Low-toxicity high-tumor targeting salmonella typhimurium strain as well as construction method and application thereof

Abstract

The invention provides a low-toxicity and high-tumor targeting salmonella typhimurium strain. According to the low-toxicity and high-tumor targeting salmonella typhimurium strain, an msbB gene segment (STM142297) and a hemA gene segment (STM142147) are deleted from the strain; the nucleotide sequence of the msbB gene segment is as shown in SEQ ID No. 1, and the nucleotide sequence of the hemA gene segment is as shown in SEQ ID No. 2; the bacterial strain is classified and named as salmonella typhimurium, and is preserved in the general microbiological center of the China Committee for Culture Collection of Microorganisms, the preservation number is CGMCC No.34793, and the preservation time is June 9, 2025. The obtained strain is low in toxicity, low in damage to hosts, high in tumor targeting performance and suitable for being used as a tumor treatment carrier.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a low-toxicity high-tumor-targeting Salmonella typhimurium strain and a construction method and application thereof. BACKGROUND

[0002] Tumor has become one of the important diseases threatening human health and life, and it and cardiovascular disease are two great difficulties in the medical field. One of the main reasons for the high mortality rate of tumor patients is that there is currently a lack of effective tumor early screening and diagnosis technology worldwide, which makes it difficult to find tumor in the early stage. In addition, the lack of effective treatment methods also makes the tumor mortality rate high. Traditional tumor treatment methods such as surgical resection, chemical drug treatment and radiotherapy cause great harm to the human body, even more than the tumor itself. Bacterial-mediated tumor treatment is a non-traditional tumor treatment method with a history of more than 100 years.

[0003] In recent years, researchers have found that anaerobic bacteria or facultative anaerobic bacteria including Escherichia coli, Clostridium butyricum, Bifidobacterium and Salmonella can mediate anti-tumor effect, and Salmonella typhimurium is the "star bacteria" of anti-tumor. Salmonella typhimurium has motility and can be enriched in various tumor tissues such as melanoma, breast tumor, pancreatic tumor and colon tumor. Tumor tissues lack effective mechanisms for clearing Salmonella typhimurium, and attenuated Salmonella typhimurium in normal tissues is easily eliminated by immunity. These characteristics make it a promising solid tumor treatment carrier. Researchers have genetically modified Salmonella typhimurium to have better safety and higher tumor targeting. However, the strains obtained by the prior art either have insufficient targeting or have too much toxicity and are not suitable as tumor treatment carriers. SUMMARY

[0004] In view of the defects of the prior art, the purpose of the present application is to provide a strain with high safety and high tumor targeting, and a method for constructing the strain and application of the strain as a bacterial carrier for tumor gene therapy.

[0005] In order to achieve the above purpose, the present application provides the following technical solutions:

[0006] The application first provides a low-toxicity high-tumor-targeting Salmonella typhimurium strain, wherein the strain is deficient in an msbB gene fragment (STM14_2297) and a hemA gene fragment (STM14_2147); the nucleotide sequence of the msbB gene fragment is shown in SEQ ID No. 1, and the nucleotide sequence of the hemA gene fragment is shown in SEQ ID No. 2; the taxonomic name of the strain is Salmonela typhimurium, and the strain is preserved in the China General Microbiological Culture Collection Center on June 9, 2025, with a preservation number of CGMCC No. 34793.

[0007] The application further provides a construction method of the low-toxicity high-tumor-targeting Salmonella typhimurium strain, and the construction method comprises the following steps.

[0008] In the Salmonella typhimurium strain ATCC 14028s, the msbB gene and the hemA gene are inactivated by using a suicide plasmid to mediate a scarless knockout, so that the construction of the strain is completed.

[0009] Preferably, the used suicide plasmid is pRE112.

[0010] Specifically, the construction method of the strain is as follows.

