[0020] To address the aforementioned technical problems, the present invention also provides a wheat disease resistance agent.

[0021] The wheat disease resistance agent provided by the present invention contains the protein and / or biological materials related to the protein.

[0022] The active ingredient of the above-mentioned wheat disease resistance agent may be the protein or the protein-related biological material. The active ingredient of the above-mentioned wheat disease resistance agent may also contain other biological and / or non-biological components. Other active ingredients of the above-mentioned agent can be determined by those skilled in the art based on the disease resistance effect of wheat.

[0023] Among the above-mentioned wheat disease resistance agents, the wheat disease resistance agent may be a drug for resisting powdery mildew.

[0024] Any of the following applications of the aforementioned protein or biological material, P1-P5, also fall within the scope of protection of this invention: P1. The application of the protein or the biomaterial in improving wheat powdery mildew resistance; P2. The application of the protein or the biomaterial in the preparation of products that improve resistance to wheat powdery mildew; P3. Application of the protein or the biomaterial in the cultivation of powdery mildew resistant wheat; P4. Application of the protein or the biomaterial in the preparation of wheat powdery mildew resistant products; P5. Application of the protein or the biological material in wheat breeding.

[0025] To address the aforementioned technical problems, the present invention also provides a method for breeding wheat resistant to powdery mildew.

[0026] The method for breeding powdery mildew-resistant wheat provided by the present invention includes the step of increasing the expression level of the protein or its encoding gene in the recipient wheat to obtain powdery mildew-resistant wheat; the powdery mildew resistance of the powdery mildew-resistant wheat is higher than that of the recipient seed wheat.

[0027] In the above method, increasing the expression level of the protein or its encoding gene in the recipient wheat can be achieved by introducing the encoding gene of the protein into the recipient wheat.

[0028] In the above method, the gene encoding the protein can be modified as follows before being introduced into the recipient plant to achieve better expression: 1) Modify the gene sequence adjacent to the initiation methionine to enable efficient translation initiation; for example, by using a sequence known to be effective in plants. 2) Linked to promoters of various plant expression to facilitate their expression in plants; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-selective, and tissue-specific promoters; the selection of promoters will vary with the time and space requirements of expression, and also depends on the target species; for example, tissue or organ-specific expression promoters, depending on the stage of development of the target receptor; although it has been shown that many promoters derived from dicotyledons are functional in monocotyledons and vice versa, ideally, dicotyledonous promoters are selected for expression in dicotyledons, and monocotyledonous promoters are selected for expression in monocotyledons; 3) Linking with a suitable transcription terminator can also improve the expression efficiency of the gene of the present invention; for example, tml from CaMV, E9 from rbcS; any available terminator known to function in plants can be linked with the gene of the present invention. 4) Introduce enhancer sequences, such as intron sequences (e.g., derived from Adhl and Bronzel) and viral leader sequences (e.g., derived from TMV, MCMV, and AMV).

[0029] The gene encoding the protein can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

[0030] In the above method, the powdery mildew-resistant wheat can be genetically modified wheat or wheat obtained through conventional breeding techniques such as hybridization.

[0031] In the above method, the recipient wheat is a type of wheat whose genome does not contain the gene encoding the protein MlIW92, such as the wheat variety Fielder.

[0032] In the above method, the pathogen causing powdery mildew can be powdery mildew fungus (… Blumeria graminis f.sp. tritici , Bgt Specifically, it can be the wheat-specific form of *Powdery Mildew*, such as *Powdery Mildew* (… Blumeria graminis f. sp. tritici , Bgt ) E09 strain.

[0033] The inventors of this invention obtained a powdery mildew resistance gene derived from wild emmer wheat. MlIW92 This invention enriches the gene resources for powdery mildew resistance in wheat disease resistance breeding. Introducing the gene encoding the MlIW92 protein into powdery mildew-susceptible wheat significantly improved the disease resistance of the transgenic plants. This invention has significant application and promotion value for plant powdery mildew breeding. Attached Figure Description

[0034] Figure 1 The wheat powdery mildew resistance gene in Example 1 of this invention MlIW92 Precise positioning. Among them, Figure 1 The expression of resistance to powdery mildew is shown in wild emmer wheat IW92 and durum wheat 81086A. Figure 1 b represents the wheat powdery mildew resistance gene. MlIW92 Precise positioning.

