Compound enzyme and application thereof in enzymolysis of palm meal

Abstract

The invention relates to the technical field of feed production, and particularly provides a compound enzyme and application thereof in enzymolysis of palm meal. The compound enzyme is specially designed according to the nutritional characteristics of the palm meal, non-starch polysaccharide components such as protein, cellulose and mannan in the palm meal can be effectively subjected to enzymolysis, the anti-nutrition effect of non-starch polysaccharide is reduced, the content of soluble oligosaccharide, small molecular protein and the like is increased, and the feeding value of the palm meal is improved.

Description

Technical Field

[0001] This invention relates to the field of feed production technology, specifically to a compound enzyme and its application in the enzymatic hydrolysis of palm meal. Background Technology

[0002] Livestock and poultry feed mainly consists of two categories of feed ingredients: energy-based feed ingredients and protein-based feed ingredients. Soybean meal is one of the most commonly used protein-based feed ingredients. However, my country mainly relies on imported soybeans. When soybean meal prices are high, other protein-based feed ingredients can be used to replace some soybean meal, and palm oil meal is one of them. Palm oil meal is inexpensive and is the product remaining after palm fruit is mechanically pressed and the palm oil is removed. It has now become the world's fifth largest protein meal commodity and has high feed value.

[0003] Palm oil meal typically contains 12.1%-21.3% crude protein and is high in crude fat, providing protein and energy for livestock and poultry. However, it is also high in non-starch polysaccharides, particularly mannan. On one hand, mannan can induce intestinal inflammation in livestock and poultry, consuming their energy. On the other hand, soluble non-starch polysaccharides can increase intestinal chyme viscosity, reducing the contact between nutrients and endogenous enzymes such as amylase and protease. Furthermore, livestock and poultry cannot secrete enzymes that degrade non-starch polysaccharides, resulting in low utilization of palm oil meal.

[0004] Currently, the utilization rate of palm meal can be improved through raw material pretreatment before it can be added to livestock and poultry feed. Palm meal pretreatment mainly involves fermentation and enzymatic hydrolysis, with mannanase as the primary enzyme, along with cellulase and protease. Enzymatic / fermentation pretreatment of palm meal can reduce the anti-nutritional effects of non-starch polysaccharides such as mannan, increase the content of soluble oligosaccharides and small-molecule proteins, improve the utilization rate of palm meal, increase the proportion of palm meal used in livestock and poultry feed, reduce feed costs, and improve livestock and poultry production performance. Summary of the Invention

[0005] The purpose of this invention is to provide a compound enzyme and its application in the enzymatic hydrolysis of palm meal. The compound enzyme is specifically designed for the nutritional characteristics of palm meal, and can effectively enzymatically hydrolyze non-starch polysaccharide components such as protein, cellulose, and mannan in palm meal, reducing the anti-nutritional effects of non-starch polysaccharides, increasing the content of soluble oligosaccharides and small molecule proteins, and improving the feed value of palm meal.

[0006] One aspect of this invention relates to a complex enzyme comprising protease, cellulase, and mannanase.

[0007] The mannanase mutant is obtained by mutating the 128th amino acid of mannanase with the amino acid sequence SEQ ID NO:2 from Tyr to Asn.

[0008] The components and their weight percentages in the complex enzyme are as follows: 10-15 parts of protease, 10-20 parts of cellulase, and 20-30 parts of mannanase.

[0009] More preferably, the components and their weight proportions in the complex enzyme are as follows: 12 parts protease, 15 parts cellulase, and 20-30 parts mannanase.

[0010] More preferably, the components and their weight proportions in the complex enzyme are as follows: 12 parts protease, 15 parts cellulase, and 22 parts mannanase.

[0011] The present invention also provides the application of the aforementioned compound enzyme in the enzymatic hydrolysis of palm meal.

[0012] The amount of the compound enzyme added is 500-1000 grams per ton of palm meal.

[0013] The present invention also provides the application of the compound enzyme in feed production.