[0011] (1) The PCR reaction solution is prepared according to the following Table 1 system, the genome of the Salmonella typhimurium ATCC 14028s strain is used as a template, msbB UP1 and msbB UP2 in Table 2 are used as primers to amplify the fragment msbB-U, msbB DP1 and msbB DP2 are used as primers to amplify the fragment msbB-D, hemA UP1 and hemA UP2 are used as primers to amplify the fragment hemA-U, hemA DP1 and hemA DP2 are used as primers to amplify the fragment hemA-D, purM UP1 and purM UP2 are used as primers to amplify the fragment purM-U, and purM DP1 and purM DP2 are used as primers to amplify the fragment purM-D. The PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 30 cycles; 72℃ for 5 min; 12℃ for sample preservation; the PCR product is purified by using a DNA purification recovery kit;

[0012] Table 1 High-fidelity PCR reaction system

[0013]

[0014] Table 2 Information of the used primers

[0015]

[0016] (2) PCR reaction solution was prepared according to the system in Table 1, and msbB-UD was amplified by using purified DNA fragments msbB-U and msbB-D as templates and msbB UP1 and msbB DP2 as primers; hemA-UD was amplified by using purified DNA fragments hemA-U and hemA-D as templates and hemA UP1 and hemA DP2 as primers; purM-UD was amplified by using purified DNA fragments purM-U and purM-D as templates and purM UP1 and purM DP2 as primers; the PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 60 s, 30 cycles; 72°C for 5 min; 12°C for sample storage; and the PCR products were purified by using a DNA purification recovery kit;

[0017] (3) Enzymatic digestion reaction solution was prepared according to the system in Table 3, and plasmid pRE112, DNA fragment msbB-UD, DNA fragment hemA-UD and DNA fragment purM-UD were digested by using restriction endonuclease XbaI / BamHI. After the reaction solution was mixed, it was placed at 37°C for 1 h, and then the above-mentioned PCR products were purified by using a DNA purification recovery kit;

[0018] Table 3 Enzymatic digestion reaction solution system

[0019]

[0020] (4) DNA ligation reaction solution was prepared according to the system in Table 4, and the above-mentioned digested plasmid pRE112 was ligated with DNA fragment msbB-UD or hemA-UD or purM-UD by using T4 DNA ligase, and the reaction solution was mixed and then placed at 16°C for 12 h for ligation;

[0021] Table 4 DNA ligation reaction solution system

[0022]

[0023]

[0024] (5) Take 10 μL of the ligation product and add it to 100 μL of DH5α competent cells, and place it in ice for 30 min; heat shock the competent cells at 42°C for 60 s; add 1 mL of fresh LB liquid medium to the heat-shocked competent cells, and incubate at 37°C, 220 rpm for 1 h; centrifuge the recovered bacteria at room temperature at 5000 rpm for 2 min, and discard the supernatant; resuspend the bacteria in 200 μL of PBS Buffer, and spread them on LB+Cm plates containing 20 μg / mL chloramphenicol; identify and screen positive clones by PCR, and extract plasmids for sequencing analysis; the constructed suicide plasmids are pRE112::msbB-UD, pRE112::hemA-UD and pRE112::purM-UD respectively;

[0025] (6) Transform the constructed suicide plasmids pRE112::msbB-UD, pRE112::hemA-UD and pRE112::purM-UD into the conjugative transfer donor Escherichia coli 7213, and screen positive transformants on LB+Cm+50 μg / mL DAP plates, namely 7213pRE112::msbB-UD, 7213pRE112::hemA-UD and 7213pRE112::purM-UD; inoculate 7213pRE112::msbB-UD and S. typhimurium wild type (WT) into LB liquid medium, and incubate them at 37°C with shaking until the logarithmic growth phase; mix the two bacterial liquids at a ratio of 2:1, take 500 μL of the concentrated bacterial liquid, and spread it on an LB plate; incubate the plate at 37°C for 8 h, scrape the bacteria, and spread them on an LB+Cm plate to screen positive conjugants; inoculate the positive conjugants into LB+Cm liquid medium, and incubate them at 37°C with shaking until the logarithmic growth phase; dilute the bacteria 50-fold, take 100 μL, and spread it on an LB+Sucrose plate; incubate the plate at room temperature; identify whether the grown colonies are msbB gene knockout strains by PCR, and perform sequencing identification; and successfully construct the deletion strain S. typhimurium ATCC 14028sΔmsbB;

[0026] (7) According to the above method, S. typhimurium ATCC 14028sΔmsbBΔhemA is constructed using 7213pRE112::hemA-UD and S. typhimurium ATCC 14028sΔmsbB; and S. typhimurium ATCC 14028sΔmsbBΔpurM is constructed using 7213pRE112::purM-UD and S. typhimurium ATCC 14028sΔmsbB.

