DsOMT018 gene of dactylicapnos root O-methyltransferase and application of DsOMT018 gene
By isolating and identifying the DsOMT018 gene of *Zijinlong* O-methyltransferase, a transgenic engineered bacterium was constructed to catalyze the production of isocorynidine and corydin, thus solving the problem of low isocorynidine content in *Zijinlong* and realizing an efficient and economical preparation method.
Patent Information
- Application Number
- CN202511839930.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-08
- Publication Date
- 2026-01-16
AI Technical Summary
Existing technologies make it difficult to effectively synthesize isocotinine, the main active ingredient in Zijinlong, and its content in Zijinlong is low, making it difficult to cultivate and sustainably develop medicinal resources.
The DsOMT018 gene of Corydalis O-methyltransferase was isolated and identified. A transgenic engineered bacterium was constructed by combining a recombinant plasmid with Escherichia coli BL21(DE3). This gene was used to catalyze the production of isocorydaline and corydaline from Corydalis tuber alkaloid and methyl donor SAM.
This improved the catalytic efficiency of isocyanidin, broadened the applicable range of substrates, and reduced experimental costs, making the preparation of isocyanidin more economical and suitable for applications in more laboratories.
Smart Images

Figure CN121344016A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a Dactylicapnos scandens O-methyltransferase DsOMT018 gene and application thereof. BACKGROUND
[0002] Dactylicapnos scandens (D.Don) Hutch. is an annual or perennial herbaceous vine of the Papaveraceae family, and its roots are used as medicine. There are four species of Dactylicapnos in Southwest China, namely D. scandens, D. scandens var. latifolius, D. scandens var. tortus and D. scandens var. lichiangensis. D. scandens is a folk medicine of the Bai nationality with significant analgesic effect, and is widely used in clinical practice. The main medicinal active ingredients of D. scandens are mainly isoquinoline alkaloids, and many bioactive components such as (+) -isocorydine, dehydrocorydaline, corytuberine, (+) -corydine and protopine have been isolated and identified from D. scandens. Among them, isocorydine has been included in medicine as an antispasmodic analgesic drug (Approval No.: GMPZCZ H53021713) approved by the State Drug Administration.
[0003] However, the content of isocorydine in D. scandens is only about 2.5%, and its growth cycle is long, it is difficult to be planted on a large scale, and it is greatly affected by the environment, which is not conducive to the sustainable development of medicinal resources. In this regard, synthetic biology is an effective strategy to solve the above problems, and the premise of biosynthesis is to clarify the key synthesis genes of the main active ingredients in medicinal plants. At present, the key synthesis genes of many important medicinal ingredients have been clarified and heterologous synthesis has been achieved in microorganisms, such as paclitaxel, ginsenosides and artemisinin. Therefore, it is crucial to clarify the biosynthesis pathway of isocorydine in D. scandens using synthetic biology technology. At present, there is no related report on the biosynthesis of isocorydine. Therefore, how to overcome the shortcomings of the prior art is a problem that needs to be solved in the field of biotechnology at present. SUMMARY
[0004] The purpose of the present application is to solve the problems of the prior art, and to provide a Dactylicapnos scandens O-methyltransferase DsOMT018 gene and application thereof.
[0005] To achieve the above-mentioned purpose, the technical solutions adopted by the present application are as follows: The present application provides a Dactylicapnos scandens O-methyltransferase DsOMT018 gene in the first aspect. The nucleotide sequence of the Dactylicapnos scandens O-methyltransferase DsOMT018 gene is shown in SEQ ID NO. 1.
[0006] The second aspect of the present application provides a protein encoded by the O-methyltransferase DsOMT018 gene of Liriodendron chinense, characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 2.
[0007] The third aspect of the present application provides a recombinant plasmid of the O-methyltransferase DsOMT018 gene of Liriodendron chinense.
[0008] Further, the O-methyltransferase DsOMT018 gene of Liriodendron chinense is homologously recombined with the pET28a vector to obtain a pET28a-DsOMT018 recombinant plasmid.
[0009] The fourth aspect of the present application provides a genetically engineered bacterium containing the recombinant plasmid or having the exogenous O-methyltransferase DsOMT018 gene of Liriodendron chinense integrated into the genome of the genetically engineered bacterium.
[0010] Further, the genetically engineered bacterium is Escherichia coli BL21 (DE3).
[0011] The fifth aspect of the present application provides an application of the O-methyltransferase DsOMT018 gene of Liriodendron chinense in the preparation of isostrychnidine and stychnidine.
