Rice fork head related structural domain protein coding gene OsFHA11 and application thereof
By cloning and expressing the OsFHA11 gene, the problem of insufficient resistance to rice sheath blight was solved, enabling the breeding of disease-resistant varieties through genetic engineering and improving the disease resistance and yield of rice.
Patent Information
- Application Number
- CN202511882826.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-01-16
AI Technical Summary
The lack of effective gene resources for resistance to rice sheath blight in existing technologies has led to environmental impacts and pathogen resistance problems caused by chemical control, and the unclear analysis of resistance genes and QTLs has slowed down the progress of breeding for resistance to sheath blight.
By cloning and expressing the rice fork-related domain protein-coding gene OsFHA11, its expression level in rice was increased. Genetic engineering was used to breed rice varieties resistant to rice sheath blight. Combined with observation of protein migration and localization using fluorescent protein genes, the molecular mechanism of resistance to rice sheath blight was elucidated.
It significantly improved the resistance of rice to sheath blight, clarified the role and regulatory pattern of the gene in cells, enabled the breeding of stable resistant varieties, effectively controlled the occurrence of sheath blight, and increased rice yield.
Smart Images

Figure CN121344006A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant genetic engineering, and in particular to a rice forkhead associated domain protein encoding gene OsFHA11 and application thereof. BACKGROUND
[0002] Rice is the main food for nearly half of the world's population, and is an important economic crop in China. Rice sheath blight is a soil-borne fungal disease caused by Rhizoctonia solani (Kuhn), which is one of the three major diseases of rice along with rice blast and bacterial leaf blight, and has become a major limiting factor for high-yield rice production. In recent years, with climate change, the promotion of high-yield, thick-stalk, multiple-spike, and large-ear type germplasm, increased planting density, and excessive use of nitrogen fertilizer, the environment in the field has become more conducive to the infection of the host by the sheath blight fungus. Rhizoctonia solani
[0003] At present, there is still no systematic method for the prevention and control of sheath blight due to the lack of sheath blight-resistant rice germplasm resources, the wide host range of the pathogen, the strong stress resistance of the pathogen, and genetic variation. In agricultural production, chemical pesticides are mainly used to prevent and control rice sheath blight, but this has led to environmental problems and the development of pathogen resistance. In most global rice-growing regions, more than 90% of rice varieties show varying degrees of susceptibility. Although there have been reports on QTLs and genes related to resistance to rice sheath blight, the occurrence and prevalence of field sheath blight are influenced by multiple factors such as rice growth, canopy density, and field agronomic practices, and there is no uniformity in aspects such as inoculation methods, disease investigation, and grading standards for sheath blight resistance identification, which has led to a lack of understanding of the major genes and QTLs that regulate sheath blight resistance, and slow progress in sheath blight-resistant breeding. Therefore, research on genes related to rice sheath blight resistance not only has great theoretical significance, but also can promote the exploration and genetic improvement of rice sheath blight-resistant germplasm resources, ultimately achieving effective prevention and control of sheath blight and increasing agricultural production and income. SUMMARY
[0004] In order to solve the above-mentioned deficiencies in the prior art, the purpose of the present application is to provide a rice forkhead associated domain protein encoding gene OsFHA11 and application thereof, in order to improve the sheath blight resistance of plants.
[0005] The technical solution of the present application to solve the above technical problems is as follows: a rice forkhead associated domain protein encoding gene OsFHA11 is provided, and the nucleotide sequence of the gene is shown in SEQ ID NO. 1.
[0006] Further, the amino acid sequence of the encoded protein of the rice forkhead associated domain protein encoding gene OsFHA11 is shown in SEQ ID NO. 2.
[0007] This invention provides an application of the above-mentioned rice fork-related domain protein-coding gene OsFHA11 in improving rice sheath blight resistance.
[0008] This invention provides a method for improving rice sheath blight resistance by increasing the expression level of the OsFHA11 gene in rice.
[0009] This invention provides an application of the above-mentioned rice fork-related domain protein-coding gene OsFHA11 in the breeding of rice varieties resistant to sheath blight.
[0010] This invention provides a method for preparing rice resistant to sheath blight, which obtains rice resistant to sheath blight by expressing the OsFHA11 gene in rice.