[0027] The application further provides the use of the low-toxicity and high-tumor-targeting S. typhimurium strain as described above as a bacterial carrier for tumor gene therapy.

[0028] Advantages of the present application:

[0029] 1. The growth rate of the obtained strain is not significantly reduced compared with the parent strain, and the strain can grow in LB medium containing porphyrin precursor material amino acetyl propionic acid, but cannot grow in LB medium;

[0030] 2. The obtained strain does not grow on plates made of mouse liver tissue and tumor tissue; the lethality of the strain to tumor-bearing mice is significantly reduced compared with the ATCC 14028sΔmsbBΔpurM strain; the colonization amount of the strain in liver tissue is significantly reduced compared with the ATCC 14028sΔmsbBΔpurM strain; live imaging shows that the strain only has obvious colonization in tumor tissue in tumor-bearing mice ( Figure 5 ), and the mice are in normal mental state.

[0031] 3. The obtained strain has low toxicity, low damage to the host, high tumor targeting, and is suitable as a tumor treatment carrier. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 The growth curve result graph of the strain constructed in the present application;

[0033] Figure 2 The experimental result graph of the plate growth of the strain constructed in the present application;

[0034] Figure 3 The survival curve result graph of the mice infected with the strain of the present application;

[0035] Figure 4 The colonization result graph of the strain of the present application in the liver of mice;

[0036] Figure 5 The colonization result graph of the strain of the present application in tumor-bearing mice. DETAILED DESCRIPTION

[0037] The present application will be specifically described below through examples, and it is necessary to point out here that the following examples are only used to further illustrate the present application, and cannot be understood as limiting the protection scope of the present application. Some non-essential improvements and adjustments made by skilled persons in the art according to the above application content still belong to the protection scope of the present application.

[0038] Example 1

[0039] The inventors first knocked out the msbB gene (Gene ID: 11757534) and further knocked out the hemA gene (Gene ID: 11753605) which is essential for porphyrin synthesis, to construct a porphyrin auxotroph of Salmonella typhimurium (ATCC 14028sΔmsbBΔhemA strain). It was preserved in the China General Microbiological Culture Collection Center on June 9, 2025, at address: No. 1, Yihuangyuan 3rd, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences, Postcode: 100101, and the preservation number is CGMCC No. 34793.

[0040] The specific scheme is as follows:

[0041] (1) Construction of ATCC 14028sΔmsbBΔhemA strain

[0042] In Salmonella strain ATCC 14028s (purchased from ATCC company), the msbB gene (Gene ID: 11757534) and hemA gene (Gene ID: 11753605) were knocked out using suicide plasmid pRE112, i.e. to construct strain ATCC 14028sΔmsbBΔhemA. The specific process is as follows:

[0043] 1) Prepare the PCR reaction solution according to Table 1, use the genome of Salmonella typhimurium ATCC 14028s strain as the template, use msbB UP1 and msbB UP2 in Table 2 as primers to amplify fragment msbB-U, use msbB DP1 and msbB DP2 as primers to amplify fragment msbB-D; use hemA UP1 and hemA UP2 as primers to amplify fragment hemA-U, use hemA DP1 and hemA DP2 as primers to amplify fragment hemA-D; use purM UP1 and purM UP2 as primers to amplify fragment purM-U, and use purM DP1 and purM DP2 as primers to amplify fragment purM-D. The PCR reaction conditions are: 95℃ pre-denaturation for 3min; 95℃ for 15s, 55℃ for 15s, 72℃ for 30s, 30 cycles; 72℃ for 5min; 12℃ to store the sample; purify the PCR product with a DNA purification recovery kit;

[0044] Table 1 High-fidelity PCR reaction system

[0045]

[0046] Table 2 Information of primers used

[0047]

[0048]

[0049] 2) PCR reaction solution was prepared according to Table 1, and msbB-UD was amplified using msbB-UP1 and msbB-DP2 as primers and msbB-U and msbB-D as templates; hemA-UD was amplified using hemA-UP1 and hemA-DP2 as primers and hemA-U and hemA-D as templates; purM-UD was amplified using purM-UP1 and purM-DP2 as primers and purM-U and purM-D as templates; the PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 60 s, 30 cycles; 72°C for 5 min; 12°C for sample storage; and the PCR products were purified using a DNA purification recovery kit;