[0012] Further, isostrychnidine and stychnidine are generated from Corydalis tuber base and a methyl donor SAM under the catalysis of the O-methyltransferase DsOMT018 gene of Liriodendron chinense.
[0013] The sixth aspect of the present application provides a preparation method of isostrychnidine and stychnidine, which generates isostrychnidine and stychnidine from Corydalis tuber base and a methyl donor SAM under the catalysis of the O-methyltransferase DsOMT018 gene of Liriodendron chinense.
[0014] The present application provides an O-methyltransferase DsOMT018 gene of Liriodendron chinense, which can be used as a biosynthesis regulation gene of isostrychnidine and stychnidine and applied in the preparation of isostrychnidine and stychnidine. The nucleotide sequence of the O-methyltransferase DsOMT018 gene of Liriodendron chinense is shown as SEQ ID NO. 1, and the full-length sequence is 1050 bp. The protein encoded by the O-methyltransferase DsOMT018 gene of Liriodendron chinense has a sequence shown as SEQ ID NO. 2, and encodes 350 amino acid residues.
[0015] The Zijinlong O-methyltransferase DsOMT018 gene is identified from fresh roots, stems and leaves of Zijinlong through transcriptome sequencing and bioinformatics technology after a large number of experiments; the RNA of the roots, stems and leaves of Zijinlong is extracted by using an RNA reagent, and then the cDNA is reversely converted and subjected to PCR amplification to obtain the Zijinlong O-methyltransferase DsOMT018 gene. DsOMT018-5'F: cagcaaatgggtcgcggatccatggaagtgaagaatagtgctgatc DsOMT018-3'R: cgacggagctcgaattcggatccttaataagtataagcctcgataacag Finally, the pET-28a-DsOMT018 recombinant vector is transformed into the E.coli BL21 (DE3) competent cell, and a detection primer is used to detect whether the vector is successfully transformed, and the detection primer is as follows: JC-5'F: ccgcgaaattaatacgactcactatagg JC-3'R: ccgtttagaggccccaagg Compared with the prior art, the present application has the following beneficial effects: The Zijinlong O-methyltransferase DsOMT018 gene isolated and identified from Zijinlong can be used as an important marker gene for molecular assisted breeding of Zijinlong, and can also be used as an important candidate gene for production of isoepicoravanine and epicatechin in a yeast chassis cell. Compared with the prior art, the catalytic efficiency of DsOMT018 is improved, and the substrate spectrum is significantly widened. Through optimization of the experimental process, more economical reagents and consumables are used, the cost is reduced, the gene isolation and identification are more cost-effective, and the application is conducive to popularization and application in more laboratories. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 LC-MS analysis of the enzyme activity reaction of DsOMT018; wherein A is the mass spectrum of the standard product isoepicoravanine; B is the mass spectrum of the standard product epicatechin; C is the mass spectrum of isoepicoravanine generated by the enzyme activity reaction of DsOMT018; D is the mass spectrum of epicatechin generated by the enzyme activity reaction of DsOMT018; Figure 2 HPLC analysis results of the enzyme activity reaction of DsOMT018; wherein 1 is epicatechin, 2 is isoepicoravanine; 3 is epicatechin; CK is a control group, DsOMT011 is an experimental group, and two standards from bottom to top are standard epicatechin and standard isoepicoravanine; Figure 3 Biosynthetic pathway of isocorydine and corydine based on the function of DsOMT018; Figure 4 Schematic diagram for construction of recombinant plasmid pET28a-DsOMT018; Figure 5 SDS-PAGE protein electrophoresis detection diagram of DsOMT018 of Sinopodophyllum hexandrum O-methyltransferase, M lane is protein Marker electrophoresis band, lane 1 and 2 are DsOMT018 protein electrophoresis bands eluted at a concentration of 200 mM imidazole. DETAILED DESCRIPTION
[0017] The application will be further described in conjunction with the following examples.
[0018] Those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. If no specific technique or condition is specified in the examples, the technique or condition described in the literature in the art or according to the product manual is used. If no manufacturer of the material or equipment is specified, it is a conventional product that can be obtained by purchase.