[0011] The present invention has the following beneficial effects: (1) In this invention, the OsFHA11 gene is linked to an overexpression vector by genetic engineering and then transformed into rice to increase the expression of the gene in the transformed rice plants, which can improve the resistance of the rice plants to sheath blight.
[0012] (2) The OsFHA11 gene of the present invention is used to analyze the mechanism of rice resistance to sheath blight. For example, the gene sequence is linked to any transformation vector containing a fluorescent protein gene, and the gene and the fluorescent protein gene are covalently introduced into rice or other plant cells using any transformation method. The migration and localization of OsFHA11 fused with the fluorescent protein in rice or other plant cells can be observed using fluorescence confocal transmission electron microscopy, thus clarifying the site of action of the gene in the cell. The protein encoded by this OsFHA11 gene can also be used as a bait protein to catch the protein that interacts with this protein in rice or other plants, thus clarifying the regulatory mode of the gene in the process of resistance to sheath blight.
[0013] (3) This invention, through the cloning of the OsFHA11 gene and its functional analysis of resistance to sheath blight, helps to elucidate the molecular mechanism of rice resistance to sheath blight. In practice, this gene can be used to cultivate rice materials resistant to sheath blight through transgenic means, and further, through intervarietal hybridization, rice varieties with stable traits resistant to sheath blight can be obtained, effectively controlling the occurrence of sheath blight and increasing rice yield. Attached Figure Description
[0014] Figure 1 A diagram showing the expression pattern of the OsFHA11 gene at different time points of infection with Sheath blight in resistant and susceptible rice varieties; Figure 2 Map of the OsFHA11 gene overexpression vector pEXT06 / g-OsFHA11; Figure 3 Gene expression level detection of OsFHA11 gene overexpression plants and phenotypic diagram of plants 72 h after inoculation with Rhizoctonia solani. Figure 4 Map of the OsFHA11 gene editing vector BGK03-OsFHA11-SG; Figure 5 The expression level of the OsFHA11 gene knockout plant and the phenotype after 72 hours of inoculation with Rhizoctonia solani. Detailed Implementation
[0015] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0016] Example 1: Cloning and sequence analysis of the rice OsFHA11 gene cDNA The OsFHA11 gene was identified as interacting with the rice sheath blight molecule RsIA_SSP6 through yeast two-hybrid screening. This gene was cloned from cDNA samples of the resistant rice variety TQ after inoculation with *Rhizoctonia solani*. Sequence alignment analysis revealed two single nucleotide polymorphisms (SNPs) in the coding region of the OsFHA11 gene between the resistant TQ and susceptible Nipponbare (NPB) varieties: 540bp:CT and 635bp:GA. The 635bp:GA mutation was a non-synonymous mutation, resulting in a change of the amino acid from asparagine (Asn) to glutamic acid (Glu). Seeds of the TQ variety were germinated at 37°C for one day and then sown in a greenhouse. After one month of cultivation, the second-to-last leaves were inoculated with *Rhizoctonia solani*. RNA was extracted from rice leaves at 12h, 24h, and 48h post-inoculation. The extraction method used is the Trizol method, and the specific operation steps are as follows: ① Take 100mg of fresh rice leaves, put them into a pre-prepared mortar (soaked in DEPC water for 24 hours and sterilized at high temperature), add an appropriate amount of liquid nitrogen and freeze grind them into powder; ② Transfer the ground powder into a pre-prepared 1.5mL enzyme-free EP tube, and immediately add 1mL of Trizol reagent. Note that the total sample volume should not exceed 10% of the Trizol volume. ③ After placing the EP tube in an ice bath for 15 minutes, add 400 μL of chloroform, vortex for 1 minute, and then place in an ice bath for 15 minutes. ④ Centrifuge at 12000 r / min for 15 min at 4℃, and carefully aspirate 450 μL of the supernatant into an enzyme-free 1.5 mL EP tube; ⑤ Add 500 μL of isopropanol, mix well, and freeze at -20°C for at least 30 minutes to precipitate. ⑥ After the freeze-precipitation is complete, centrifuge at 13000 r / min for 20 min at 4℃. The precipitate is RNA. ⑦ After centrifugation, discard the supernatant, being careful not to discard the RNA. Add 1 mL of 75% ethanol (a mixture of 750 μL anhydrous ethanol and 250 μL DEPC water), and wash the precipitate 2-3 times at room temperature, 5 min each time. After each wash, centrifuge at 7500 rpm for 5 min at 4°C. ⑧ After washing, centrifuge at high speed for a short time, and use a small pipette tip to remove excess alcohol; ⑨ Air dry naturally to allow the alcohol to evaporate. Add an appropriate amount of DEPC water according to the experimental requirements and store in a -80℃ refrigerator for later use.