[0050] 3) Enzymatic digestion reaction solution was prepared according to Table 3, and plasmid pRE112, DNA fragment msbB-UD, DNA fragment hemA-UD and DNA fragment purM-UD were digested using restriction endonuclease XbaI / BamHI. After mixing the reaction solution, it was placed at 37°C for 1 h, and then the above-mentioned PCR products were purified using a DNA purification recovery kit;

[0051] Table 3 Enzymatic digestion reaction solution system

[0052]

[0053] 4) DNA ligation reaction solution was prepared according to Table 4, and plasmid pRE112 after digestion was ligated with DNA fragment msbB-UD or hemA-UD or purM-UD using T4 DNA ligase. After mixing the reaction solution, it was placed at 16°C for 12 h;

[0054] Table 4 DNA ligation reaction solution system

[0055]

[0056] 5) Take 10 μL ligation product into 100 μL DH5α competent cells, place in ice for 30 min; place the competent cells in 42°C heat shock for 60 s; add 1 mL fresh LB liquid medium to the heat-shocked competent cells, place in 37°C, 220 rpm for 1 h for recovery; place the recovered bacterial solution in room temperature, centrifuge at 5000 rpm for 2 min, discard the supernatant; resuspend the bacterial bodies with 200 μL PBS Buffer, and spread on LB+Cm plates containing 20 μg / mL chloramphenicol, screen positive clones by PCR identification, and extract plasmids for sequencing analysis; the constructed suicide plasmids are pRE112::msbB-UD, pRE112::hemA-UD and pRE112::purM-UD respectively;

[0057] 6) Transform the constructed suicide plasmids pRE112::msbB-UD, pRE112::hemA-UD and pRE112::purM-UD into the conjugative transfer donor Escherichia coli 7213, and screen positive transformants on LB+Cm+50 μg / mL DAP plates, i.e. 7213pRE112::msbB-UD, 7213pRE112::hemA-UD and 7213pRE112::purM-UD; inoculate 7213pRE112::msbB-UD and S. typhimurium wild type (WT) into LB liquid medium, and incubate at 37°C with shaking until logarithmic growth phase; mix the two bacterial solutions at a ratio of 2:1, take 500 μL concentrated bacterial solution, and spread on LB plates; incubate at 37°C for 8 h, scrape the bacterial bodies, and spread on LB+Cm to screen positive conjugants; inoculate the positive conjugants into LB+Cm liquid medium, and incubate at 37°C with shaking until logarithmic growth phase; dilute 50-fold, take 100 μL, and spread on LB+Sucrose plates for room temperature incubation; identify by PCR whether the grown colonies are msbB gene knockout strains, and perform sequencing identification; successfully constructed deletion strain is S. typhimurium ATCC 14028sΔmsbB;

[0058] According to the same method, S. typhimurium ATCC 14028sΔmsbBΔhemA is constructed using 7213pRE112::hemA-UD and S. typhimurium ATCC 14028sΔmsbB; and S. typhimurium ATCC 14028sΔmsbBΔpurM is constructed using 7213pRE112::purM-UD and S. typhimurium ATCC 14028sΔmsbB.

[0059] (2) Growth curve of ATCC 14028sΔmsbBΔhemA strain

[0060] Salmonella strains ATCC 14028s WT, ΔmsbB and ΔmsbB ΔhemA were cultured overnight, 100 μL of overnight culture was diluted into 10 mL fresh LB medium and incubated at 37°C, 180 r / min. The OD of the culture was measured every hour. -1 Diluted into fresh LB + Δala (LB medium containing porphyrin precursor material, aminolevulinic acid), incubated at 37°C, 180 r / min. The OD of the culture was measured every hour. 600 The results show that the growth of ATCC 14028s ΔmsbB ΔhemA strain has no obvious change compared with the parent strain.