[0035] Figure 2 This is the result of functional verification of the wheat powdery mildew resistance gene transgenic gene in Example 1 of the present invention. Among them, Figure 2 'a' represents the recombinant plasmid pLGY-OE3- PKNLR On PK-NLR Schematic diagram of the expression box structure; Figure 2 b represents the result of powdery mildew resistance identification of overexpressing transgenic plants, with + indicating resistance and - indicating susceptibility. Detailed Implementation

[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0038] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0039] The wild emmer wheat IW92 described in the following examples was kindly provided by Dr. Gerechter-Amitai of the Agricultural Research Organization, The Volcani Center, Israel, and is disclosed in the literature “Li, M., Zhang, H., Xiao, H. et al. A membrane associated tandem kinase from wildemmer wheat confers broad-spectrum resistance to powdery mildew. Nat Commun 15, 3124 (2024).”, and is available to the public from the applicant.

[0040] The durum wheat 81086A in the following examples has been disclosed in the literature “Zhu, K., Li, M., Dong, L. et al. An atypical NLR pair TdCNL1 / TdCNL5 from wild emmer confers powdery mildewresistance in wheat. Nat Genet 57, 1553–1562 (2025).” and is available to the public from the applicant.

[0041] The wheat Fielder, which is highly susceptible to powdery mildew in the following examples, has been disclosed in the literature “Zhu, K., Li, M., Dong, L. et al. An atypical NLR pair TdCNL1 / TdCNL5 from wild emmer confers powderymildew resistance in wheat. Nat Genet 57, 1553–1562 (2025).” and is available to the public from the applicant.

[0042] The powdery mildew race E09 prevalent in the Beijing area described in the following examples has been disclosed in the literature “Zhu, K., Li, M., Dong, L. et al. An atypical NLR pair TdCNL1 / TdCNL5 from wild emmer conferspowdery mildew resistance in wheat. Nat Genet 57, 1553–1562 (2025).” and is available to the public from the applicant.

[0043] The starting plasmid pLGY-OE3 in the following examples has been disclosed in the literature “Zhu, K., Li, M., Dong, L. et al. An atypical NLR pair TdCNL1 / TdCNL5 from wild emmer confers powdery mildewresistance in wheat. Nat Genet 57, 1553–1562 (2025).” and is publicly available from the applicant.

[0044] Unless otherwise specified, the quantitative experiments in the following examples were all repeated three times, and the results were averaged.

[0045] Example 1 1. Identification of powdery mildew resistance in wild emmer wheat IW92 Powdery mildew resistance was assessed in wild emmer wheat IW92 (a gift from Dr. Gerechter-Amitai of the Volcani Center, Agricultural Research Organization, Israel), with durum wheat 81086A as a control. The results showed that IW92 exhibited immunity or high resistance to powdery mildew throughout its entire growth period, making it an excellent powdery mildew-resistant material (see...). Figure 1 (a).

[0046] 2. Wheat powdery mildew resistance gene MlIW92 Precise positioning Seedling resistance was assessed using the prevalent powdery mildew race E09 in the Beijing area to wild emmer wheat IW92, durum wheat 81086A, and IW92×81086A segregating populations and F3 families. The results showed that IW92 exhibited an immunoreactive phenotype (IT=0), while 81086A showed a highly susceptible phenotype (IT=4). The F1 generation of IW92 / 81086A also exhibited an immunoreactive phenotype (IT=0), consistent with the resistant parents. Identification of 656 IW92 / 81086A F2 segregating populations revealed that 498 were resistant and 158 were susceptible, with a chi-square test consistent with a 3:1 segregation ratio controlled by a single gene. Of the 656 F3 families of IW92 / 81086A, 167 families showed homozygous resistance, 331 families showed segregation between resistance and susceptibility, and 158 families showed homozygous susceptibility. Chi-square tests showed a segregation ratio consistent with a 1:2:1 ratio controlled by a single gene. This genetic analysis indicates that powdery mildew resistance in common wheat IW92 is controlled by a single dominant gene, tentatively named... MlIW92 .