[0017] The obtained RNA was reverse transcribed into cDNA. The reverse transcription was performed using the Vazyme HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper). The specific operating steps are as follows, according to the product instructions: ① Take 1 μg of RNA, add 1 μL of Oligo(dT)23VN (50 μM) and an appropriate amount of RNase-free ddH2O, with a total volume of 12 μL, heat at 65℃ for 5 min, quickly place on ice to cool, and let stand on ice for 2 min; ②Add 4μL of 4×gDNA wiper Mix to the mixture in step ①, gently mix with a pipette, and incubate at 42℃ for 2min; ③ Add 2μL of 10 × RT Mix and 2μL of HiScript II Enzyme Mix to the mixture from the previous step, and gently mix with a pipette; ④ Then start synthesizing the first-strand cDNA. The program is: 50℃ for 45 min, 85℃ for 5 min, store at -20℃ and use within 6 months. For long-term storage, it is recommended to aliquot and store at -70℃. Avoid repeated freeze-thaw cycles for cDNA.
[0018] Download the reference gene sequence of OsFHA11 from the RIGW website, and design gene primers with EcoRI and BamHI restriction sites using CE Design. The sequences are as follows: OsFHA11_F: 5'-gccatggaggccagtgaattcATGGAAGCAGCAGTGGCTACTC-3' (SEQ ID NO. 3); OsFHA11_R: 5'-cagctcgagctcgatggatccCTAATTGGTTTGTTGAGTTGCCG-3' (SEQ ID NO. 4).
[0019] The CDS sequence of OsFHA11 was amplified using the obtained cDNA as a template, and Phanta Max Super-Fidelity DNA Polymerase was employed. The specific reaction system is as follows: 25 μL 2×Phanta Max Buffer, 1 μL dNTP Mix (10 mM each), 2 μL each of upstream primer (10 μM) and downstream primer (10 μM), and 1 μL Phanta Max Super Add Fidelity DNA Polymerase, 2 μL template cDNA, and double-distilled water to a total volume of 50 μL.
[0020] The reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min, repeated 35 times; 72℃ extension for 10 min. After the reaction, the obtained gene was sent to Qingke Xinyue Biotechnology Co., Ltd. (Chengdu) for sequencing. The nucleotide sequence of the OsFHA11 gene obtained by sequencing is shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO.2.
[0021] Example 2: Analysis of the induced expression of the OsFHA11 gene in resistant and susceptible rice materials RNA was extracted from leaves of *Teqing* and *Nipponbare* rice plants at 12, 24, and 48 hours after infection, respectively, to analyze the expression level of the OsFHA11 gene in the two rice materials. The RNA extraction and reverse transcription methods for both rice materials were the same as in Example 1. The expression level of the OsFHA11 gene was analyzed using quantitative real-time PCR. Primers for quantitative real-time PCR were designed based on the cloned OsFHA11 gene sequence, as follows: OsFHA11_qt_F: 5'-GGTTCCTGAACAGGCTGACA-3' (SEQ ID NO.5) OsFHA11_qt_R: 5'-CACTGGACACATCGACGATCA-3' (SEQ ID NO.6) The reaction system was 10 μL: 5 μL (2×AceQ qPCR SYBR Green Master Mix Primer 1 (10 μM), 0.2 μL OsFHA11_qt_F (10 μM), 0.2 μL OsFHA11_qt_R (10 μM), 0.2 μL 50×ROX Reference Dye 1, 0.2 μL Template cDNA), and double-distilled water was added to make up to 10 μL.