[0014] The compound enzyme provided by this invention, through the rational combination of protease, cellulase, and mannanase, can effectively enzymatically hydrolyze proteins and non-starch polysaccharide components such as cellulose and mannan in palm meal, reducing the anti-nutritional effects of non-starch polysaccharides. Compared with before enzymatic hydrolysis, the reducing sugar content in the enzymatically hydrolyzed palm meal increased by 6.28 mg / g (DM basis), the oligosaccharide content increased by 14.87 mg / g (DM basis), the biomimetic dry matter digestibility improved by 4.65%, the crude protein digestibility improved by 2.27%, and the energy value of the enzyme hydrolysate improved by 371 kcal / kg. Using 5% enzymatically hydrolyzed palm meal in laying hen diets can reduce the feed conversion ratio by 0.04, decrease the deformity rate by 0.17%, increase the laying rate by 1.49%, and increase the average egg weight by 1.17 g. This demonstrates that the compound enzyme preparation provided by this invention can significantly improve the utilization rate of palm meal, enhance its feed value, help increase the proportion of palm meal used in feed formulations, reduce breeding costs, improve production efficiency, and has broad application prospects. Detailed Implementation

[0015] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention: The protease described in this embodiment of the invention can be purchased from Weifang Kangdian Biotechnology Co., Ltd., with an enzyme activity of 50,000 u / g; the cellulase can be purchased from Weifang Kangdian Biotechnology Co., Ltd., with an enzyme activity of 10,000 u / g.

[0016] The present invention will be further illustrated below with reference to the embodiments.

[0017] Example 1 Cloning of the mannanase gene Aspergillus niger ( Aspergillus niger The genome was used as a template for PCR amplification. The PCR primers MAN-F1 and MAN-R1 are as follows: MAN-F1: GCT GAATTC CTCCCCAAAGCTTCACCAGCTCC (The underlined part is the EcoRI restriction enzyme recognition site). MAN-R1: CTG GCGGCCGC TTATCAGGCGGAGTCAATAGCG (The underlined part is the NotI restriction enzyme recognition site).

[0018] The PCR product was recovered via gel extraction, ligated into the pEASY-T vector, and transformed into *E. coli* DH5α. Correct transformants were selected for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 1, and its encoded amino acid sequence was SEQ ID NO: 2. NCBI BLAST alignment revealed that SEQ ID NO: 2 had 100% similarity to the mannanase sequence derived from *Aspergillus niger*, thus confirming that the gene obtained by PCR was the mannanase gene, named MAN.

[0019] Example 2: Screening for high specific activity mannanase mutants To improve the specific activity of mannanase MAN, the applicant screened for a large number of mutations in the enzyme using directed evolution technology.

[0020] Using the MAN gene (SEQ ID NO: 1) as a template, PCR amplification was performed using the primers MAN-F1 and MAN-R1 described in Example 1 with the GeneMorph II random mutagenesis PCR kit. The PCR product was recovered from the gel, digested with EcoRI and Not I, and then ligated into the pET21a vector digested with the same enzymes. The transformed product was then transformed into Escherichia coli BL21(DE3), plated on LB-Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well, and the plates were incubated at 37°C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, and the cells were resuspended in buffer and repeatedly freeze-thawed to break the cell walls, obtaining E. coli cell lysate containing acid mannanase.

[0021] 30 μL of lysis buffer was transferred to two new 96-well plates. 30 μL of substrate was added to one well, and the mixture was incubated at 37°C for 30 min. The reducing sugar content was then determined using the DNS method. 150 μL of Coomassie Brilliant Blue solution was added to the other well, and the mixture was allowed to stand for 10 min. The protein content was then determined using the Coomassie Brilliant Blue (Bradford) binding assay. The enzyme activity and protein content of different mutants were calculated. Ultimately, the applicant screened tens of thousands of transformants to identify the mutation site Y128N, which significantly increased the MAN specific activity of the mannanase mutant.

[0022] Based on wild-type mannanase MAN, this invention provides a mutant containing a single point mutation of Y128N.

[0023] Example 3 Expression of mannanase in Trichoderma reesei First, based on the codon preference of Trichoderma, the gene sequences of mannanase MAN and its mutants were optimized. The optimized gene sequences were synthesized by Shanghai Jierui Biotechnology Co., Ltd., and two restriction enzyme sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequences, respectively.