[0019] Example 1 Through local BLAST search of the transcriptome data and its KEGG protein database annotation results, candidate genes related to the isocorydine synthesis pathway were obtained, and FPKM values were found from the transcriptome data. The FPKM values were used to analyze the differential expression of these genes, and the differential gene expression was used to make a heat map using TBtool. The expression amounts of the related genes in the roots, stems and leaves of Sinopodophyllum hexandrum were compared, and the function of the candidate gene OMT018 was identified. The open reading frame (ORF) and amino acid sequence of DsOMT018 were identified using the online tool ORF Finder (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html). The amino acid sequences of OMT genes from other species can be downloaded from existing databases and aligned with the candidate gene OMT018 by ClustalW. A phylogenetic tree was constructed by MEGA-X under the default parameters using the neighbor joining method. Then cDNA was prepared, the candidate gene DsOMT018 was amplified and recovered, the pET-28a enzyme cutting vector was homologously recombined with the target gene DsOMT018 (homologous recombination of pET-28a enzyme cutting vector and target gene DsOMT018), Figure 4 protein expression (protein expression), Figure 5), in vitro enzyme activity reaction, and LC / MS detection, etc. After a series of work, it is finally identified that the gene can catalyze the reaction of corydalis tuber base to generate isocorydine and corydine. The steps of each stage are as follows: (1) Preparation of cDNA template Fresh roots, stems and leaves of C. decumbens were taken, sliced, and then quickly frozen in liquid nitrogen for RNA extraction. Total RNA extraction was performed using the HiPure HP Plant RNA Mini Kit of Guangzhou Meiji Biological Technology Co., Ltd. According to the operation steps of the kit instructions, RNA was extracted, and after detection, the RNA was reversely transcribed into cDNA using the TAKARA reverse transcription kit, and was stored at -20ºC for standby use.
[0020] (2) Gene amplification and recovery The ORF (open reading frame) of 18 candidate genes DsOMT of C. decumbens was found out by using NCBI online software (https: / / www.ncbi.nlm.nih.gov / orffinder). Then the specific primers of the full-length sequence of the gene coding region were designed by using SnapGene software. The DsOMT018 gene primer designed with the homologous arm of the E. coli expression vector pET28a vector was as follows: DsOMT018-5'F: cagcaaatgggtcgcggatccatggaagtgaagaatagtgctgatc (SEQ ID NO. 3); the downstream primer was DsOMT018-3'R: cgacggagctcgaattcggatccttaataagtataagcctcgataacag (SEQ ID NO. 4). The cDNA obtained by reverse transcription was used as the template, and DNA polymerase (phanta enzyme) was used for gene amplification. The amplification system was as follows: cDNA 2 μL, 2×phantaMax Master mix 25 μL, upstream and downstream primers (0.2 μM) 2 μL each, ddH2O to 50 μL, and the amplification system was as follows: 95ºC, 3 min; 95ºC, 15 s, 55ºC, 15 s, 72ºC, 1 min, 40 cycles; 72ºC, 5 min. After the PCR amplification program was completed, the length of the amplified gene band was detected by 1% agarose gel electrophoresis to determine whether the length of the amplified gene band was consistent with the length of the target gene band.
[0021] If the lengths are similar, the target gene (i.e. DsOMT018 target gene) can be recovered by using the reagent kit of GenStar Company. The recovery concentration was determined in NanoDrop2000, and finally stored in a refrigerator at -20ºC.
[0022] (3) Construction and identification of gene recombinant vector A. Vector Linearization: DH5α bacteria containing the empty pET-28a vector were amplified and the plasmid extracted. The plasmid was digested with BamHI enzyme and purified using a kit to obtain the linearized pET-28a vector, which was stored at -20℃ for later use. The digestion system consisted of 2 μL of pET28a vector (1 μg / μL), 2 μL of 10×Buffer solution, 2 μL of BamHI enzyme, and ddH2O to a final volume of 20 μL. The vector was incubated at 37℃ for 1 hour using a PCR instrument. The pET28a vector was purified and recovered using the Omega EZNA® Cycle Pure Kit, and its concentration was determined before storage at -20℃ for later use.
[0023] B. Gene recombination: LB liquid medium (1L): Weigh 10g tryptone, 5g yeast extract, and 10g sodium chloride, add 950 mL deionized water to dissolve, adjust the pH to 7.0 with 5 M NaOH solution, and bring the volume to 1L with deionized water. Sterilize by steaming at 121℃ for 20 min.
[0024] LB solid medium (1L): Add 15g of agar powder to LB liquid medium (1L) and autoclave at 121℃ for 15 min.
[0025] LB resistance plates: Add 15g of agar powder to 1L of LB liquid medium and autoclave at 121℃ for 15min. Once the medium temperature has cooled to approximately 55℃, add 1mL of filtered, sterilized kanamycin solution (100 mg / mL), mix well, and pour into plates. Store at 4℃.