[0022] Using the rice OsActin gene as an internal reference gene, the primer sequences are as follows: OsActin-F: 5'-CAGCCACACTGTCCCCATCTA-3' (SEQ ID NO. 7); OsActin-R: 5'-AGCAAGGTCGAGACGAAGGA-3' (SEQ ID NO. 8).
[0023] Using CFX Connect Real from US-based Bole Corporation The real-time PCR reaction was performed using a Time PCR System. The reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s; 60℃ extension for 1 min; 40 cycles.
[0024] Depend on Figure 1 It was found that the expression level of the OsFHA11 gene in the resistant rice Teqing was significantly higher 12 hours after infection with the pathogen than in the uninfected sample (0h represents the uninfected sample), while in the susceptible rice Nipponbare, the expression level did not change significantly after 12 hours of infection compared to the uninfected sample. This indicates that the gene can be upregulated in response to pathogen infection in resistant materials, but is not sensitive to pathogen infection in susceptible materials. Therefore, it is speculated that OsFHA11 may have a certain function in Teqing's resistance to sheath blight. However, the expression level of OsFHA11 after 12 hours of pathogen infection followed by a decrease at 24 and 48 hours compared to the uninfected sample indicates that OsFHA11 is an early response factor induced by pathogen in resistant Teqing rice and participates in the regulation of rice immune response.
[0025] Example 3: Obtaining transgenic rice with OsFHA11 gene overexpression To further identify the function of the OsFHA11 gene in rice sheath blight resistance, the sequence fragment obtained in Example 1 (with the stop codon TAG removed) was cloned into the plant expression vector pEXT06-g (g:gfp) to construct an overexpression vector containing the OsFHA11 gene, and green fluorescent protein was fused to the OsFHA11 gene. The constructed pEXT06 / g-OsFHA11 gene overexpression vector (vector map shown) was then used. Figure 2 Agrobacterium EHA105 was transformed using liquid nitrogen and then transformed into the susceptible rice variety Nipponbare to obtain the overexpression line OsFHA11-OE. The specific operation was completed by Baige Biotechnology Co., Ltd.
[0026] Depend on Figure 3 It can be seen that the expression level of the OsFHA11 gene in the overexpression transformed plants is significantly higher than that in the wild type. Furthermore, after inoculation with rice sheath blight pathogen, the resistance of OsFHA11-OE plants is significantly increased compared with that of the wild type, and the expression levels of resistance-related genes such as OsPR1b, OsPR10a, and OsNPR1 are also significantly higher than those in the wild type. This indicates that OsFHA11 does indeed have the function of enhancing rice resistance to rice sheath blight pathogen.
[0027] Example 4: Obtaining OsFHA11 gene-edited (CRISPR) transgenic rice To further verify the function of the OsFHA11 gene in rice sheath blight resistance, this invention constructed the gene editing vector BGK03-OsFHA11-SG for the OsFHA11 gene (vector map shown). Figure 4 The target sequence and primer sequences used were transformed into the rice variety Teqing, which is resistant to rice sheath blight. The specific operations were completed by Baige Biotechnology Co., Ltd. Specific target sequences were designed based on the OsFHA11 gene CDS sequence, as follows: Target: 5'-TCTTCTCTAGCCCAACCCCCAGG-3' (SEQ ID NO.9); SG sequence: 5'-GCTTCTCTAGCCCAACCCCC-3' (SEQ ID NO.10); Gene editing identification primers: GP5319-2F: 5'-GAAATCAAGAAGCGAACAAA-3' (SEQ ID NO. 11); GP5319-2R: 5'-AACAATCAGGTGGACAACAATA-3' (SEQ ID NO. 12).
[0028] To detect the effect of gene editing, a series of sequences near the target were detected using specific primers GP5319-2F / R. The procedure was as follows: Genomic DNA was extracted from gene-edited plants. The target region sequence was amplified from the gene-edited plant DNA using primers GP5319-2F / R and sequenced. Sequencing comparison yielded three types of gene-edited plants, denoted as OsFHA11-CR#1, 2, and 3, respectively. In OsFHA11-CR#1 and 2 transgenic plants, the OsFHA11 sequence had deletions of 1 base and 26 bases, respectively, causing premature termination of the encoded protein sequence. The OsFHA11-CR#3 sequence contained a synonymous SNP mutation, which did not affect the protein sequence encoded by OsFHA11. Phenotypic identification after inoculation with rice sheath blight showed that the resistance of gene-edited plants OsFHA11-CR#1 and 2 was significantly lower than that of wild-type Teqing, while the resistance of OsFHA11-CR#3 showed no significant change. Figure 5 ).