[0047] By developing molecular markers to target wheat powdery mildew resistance genes MlIW92It was located between the near-terminal molecular markers IW92-46 and IW92-21 on chromosome 4AL. Further fine-tuning is needed. MlIW92 Regarding genes, the applicant constructed a genetic segregation population of 2896 F2 single plants using a cross between IW92 and 81086A. MlIW92 Genotyping of the F2 genetically segregating population was performed using the molecular markers IW92-46 and IW92-21, which are located flanking the gene mapping intervals, to identify key recombinant exchange individuals. During the seedling stage, the F2 generation of these key recombinant exchange individuals selected using molecular markers IW92-46 and IW92-21 was further analyzed using the powdery mildew race E09. 2:3 Family pedigrees were subjected to powdery mildew resistance identification. Simultaneously, based on the reference genome sequences of Chinese spring wheat (Zavitan) and wild emmer wheat (Langdon), novel molecular markers IW92-46 and IW92-21 were developed. MlIW92 The gene-tightly linked molecular marker IW92-66 was used to screen key recombination exchange singles for F1 generation. 2:3 Genotyping of family pedigrees to determine MlIW92 The genes are precisely mapped. Ultimately, this will... MlIW92 The gene was finely mapped between molecular markers IW92-66 and IW92-21.

[0048] 3. Wheat powdery mildew resistance gene MlIW92 Genetically modified functional verification RNA-seq analysis showed that in IW92 leaves inoculated with powdery mildew E09... TrdurLDN4A01G442400.m1 (tentatively referred to as) PK-NLR Also marked as PKNLR The expression level was significantly upregulated, which is MlIW92 The key candidate gene, whose nucleotide sequence is shown in SEQ ID No. 3, and whose CDS nucleotide sequence is shown in SEQ ID No. 1, encodes a CNL (PK-CC-NBS-LRR) protein with PK, CC, NBS, and LRR domains, whose amino acid sequence is shown in SEQ ID No. 2.

[0049] The applicant will PK-NLR Transgenic plants were obtained by Agrobacterium-mediated stable genetic transformation of Fielder wheat, which is highly susceptible to powdery mildew. The specific steps are as follows: cDNA was extracted from wild emmer wheat IW92 and used as a template for PCR amplification. The primer sequences are as follows: F1: 5'-tgcagccctaggcctactagggatccATGGGGACGTACTTGTCCTC-3' (uppercase letters indicate the sequence that is the same as the sequence of SEQ ID No. 1, positions 1-20); R1 : 5'-tgatacgaacgaaagctctgagctcCTAAAAACAGAAGGGGCGAT-3' (The uppercase letters indicate the sequence that is the reverse complementary sequence to the sequence of SEQ ID No. 1, positions 3872-3891).

[0050] The obtained PCR product is PK-NLR Fragments, after sequencing, PK-NLR The fragment has PK-NLR The CDS sequence (as shown in SEQ ID No. 1 in the sequence list).

[0051] Will PK-NLR The fragment was inserted into the starting plasmid pLGY-OE3 via homologous recombination, resulting in the recombinant plasmid pLGY-OE3- PKNLR Recombinant plasmid pLGY-OE3- PKNLR contain PK-NLR Expression box (see results) Figure 2 (a) Initiated in the expression box PK-NLR The promoter of expression is Ubi Pro , terminated child NOS Ter .

[0052] The recombinant plasmid pLGY-OE3- PKNLR By introducing Agrobacterium EHA105 (a product of Beijing Huayueyang Biotechnology Co., Ltd.), recombinant Agrobacterium EHA105-pLGY-OE3- was obtained. PKNLR The Agrobacterium-mediated recombinant plasmid pLGY-OE3- was used in accordance with standard procedures in the field. PKNLR Transformation of recipient wheat to prepare transformant plants. Specifically, recombinant Agrobacterium EHA105-pLGY-OE3- PKNLR Embryogenic callus from common wheat (Fielder) was genetically transformed, followed by co-culture, selection culture, differentiation and regeneration culture, and rooting culture to obtain regenerated plants, i.e., T0 generation plants. Total DNA was extracted from leaves of the T0 generation regenerated plants and subjected to PCR identification. The identification primers were selected from… F2 and R2 composition.

[0053] F2 :GCAAGCTGACCAATCTGAGG; R2:GAGGCCACGATTTGACACAT.