[0061] (3) Auxotrophic growth of ATCC 14028s ΔmsbB ΔhemA strain

[0062] Salmonella strains ATCC 14028s ΔmsbB ΔhemA, ΔmsbB ΔpurM and ΔmsbB were cultured overnight, 100 μL of overnight culture was diluted into 10 mL fresh LB medium and incubated at 37°C, 180 r / min. The OD of the culture was measured every hour. -1 Diluted into fresh LB + Δala or LB, incubated at 37°C, 180 r / min until the logarithmic growth phase, diluted with PBS to an appropriate concentration, 10 1 , 10 2 and 10 3 CFU order of magnitude of bacteria were dropped on LB plates, LB + Δala plates, 1 / 4 Tumor tissue plates and 1 / 4 Liver tissue plates. Among them, 1 / 4 Tumor tissue plates and 1 / 4 Liver tissue plates refer to plates containing 1 / 4 tissue grinding liquid. The results show that ATCC 14028s ΔmsbB ΔpurM strain can grow in LB medium containing porphyrin precursor material Δala (aminolevulinic acid), cannot grow in LB, and cannot grow on plates made of mouse liver tissue and tumor tissue.

[0063] (4) Survival curve of mice infected with ATCC 14028s ΔmsbB ΔpurM strain

[0064] A tumor-bearing mouse model was constructed using esophageal cancer Eca109 cells, and the steps were as follows: male BALB / c nude mice with a body weight of 18-20 g were raised in a specific pathogen-free facility with controlled humidity and temperature, with a 12-hour light / dark cycle, and free access to food and water. The mice were subcutaneously injected with 5 × 10 6 esophageal cancer Eca109 cells, and bacterial infection was performed when the tumor volume grew to about 125 mm 3 . Mice were infected by intraperitoneal injection with Salmonella strains ATCC 14028s ΔmsbB ΔhemA, ΔmsbB ΔpurM and ΔmsbB. The infection dose of ΔmsbB (L) was 1.14 × 10 6CFU / mouse, the infection dose of ΔmsbBΔpurM (L) and ΔmsbBΔhemA (L) were 1.13 x 10 6 and 6.6 x 10 5 CFU / mouse, the infection dose of ΔmsbBΔpurM (H) and ΔmsbBΔhemA (H) were 7.3 x 10 6 and 6.5 x 10 6 CFU / mouse. The number of mice in each group was 4-8. The results showed that ATCC 14028sΔmsbBΔhemA was low virulence, and no mice died after infection, and had good safety.

[0065] (5) Colonization of ATCC 14028sΔmsbBΔpurM in the liver of mice

[0066] The tumor-bearing mouse model was constructed with esophageal cancer Eca109 cells, and when the tumor volume grew to about 125 mm 3 , the mice were infected by intraperitoneal injection with ATCC 14028sΔmsbBΔhemA and ΔmsbBΔpurM. The infection dose of ΔmsbBΔpurM was 1.13 x 10 6 CFU / mouse, and the infection dose of ΔmsbBΔhemA (L) and ΔmsbBΔhemA (H) were 6.6 x 10 5 and 6.5 x 10 6 CFU / mouse. After 15 days of infection, the mice were sacrificed, the liver tissues of the mice were aseptically removed and weighed, the liver was placed in a sterile grinding bag, 1 mL of sterile PBS was added, and the liver was crushed by grinding back and forth with a grinding rod, and the tissue grinding liquid was aspirated, diluted to an appropriate concentration, and then plated on LB plates for viable cell counting analysis. The results showed that the toxicity of ATCC 14028sΔmsbBΔhemA strain was much lower than that of ΔmsbBΔpurM strain.

[0067] (6) Colonization of ATCC 14028sΔmsbBΔpurM in tumor-bearing mice

[0068] The tumor-bearing mouse model was constructed with esophageal cancer Eca109 cells, and when the tumor volume grew to about 125 mm 3The mice were infected with Salmonella strain ATCC 14028sΔmsbBΔhemA, ΔmsbBΔpurM and ΔmsbB carrying chemiluminescent markers by intraperitoneal injection. The colonization of each strain in the mice was observed every 3 days after infection by using an animal fluorescence imaging system, and the mice were anesthetized by intraperitoneal injection of 100 μl of 1.5% sodium pentobarbital before imaging. The results show that ATCC 14028sΔmsbBΔhemA only has images at the tumor site; the survival state of the observed mice again shows that the safety of ATCC 14028sΔmsbBΔhemA strain is higher than that of ΔmsbBΔpurM strain.