[0029] All the above results demonstrate that the OsFHA11 gene of the present invention has the effect of improving the resistance of rice to sheath blight.
[0030] The nucleotide sequence and amino acid sequence of OsFHA11 in this invention are shown below: (1) Nucleotide sequence ATGGAAGCAGCAGTGGCTACTCCTTCCTTGCTCTTCTCTAGCCCAACCCCCAGGAGGCCTTCCTCCTGCTTGCCTCCTCCTCCTCCTTGCAGCAGCAGCAGCAGCAGCTACGCCTCCCATGGTTTCAAGCTGCTGCAGCCGCAGTTGCTGTTCATCAATCGGCTAACCAGCAGAAACAGCAACGGGAGTAGCAGAAGAAGCATTTCCATTTTGTCGCTGAGGTGCTCTTCCAGTGGCACTGACAGCGCGTCTTCTTCCGCCACTTCAGAAAGATGGGTTCTCGAGCCTGCAGGAGACGGCGATTGGCGTCATATCGGGTACCGCGTCGCACGACCCGGCGGCTTCCAGATAGCATCCGAGGCGGCGGTGACGGTGGGTCGGGTTCCTGAACAGGCTGACATCGTCCTGTCTGTCGCAACAGTTTCTGGGACGCACGCACGGCTGGAGAAGAAAGAGGGGAGCTTGTTGGTAACAGACCTGGAGAGCACGAATGGCACCTACATCAACGAGAGGCGCCTCACCCCGGGTTTCCCCACTCCCATCGATCCCGGCAGCCTCCTCATCTTTGGTGACATCCACCTGGCCATGTTCCGTGTCTCCAAGATGATCGTCGATGTGTCCAGTGACACCAATGGAGCTGAGCAGGAAGCTGAGACGGCTCAAGTATCAGCGGCAACTCAACAAACCAATTAG(SEQ ID NO.1); (2) Amino acid sequence MEAAVATPSLLFSSPTPRRPSSCLPPPPPCSSSSSSYASHGFKLLQPQLLFINRLTSRNSNGSSRRSISILSLRCSSSGTDSASSSATSERWVLEPAGDGDWRHIGYRVARPGGFQIASEAAVTVGRVPEQADIVLSVATVSGTHARLEKKEGSLLVTDLESTNGTYINERRLTPGFPTPIDPGSLLIFGDIHLAMFRVSKMIVDVSSDTNGAEQEAETAQVSAATQQTN(SEQ ID NO.2)。
[0031] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A rice fork-associated domain protein-coding gene OsFHA11, characterized in that, The nucleotide sequence of the rice fork head associated domain protein encoding gene OsFHA11 is shown as SEQ ID NO.
1.
2. The rice forkhead associated domain protein encoding gene OsFHA11 according to claim 1, characterized in that, The amino acid sequence of the encoded protein of the rice fork head associated domain protein encoding gene OsFHA11 is shown as SEQ ID NO.
2.
3. The rice fork head associated domain protein encoding gene OsFHA11 of claim 1 or 2 for use in improving the resistance of rice to sheath blight.
4. A method for improving resistance to sheath blight in rice, comprising, The resistance of rice to sheath blight is improved by expressing the expression amount of the OsFHA11 gene in rice; wherein the nucleotide sequence of the OsFHA11 gene is shown as SEQ ID NO.
1.
5. The rice fork head associated domain protein encoding gene OsFHA11 of claim 1 or 2 for use in breeding rice varieties resistant to sheath blight.
6. A method for preparing a rice plant resistant to sheath blight, characterized by, The rice resistant to sheath blight is obtained by expressing the expression amount of the OsFHA11 gene in rice; wherein the nucleotide sequence of the OsFHA11 gene is shown as SEQ ID NO. 1.