[0054] The plants that tested positive were T0 generation transgenic plants, among which 3 plants were numbered as follows: PKNLR-OE#1 , PKNLR-OE#2 and PKNLR-OE#3 .

[0055] During the seedling stage PK-NLR The T0 generation transgenic plants that were positive for powdery mildew were tested for resistance, as detailed below: Transgenic plants were grown in pots in a greenhouse. The resistance of these plants to powdery mildew race E09, prevalent in the Beijing area, was assessed throughout their growth cycle. Transgenic plants were grown in pots, with susceptible controls (Fielder) planted alongside them. Inoculum inoculation trays were placed nearby, and the trays were replaced every 7 days for saturation inoculation. Powdery mildew resistance was assessed at the two-leaf, three-leaf, four-leaf, jointing, and mature plant stages.

[0056] The results showed that the susceptible control Fielder and negative transgenic plants were highly susceptible to powdery mildew, while the positive transgenic plants were highly resistant to powdery mildew. Figure 2 (b) Explanation that is PK-NLR MlIW92 The gene (CDS sequence is shown in SEQ ID No. 1) and the protein it encodes is called MlIW92 protein (amino acid sequence is shown in SEQ ID No. 2).

[0057] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A protein, characterized in that it is A protein as follows A1, A2 or A3: A1, a protein whose amino acid sequence is the amino acid sequence shown in SEQ ID No. 2 in the sequence listing; A2, a protein having 80% or more identity to the protein shown in A1 and being associated with wheat powdery mildew resistance, obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID No. 2 in the sequence listing; A3, a fusion protein obtained by linking a protein tag to the N terminus or / and C terminus of A1 or A2.

2. Biomaterials associated with the protein of claim 1, characterized in that: Any one of the following B1 to B5: B1, a nucleic acid molecule encoding the protein of claim 1; B2, an expression cassette containing the nucleic acid molecule of B1; B3, a recombinant vector containing the nucleic acid molecule of B1 or the expression cassette of B2; B4, a recombinant microorganism containing the nucleic acid molecule of B1 or the expression cassette of B2 or the recombinant vector of B3; B5, a transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule of B1.

3. The biomaterial of claim 2, wherein: B1) the nucleic acid molecule is C1 or C2: C1, a DNA molecule encoding the sequence shown in SEQ ID No. 1 in the sequence listing; C2, a DNA molecule having the sequence shown in SEQ ID No. 3 in the sequence listing.

4. A wheat disease resistance agent characterized by: The wheat disease resistance agent contains the protein of claim 1 or / and the biological material of claim 2 or 3.

5. The wheat disease resistance agent according to claim 4, characterized in that: The wheat disease resistance agent is an agent against powdery mildew.

6. Use of a protein according to claim 1, characterized in that: The application is any one of P1-P5: P1, the application of the protein or the biological material in improving the resistance of wheat to powdery mildew; P2, the application of the protein or the biological material in preparing a product for improving the resistance of wheat to powdery mildew; P3, the application of the protein or the biological material in breeding wheat resistant to powdery mildew; P4, the application of the protein or the biological material in preparing a wheat product against powdery mildew; P5, the application of the protein or the biological material in wheat breeding.

7. Use of the biomaterial according to claim 2 or 3, characterized in that: The application is any one of P1-P5: P1, the application of the protein or the biological material in improving the resistance of wheat to powdery mildew; P2, the application of the protein or the biological material in preparing a product for improving the resistance of wheat to powdery mildew; P3, the application of the protein or the biological material in breeding wheat resistant to powdery mildew; P4, the application of the protein or the biological material in preparing a wheat product against powdery mildew; P5, the application of the protein or the biological material in wheat breeding.

8. A method of breeding wheat resistant to powdery mildew, characterized by: The method comprises the step of increasing the expression amount of the protein or its encoding gene in the recipient wheat to obtain wheat resistant to powdery mildew; the powdery mildew resistance of the wheat resistant to powdery mildew is higher than that of the recipient wheat.

9. The method of claim 8, wherein: The recipient wheat is wheat that does not contain a gene encoding the protein of claim 1 in its genome.

10. The method according to claim 8 or 9, characterized in that: The recipient wheat is wheat variety Fielder.

Images