[0069] The results corresponding to the above experiment can be seen in Figures 1-5 , wherein, Figure 1 is a growth curve result graph of the constructed strain of the application; Figure 2 is an experimental result graph of the constructed strain of the application on a plate; Figure 3 is a survival curve result graph of the mice infected with the strain of the application; Figure 4 is a colonization result graph of the strain of the application in the liver of mice; Figure 5 is a colonization result graph of the strain of the application in tumor-bearing mice.

[0070] Gene sequence list

[0071] SEQ ID No. 1:

[0072] atggaaaccaaaaaaaataatagtgagtatatccctgaattcgaaaaatcctttcgctatccacagtattggggcgcctggttgggcgcggcggcaatggcggggatcgcattaacaccggcatcattccgcgaccctttgctggcgacgctggggcgttttgccggacggctggggaagagttctcgtcgccgggcgctaattaatctgtcgttgtgctttccgcagcgtagcgaagctgagcgcgaagcgattgtcgatgagatgttcgccaccgcgccacaggcaatggcgatgatggctgagttggcgatgcgcggtccgaaaaaaattcaacagcgtgttgactgggaaggtctggagattatcgaggagatgcgtcgtaacgacgaaaaagtcatttttctcgtaccgcatggctggggcgtcgacattccagccatgctgatggcctctcaggggcaaaaaatggcggcgatgtttcataatcagggtaatccggtttttgactatatctggaacacagtgcgtcggcgtttcggcggacgtttgcatgcgcgtaatgacgggattaaaccctttattcagtctgttcgtcagggctactggggttactacctgccggaccaggatcacggcccggagcatagtgaattcgttgatttctttgcgacatacaaagcgacgctgcctgcaattggtcggctgatgaaagtgtgccgcgcacgcgtgataccgcttttcccggtgtataatggtaaaacgcatcgcctgactatccagattcgcccgccaatggacgatctgctcacggctgacgaccacactatcgccagacggatgaacgaagaggtcgaaatttttgtcggcccgcatccggaacagtacacctggatcctgaagctgctcaaaacccgcaagccaggcgagattcagccgtataagcgtaaagatctttatcccatcaaataa

[0073] SEQ ID No. 2:

[0074]

Claims

1. A low-toxicity high-tumor targeting Salmonella typhimurium strain, characterized in that, The strain lacks an msbB gene fragment and a hemA gene fragment; the nucleotide sequence of the msbB gene fragment is shown as SEQ ID No. 1, and the nucleotide sequence of the hemA gene fragment is shown as SEQ ID No. 2; the taxonomic name of the strain is Salmonela typhimurium, and the strain is preserved in the China General Microbiological Culture Collection Center on June 9, 2025, with a preservation number of CGMCC No. 34793.

2. A method for constructing a low-toxicity high-tumor targeting Salmonella typhimurium strain, characterized by, The construction method comprises the following steps: In the Salmonella strain ATCC 14028s, the msbB gene and the hemA gene are knocked out by using a suicide plasmid to mediate a scarless knockout, that is, the construction of the strain is completed.

3. The method of constructing a low-toxicity high-tumor-targeting Salmonella typhimurium strain according to claim 2, characterized in that, The suicide plasmid used is pRE112.