[0026] The DsOMT018 target gene amplified by the ready-to-use seamless cloning enzyme kit of Shenguo Bioengineering (Shanghai) Co., Ltd. is connected with the linearized pET-28a vector. According to the homologous recombination enzyme instruction, the homologous recombination connection is carried out, and the component allocation ratio is calculated according to the concentration of the linearized pET-28a vector and the DsOMT018 target gene. The DNA molar ratio of the linearized pET-28a vector to the DsOMT018 target gene is 1.5:1. The total reaction system is 5 μL, wherein the ligase is 2.5 μL. Each component is added to the PCR tube and mixed gently by blowing and sucking with a pipette gun. Incubated at 50°C for 30 min in a PCR instrument to obtain the pET-28a-DsOMT018 recombinant vector. The transformation strain is E. coli BL21 (DE3) competent, which is mainly used to introduce the constructed recombinant vector (containing the target gene) into cells. Its competent cells can efficiently uptake exogenous DNA and are widely used for induced expression of recombinant proteins. The BL21 (DE3) competent is taken out from the-80°C refrigerator and placed on the 4°C ice for thawing. 5 μL of the pET-28a-DsOMT018 recombinant vector plasmid is taken into a 1.5 mL centrifuge tube with a pipette gun. 50 ul of BL21 (DE3) competent is added thereto and mixed gently by blowing and sucking with a pipette gun. It is placed on the 4°C ice for 30 min, put into the 42°C metal bath for heat shock for 45 s, and then put into the 4°C ice for 2 min. 200 μL of LB liquid medium is added thereto in the clean bench, and it is placed in a 37°C shaking bed for 1 h. 150 μL is taken and coated on an LB resistant plate, sealed with a sealing film and placed in a 37°C E. coli incubator for overnight culture.
[0027] C. Bacterial water detection: On the clean bench, 8 colonies of the same size were randomly picked from the LB resistance plate in (3) and placed in 20 μL ddH2O. For the 8 colonies, 3 μL was taken for PCR amplification, and each colony corresponded to a PCR tube. The upstream primer (0.2 μM) was JC-5'F: ccgcgaaattaatacgactcactatagg (SEQ ID NO. 5), and the downstream primer (0.2 μM) was JC-3'R: ccgtttagaggccccaagg (SEQ ID NO. 6). The PCR reaction system used 2x Taq Master Mix enzyme reaction system from Nanjing Novozyme Biotech Co., Ltd., and the specific content was as follows: upstream primer (0.2 μmol / μL) 0.5 μL, downstream primer (0.2 μmol / μL) 0.5 μL, 2x Taq Master Mix enzyme 12.5 μL, and ddH2O was supplemented to 25 μL. The PCR amplification program was 95°C, 3 min; 95°C, 30 s, 55°C, 15 s, 72°C, 1 min, 35 cycles; 72°C, 5 min. After the reaction program was completed, the length of the PCR product was detected by 1% agarose.
[0028] If the length of the PCR product is near the 1500 bp band, it is positive, indicating that the assembly is successful and can be sequenced. After successful sequencing, the E. coli BL21 (DE3) positive bacteria liquid with the successfully transformed pET-28a-DsOMT018 recombinant vector was preserved at a volume ratio of 1:1 with 50% glycerol.
[0029] (4) Protein expression and purification of candidate gene DsOMT018 Protein expression: The bacteria liquid preserved in (3) was recovered at 37°C and 220 r / min. After the bacteria liquid was fully turbid, 3 mL of the bacteria liquid was inoculated into 500 mL of LB liquid medium containing 100 μg / mL kanamycin. When the OD value of the bacteria liquid increased to 0.6-0.8, 1 mM IPTG (isopropyl-β-D-thiogalactoside) was added, and the protein induction expression was performed at 16°C for 12-14 h.
[0030] Protein purification: After the expression induction was completed, the bacterial cells were collected by centrifugation at 4°C and 5000 rpm / min for 20 min using a large high-speed refrigerated centrifuge. The bacterial cells were resuspended with 20 mL of Tris-HCl (pH=7.5) buffer containing 50 mM Tris and 200 mM NaCl, and then broken 1-2 times using a high-pressure low-temperature cell disrupter (Guangzhou Juyong Biotechnology Co., Ltd.) at a pressure of 1000 bar and a temperature of 4°C. Then, the supernatant was collected by high-speed centrifugation at 4°C and 12000 rpm / min for 30 min, and then loaded onto a Ni-NTA agarose affinity column. The column was eluted with different concentrations of imidazole from low concentration to high concentration (20 mM, 50 mM, 60 mM, 200 mM) in sequence, with 50 mL of each concentration eluted once and the filtrate collected, followed by elution with the next concentration.