[0024] 3.1 Construction of expression plasmids The synthesized mannanase gene fragment and the pSC1G vector were digested with restriction endonucleases KpnI and MluI (Fermentas), respectively. The digestion products were purified using a gel purification kit, and the digestion products of the mannanase gene and the pSC1G vector were ligated using T4 DNA ligase (Fermentas) and transformed into E. coli DH5α (Invitrogen). Selection was performed using ampicillin, and the clones were sequenced (Invitrogen) for verification. After successful sequencing, recombinant plasmids containing the mannanase gene were obtained.

[0025] 3.2 Construction of recombinant Trichoderma reesei strains (1) Preparation of protoplasts Take the host fungus Trichoderma reesei ( Trichoderma reesei UE spore suspension was inoculated onto PDA solid plates and cultured at 30℃ for 6 days. After abundant sporulation, colonies of about 1cm×1cm were cut and placed in liquid medium containing 120 mL YEG+U (0.5% yeast powder, 1% glucose, 0.1% uridine) and cultured at 30℃ with shaking at 220 rpm for 14~16 h. Mycelia were collected by filtration through sterile gauze and washed once with sterile water. The mycelia were placed in an Erlenmeyer flask containing 20 mL of 10 mg / mL lysin solution (Sigma L1412) and incubated at 30 °C and 90 rpm for 1-2 h. The progress of protoplast transformation was detected by microscopic observation. Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, shake gently, filter with sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4℃ for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to suspend the bacterial cells, centrifuge at 3000 rpm, 4℃ for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to suspend and dispense.

[0026] (2) Expression plasmid transformation All the following operations were performed on ice. 10 μg of the recombinant plasmid constructed above was added to a 7 mL sterile centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, mixed, and incubated on ice for 20 min. Next, 2 mL of 25% PEG was added, mixed, and incubated at room temperature for 5 min. Then, 4 mL of 1.2 M sorbitol was added, mixed, and poured into the upper culture medium. After gentle mixing, the mixture was spread onto the prepared lower culture medium plate and incubated at 30℃ for 5–7 days until transformants appeared. The transformed transformants were then transferred to the lower culture medium plate for rescreening; strains with smoother colony edges were considered positive transformants.

[0027] Following the above method, the applicant constructed recombinant Trichoderma reesei engineered strains expressing mannanase MAN and its mutants.

[0028] (3) Fermentation verification and enzyme activity assay The engineered Trichoderma reesei strains constructed above were inoculated onto PDA solid plates and incubated upside down in a 30℃ incubator for 6-7 days until spores were abundant. Two 1cm diameter mycelial blocks were then inoculated into 250mL Erlenmeyer flasks containing 50mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The flasks were incubated at 30℃ for 48 hours, followed by incubation at 25℃ for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing mannanase MAN and its mutant, respectively. The enzyme activity and protein content were measured, and the specific activity was calculated.

[0029] 3.3 Mannanase Activity Detection Method (1) Definition of mannanase enzyme activity unit Under conditions of 37°C and pH 5.5, the amount of enzyme required to degrade and release 1 μmol of reducing sugar per minute from a mannan solution with a concentration of 3 mg / ml is defined as one enzyme activity unit (U).

[0030] (2) Enzyme activity assay method (2.1) Plotting the standard curve: Pipette 4.0 ml of acetate-sodium acetate buffer solution, add 5.0 ml of DNS reagent, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, and dilute to 25.0 ml with water to prepare a standard blank sample.

[0031] Pipette 1.00, 2.00, 3.00, 4.00, 5.00, 6.00 and 7.00 ml of mannose solution respectively, and dilute to 100 ml with acetate-sodium acetate buffer solution to prepare D-mannose standard solutions with a concentration of 0.10~0.70 mg / ml.