4. The method of constructing a low-toxicity high-tumor-targeting Salmonella typhimurium strain according to claim 3, characterized in that, The construction method of the strain is as follows: (1) The PCR reaction solution is prepared according to the system in Table 1, the genome of the Salmonella typhimurium ATCC 14028s strain is used as a template, the primers msbB UP1 and msbB UP2 in Table 2 are used to amplify the fragment msbB-U, the primers msbB DP1 and msbB DP2 are used to amplify the fragment msbB-D, the primers hemA UP1 and hemA UP2 are used to amplify the fragment hemA-U, the primers hemA DP1 and hemA DP2 are used to amplify the fragment hemA-D, the primers purM UP1 and purM UP2 are used to amplify the fragment purM-U, and the primers purM DP1 and purM DP2 are used to amplify the fragment purM-D. The PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 30 cycles; 72℃ for 5 min; 12℃ for sample storage; and the DNA purification and recovery kit is used for purifying the PCR product; Table 1 High-fidelity PCR reaction system Table 2 Information of primers used (2) The PCR reaction solution is prepared according to the system in Table 1, the purified DNA fragments msbB-U and msbB-D are used as templates, the primers msbB UP1 and msbB DP2 are used to amplify the fragment msbB-UD, the purified DNA fragments hemA-U and hemA-D are used as templates, the primers hemA UP1 and hemA DP2 are used to amplify the fragment hemA-UD, the purified DNA fragments purM-U and purM-D are used as templates, and the primers purM UP1 and purM DP2 are used to amplify the fragment purM-UD; the PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 60 s, 30 cycles; 72℃ for 5 min; 12℃ for sample storage; and the DNA purification and recovery kit is used for purifying the PCR product; (3) The enzyme digestion reaction solution was prepared according to Table 3, and the plasmid pRE112, the DNA fragment msbB-UD, the DNA fragment hemA-UD and the DNA fragment purM-UD were digested by using the restriction endonuclease XbaI / BamHI. After the reaction solution was mixed, it was placed at 37°C for 1h, and then the DNA purification recovery kit was used to purify the above-mentioned PCR products; Table 3 Enzyme digestion reaction solution system (4) The DNA ligation reaction solution was prepared according to Table 4, and the above-mentioned digested plasmid pRE112 was ligated with the DNA fragment msbB-UD or hemA-UD or purM-UD by using T4 DNA ligase. After the reaction solution was mixed, it was placed at 16°C for 12h; Table 4 DNA ligation reaction solution system (5) 10μL of the ligation product was added to 100μL of DH5α competent cells, and the competent cells were placed in ice for 30min; the competent cells were placed at 42°C for 60s; 1mL of fresh LB liquid medium was added to the heat-shocked competent cells, and the mixture was placed at 37°C, 220rpm for 1h; after recovery, the bacterial solution was placed at room temperature, and centrifuged at 5000rpm for 2min, and the supernatant was discarded; the bacterial body was resuspended with 200μL of PBS Buffer, and was coated on an LB+Cm plate containing 20μg / mL of chloramphenicol. The positive clones were screened by PCR identification, and the plasmid was extracted for sequencing analysis. The constructed suicide plasmids were pRE112::msbB-UD, pRE112::hemA-UD and pRE112::purM-UD; (6) The constructed suicide plasmids pRE112::msbB-UD, pRE112::hemA-UD and pRE112::purM-UD were transformed into the conjugative transfer donor Escherichia coli 7213, and the positive transformants were screened on an LB+Cm+50μg / mL DAP plate, i.e. 7213pRE112::msbB-UD, 7213pRE112::hemA-UD and 7213pRE112::purM-UD; 7213pRE112::msbB-UD and S. typhimurium wild strain (WT) were inoculated into LB liquid medium, and were cultured at 37°C until the logarithmic growth phase. The two bacterial solutions were mixed at a ratio of 2:1, 500μL of the concentrated bacterial solution was coated on an LB plate, and was incubated at 37°C for 8h. The bacterial body was scraped and was coated on an LB+Cm plate to screen the positive conjugants. The positive conjugants were inoculated into LB+Cm liquid medium, and were cultured at 37°C until the logarithmic growth phase. Then, the culture was diluted 50 times, 100μL of which was coated on an LB+Sucrose plate and was incubated at room temperature. Whether the grown colonies were msbB gene knockout strains was identified by PCR, and sequencing identification was performed. The successfully constructed deletion strain was S. typhimurium ATCC 14028sΔmsbB. (7) S. typhimurium ATCC 14028sAmshBAhemA was constructed from S. typhimurium ATCC 14028sAmshB and 7213pRE112::hemA-UD according to the above method; S. typhimurium ATCC 14028sAmshBApurM was constructed from S. typhimurium ATCC 14028sAmshB and 7213pRE112::purM-UD according to the above method.

5. The use of the low-toxic high-tumor-targeting S. typhimurium strain of claim 1 or the low-toxic high-tumor-targeting S. typhimurium strain constructed by the method of any one of claims 2 to 4 as a bacterial vector for tumor gene therapy.

Images