[0031] (5) Enzyme activity reaction The in vitro enzyme activity reaction was performed in a 200 μL mixed system: the experimental group was added with 100 μL of purified protein 10 μg / μL obtained in (4), 90 μL of 50 mmol / L Tris-HCl (pH=8.0), 7 μL of 100 mmol / L methyl donor SAM, and 3 μL of 100 mmol / L substrate Corydalis tuberine; the control group was added with 100 μL of purified protein 10 μg / μL eluted with 200 mM imidazole in (4), 91 μL of 50 mmol / L Tris-HCl (pH=7.5), and 6 μL of 100 mmol / L methyl donor SAM and 3 μL of 100 mmol / L substrate Corydalis tuberine were added after incubation at 98°C for 5 min to inactivate the protein in the control group and lose its catalytic activity on the substrate Corydalis tuberine; the experimental group and the control group were incubated at 37°C and 200 r / min overnight, and then 200 μL of analytical methanol was added to inactivate, centrifuged at 12000 r / min for 8 min, and the supernatant was filtered for liquid chromatography detection. Finally, the reaction products were detected by LC-MS analysis.
[0032] (6) Product detection The LC-MS detection conditions are as follows: Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography mass spectrometry (LC / MS) was used for detection: the ion source was in negative ion mode, the voltage was 3500 V, the fragmentation voltage was 135 V, the cone hole voltage was 60 V, the radio frequency voltage was 750 V, the scan range was 100-1000 m / z, and the scan mode was SRM.
[0033] Chromatographic conditions: the chromatographic column was Agilent Extend-C18 (250 mm x 4.6 mm, 5 μm), column temperature: 30 ℃, the mobile phase for measuring product was acetonitrile (A) - water (B), gradient elution: 0-25 min, 10%-30% acetonitrile; 25-28 min, 30%-90% acetonitrile; 28-33 min, 90%-30% acetonitrile. When gradient elution, linear change was presented. Elution time: 33 min; injection volume: 10 μL; flow rate: 0.4 mL / min; detection wavelength: 282 nm.
[0034] LC-MS detection results: from Figure 2 The HPLC chart of DsOMT018 enzyme activity reaction showed that two peaks were generated, which were consistent with the time peaks of the standard substances isoepicactine and epicatechin, combined with Figure 1 the mass spectrometry data, the molecular weight of the two peaks generated by the enzyme activity reaction of DsOMT018 was consistent with that of the standard substances isoepicactine and epicatechin, that is, the enzyme activity reaction of DsOMT018 catalyzed the methylation of C-1 and C-11 of epicatechin alkaloid to generate isoepicactine and epicatechin, respectively.
[0035] The above shows and describes the basic principles, main features and advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application, and various changes and improvements can be made without departing from the spirit and scope of the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.
Claims
1. A Ginkgo biloba O-methyltransferase DsOMT018 gene, characterized in that, The nucleotide sequence of the Z. caulescens O-methyltransferase DsOMT018 gene is shown as SEQ ID NO.
1.
2. The protein encoded by the Ginkgo biloba O-methyltransferase DsOMT018 gene of claim 1, characterized by, The amino acid sequence of the encoded protein is shown as SEQ ID NO.
2.
3. A recombinant plasmid containing the Z. caulescens O-methyltransferase DsOMT018 gene of claim 1.
4. The recombinant plasmid containing the O-methyltransferase DsOMT018 gene of Goniobombus uniflorus according to claim 3, characterized in that, The Z. caulescens O-methyltransferase DsOMT018 gene is homologously recombined with the pET28a vector to obtain a pET28a-DsOMT018 recombinant plasmid.
5. A genetically engineered bacterium containing the recombinant plasmid of claim 1, or having the exogenous Z. caulescens O-methyltransferase DsOMT018 gene of claim 1 integrated into the genome of the genetically engineered bacterium.
6. The genetically engineered bacteria of claim 5, wherein, The genetically engineered bacterium is Escherichia coli BL21 (DE3).
7. Use of the Z. caulescens O-methyltransferase DsOMT018 gene of claim 1 in the preparation of isostrychnidine and stychnidine.
8. The use of the Stephania sinica O-methyltransferase DsOMT018 gene according to claim 7 for the preparation of isoform and corydaline, characterized in that: Isostrychnidine and stychnidine are generated from the raw materials stylopine and methyl donor SAM under the catalysis of the Z. caulescens O-methyltransferase encoded by the Z. caulescens O-methyltransferase DsOMT018 gene.
9. A process for the preparation of isocorydine and corydine, characterized in that, Isostrychnidine and stychnidine are generated from the raw materials stylopine and methyl donor SAM under the catalysis of the Z. caulescens O-methyltransferase encoded by the Z. caulescens O-methyltransferase DsOMT018 gene of claim 1.