[0032] Pipette 2.00 ml of each of the above concentration series of mannose standard solutions (make two replicates) into separate graduated test tubes, then add 2 ml of acetate-sodium acetate buffer solution and 5 ml of DNS reagent to each. Incubate with electromagnetic oscillation for 3 seconds, then heat in a boiling water bath for 5 minutes. Cool to room temperature with tap water, then dilute to 25 ml with water. Zero the tube using a standard blank as a control, and measure the absorbance (OD) value at 540 nm.

[0033] A standard curve was plotted with mannose concentration on the Y-axis and absorbance (OD) value on the X-axis. The standard curve needs to be re-plotted each time a new DNS reagent is prepared.

[0034] (2.2) Enzyme activity assay: Take 10.0 ml of mannan solution and equilibrate at 37°C for 10 min.

[0035] Take 10.0 ml of appropriately diluted enzyme solution and equilibrate at 37°C for 10 min.

[0036] Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 37°C) into a graduated test tube, add 5 ml of DNS reagent, and vortex for 3 seconds. Then add 2.0 ml of mannan solution, incubate at 37°C for 30 minutes, and heat in a boiling water bath for 5 minutes. Cool to room temperature with tap water, add water to a final volume of 25 ml, and vortex for 3 seconds. Using a standard blank sample as a blank control, measure the absorbance at 540 nm. A B .

[0037] Pipette 2.0 ml of appropriately diluted enzyme solution (equilibrated at 37°C) into a graduated test tube, then add 2.0 ml of mannan solution (equilibrated at 37°C), vibrate electromagnetically for 3 seconds, and incubate at 37°C for 30 minutes. Add 5.0 ml of DNS reagent, vibrate electromagnetically for 3 seconds to initiate the enzymatic hydrolysis reaction. Heat in a boiling water bath for 5 minutes, cool to room temperature with tap water, and dilute to 25 ml with water, vibrating electromagnetically for 3 seconds. Using a standard blank sample as a blank control, measure the absorbance at 540 nm. A E .

[0038] Enzyme activity calculation formula: X D =[(A E -A B )×K+ C0]×N×1000 / (M×t).

[0039] In the formula: X D To dilute the mannanase activity in the enzyme solution, U / ml; A E The absorbance of the enzyme reaction solution; A B λ is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C0 is the intercept of the standard curve; M is the molar mass of mannose, 180.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme dilution factor; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0040] 3.4 Protein content determination method (1) Measurement method The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it follows Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.

[0041] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 min, and the protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0042] 3.5 Specific vitality calculation "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.

[0043] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0044] The specific calculation results are shown in Table 1.

[0045] Table 1 Comparison of specific activities of mannanase mutants Mannanase MAN and its mutants Specific activity (U / mg) Wild-type MAN 533.75 Y128N single-point mutant 762.25 As shown in Table 1, compared with wild-type mannanase MAN, the specific activity of the acidic mannanase single-point mutant provided by this invention is generally increased by 42.81%, reaching 762.25 U / mg, achieving unexpected technical results.

[0046] The acid mannanase mutant provided by this invention has a significantly higher specific activity than the wild type, which is beneficial for reducing production costs and promoting its widespread application in the fields of livestock, poultry, and marine aquatic feed.

[0047] The applicant named the acidic mannanase mutant containing the Y128N single-point mutation mannanase Man-1. The recombinant Trichoderma reesei engineered strain expressing this mutant was scaled up to produce a solid product of mannanase Man-1 with an enzyme activity level of 3000 u / g.

[0048] Example 4 A composite enzyme and its preparation method A complex enzyme, the components and their contents are as follows: protease 12kg, cellulase 18kg, mannanase Man-1 20kg. This is complex enzyme #1.

[0049] The above-mentioned complex enzyme was obtained by weighing each component of the complex enzyme according to the above proportions and then mixing each component thoroughly.

[0050] Example 5 A composite enzyme and its preparation method A complex enzyme, the components and their contents are as follows: protease 15kg, cellulase 20kg, mannanase Man-1 30kg. This is complex enzyme #2.

[0051] The preparation method is the same as in Example 4.

[0052] Example 6 A composite enzyme and its preparation method A complex enzyme, the components and their contents are as follows: protease 12kg, cellulase 15kg, mannanase Man-1 22kg. This is complex enzyme #3.

[0053] The preparation method is the same as in Example 4.

[0054] Example 7: Evaluation of the application effect of the compound enzyme This embodiment uses an in vitro enzymatic hydrolysis method to evaluate the enzymatic hydrolysis effect of the compound enzyme on palm meal.

[0055] 1. Materials and Methods 1.1 Test Samples The test samples were selected from the No. 1 compound enzyme, No. 2 compound enzyme and No. 3 compound enzyme described in Examples 4-6.

[0056] Palm meal was selected as the feed ingredient. 1.2 Test Methods The experiment was set up with 4 treatment groups, each with 5 replicates: blank control group, treatment group 1 (added with 1 kg / t 1# compound enzyme), treatment group 2 (added with 1 kg / t 2# compound enzyme), and treatment group 3 (added with 1 kg / t 3# compound enzyme).

[0057] For each replicate, weigh 30g of soybean meal that has passed through a 1.5mm sieve into a 250ml Erlenmeyer flask, add 120ml of pH 5.0 phosphate buffer, and add enzymes #1, #2, and #3 to each treatment group at a dosage of 1kg / t. The blank control group received no enzyme. Place the flasks in a water bath at 50℃ and 120r / min for 16 hours for enzymatic hydrolysis. After hydrolysis, place the Erlenmeyer flasks in a boiling water bath for 3 minutes to inactivate the enzymes. Then, transfer the entire hydrolysate to a large petri dish and dry it overnight in a 60℃ oven for later use.

[0058] 1.3 Measurement Indicators The reducing sugar and oligosaccharide content, as well as the digestibility of pig biomimetic dry matter, crude protein digestibility, and enzyme hydrolysate energy value of palm meal in each treatment group were determined (refer to the operating procedures of the monogastric animal biomimetic digester).

[0059] 1.4 Data Processing and Analysis Experimental data were analyzed using ANOVA in SPSS 19.0 statistical software. All indicators were analyzed on a replicate-by-replication basis, and LSD multiple comparisons were used for testing. Results are expressed as mean and standard deviation; P < 0.05 was considered statistically significant.

[0060] 2. Results and Analysis Table 2. Reducing sugar and oligosaccharide content in palm meal Group Total reducing sugars per gram of palm meal (mg, DM basis) Oligosaccharide content per gram of palm meal (DM basis) control group <![CDATA[71.24 c ±0.23]]> <![CDATA[45.18 c ±0.76]]> Experimental group 1 <![CDATA[73.76 b ±0.49]]> <![CDATA[55.95 b ±0.28]]> Experimental group 2 <![CDATA[75.98 ab ±0.47]]> <![CDATA[58.51 ab ±0.20]]> Experimental group 3 <![CDATA[77.52 a ±0.30]]> <![CDATA[60.05 a ±0.17]]> Note: Numbers in the table with the same superscript letter indicate no significant difference (P>0.05), while numbers with different superscript letters indicate significant difference (P<0.05).

[0061] As shown in Table 2, compared with the control group, the addition of compound enzymes 1-3 for enzymatic pretreatment of palm meal increased the reducing sugar content by 2.52 mg / g, 4.74 mg / g, and 6.28 mg / g, respectively; and the oligosaccharide content by 10.77 mg / g, 13.33 mg / g, and 14.87 mg / g, respectively. This indicates that the compound enzymes provided by this invention can significantly increase the content of small-molecule carbohydrates in palm meal after enzymatic pretreatment. Among them, compound enzyme 3 showed the best effect.

[0062] Table 3. Digestibility of palm meal dry matter, crude protein digestibility, and energy value of enzymatic hydrolysate for pigs Note: Numbers in the table with the same superscript letter indicate no significant difference (P>0.05), while numbers with different superscript letters indicate significant difference (P<0.05).

[0063] As shown in Table 3, compared with the control group, the addition of compound enzymes 1-3 for enzymatic pretreatment of palm meal increased the dry matter digestibility by 2.26%, 3.88%, and 4.65%, respectively; the crude protein digestibility improved by 1.39%, 1.73%, and 2.27%, respectively; and the energy value of the enzyme hydrolysate improved by 210 kcal / kg, 282 kcal / kg, and 371 kcal / kg, respectively. This demonstrates that the compound enzymes provided in this invention can significantly improve the utilization rate of palm meal after enzymatic pretreatment. Among them, compound enzyme 3 showed the best effect.

[0064] Example 8 Evaluation of the effects of animal feeding experiments This embodiment evaluates the application effect of the compound enzyme described in this invention through an egg-laying hen breeding experiment.

[0065] 1. Materials and Methods 1.1 Test Samples The test sample was palm meal pretreated with the No. 3 compound enzyme as described in Example 6.

[0066] 1.2 Experimental Grouping This experiment used 400 healthy laying hens with similar body weight and feed intake. A completely randomized design was used, with participants divided into two treatment groups, each with five replicates and 40 animals per replicate. The control group was fed a corn-soybean meal basal diet, while the experimental groups were fed diets supplemented with 5% enzymatically hydrolyzed palm meal instead of soybean meal and other feed ingredients. The pre-feeding period was 7 days, and the formal experimental period was 56 days.

[0067] The specific grouping design is shown in Table 4.

[0068] Table 4 Experimental group design Group Type of food control group Corn-soybean meal diets experimental group Use 5% enzymatically hydrolyzed palm meal to replace the diet. 1.3 Measurement Indicators During the experiment, the egg production rate and egg weight were recorded daily. Feed was collected every 14 days, and the amount of feed consumed was recorded. After statistical analysis, the feed conversion ratio, average egg weight, etc. were calculated.

[0069] 1.4 Data Processing and Analysis Experimental data were analyzed using ANOVA in SPSS 19.0 statistical software. All indicators were analyzed on a replicate-by-replication basis, and LSD multiple comparisons were used for testing. Results are expressed as mean and standard deviation; P < 0.05 was considered statistically significant.

[0070] Results and Analysis Experimental results: Table 5 Egg production performance of laying hens As shown in Table 5, replacing soybean meal with 5% enzymatically hydrolyzed palm meal in the daily diet of laying hens can significantly improve the egg production performance of laying hens, reduce the feed conversion ratio by 0.04, reduce the rate of deformed eggs by 0.17%, increase the laying rate by 1.49%, and increase the average egg weight by 1.17g.

[0071] In summary, the composite enzyme provided by this invention, through the rational combination of protease, cellulase, and mannanase, effectively increases the content of reducing sugars and oligosaccharides and other small-molecule carbohydrates in palm meal through enzymatic pretreatment. This improves the digestibility of dry matter, crude protein, and the energy value of enzyme hydrolysates in palm meal. By enhancing the digestibility of nutrients in palm meal and degrading non-starch polysaccharide components in cell walls, the potential nutritional value of palm meal is increased, improving the egg production performance of laying hens and enabling enterprises to reduce costs and increase efficiency.

Claims

1. A complex enzyme, characterized by, The complex enzyme comprises a protease, a cellulase and a mannanase.

2. The complex enzyme according to claim 1, wherein The mannanase is obtained by mutating the 128th amino acid of the mannanase with amino acid sequence of SEQ ID NO: 2 from Tyr to Asn.

3. The complex enzyme according to claim 2, wherein The complex enzyme comprises the following components and their weight fractions: 10-15 parts of protease, 10-20 parts of cellulase and 20-30 parts of mannanase.

4. The complex enzyme according to claim 3, wherein The complex enzyme comprises the following components and their weight fractions: 12 parts of protease, 15 parts of cellulase and 20-30 parts of mannanase.

5. The complex enzyme according to claim 4, wherein The complex enzyme comprises the following components and their weight fractions: 12 parts of protease, 15 parts of cellulase and 22 parts of mannanase.

6. Use of the complex enzyme according to any one of claims 1-5 in enzymatic hydrolysis of palm kernel meal.

7. Use according to claim 6, wherein The complex enzyme is added in an amount of 500-1000 g / t of palm kernel meal.

8. Use of the complex enzyme according to any one of claims 1-5 in feed production.