Application of broad-spectrum sexual disease-resistant gene Ataf1

By inhibiting the expression of the Arabidopsis thaliana Ataf1 gene, a disease-resistant transgenic Arabidopsis plant was constructed, solving the problem of rapeseed's resistance to pathogens and achieving significant resistance to Sclerotinia sclerotiorum, Botrytis cinerea, Pseudomonas syringae, and Plasmodium falciparum.

CN121344052APending Publication Date: 2026-01-16HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511542054.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-27
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

In existing technologies, rapeseed is susceptible to pathogens such as Sclerotinia sclerotiorum, Botrytis cinerea, Pseudomonas syringae, and Plasmodiophora, leading to severe yield reduction and economic losses. Furthermore, the function of the Arabidopsis thaliana Ataf1 gene lacks reference in rapeseed disease resistance research.

Method used

By inhibiting the expression of the Arabidopsis S gene Ataf1, disease-resistant transgenic Arabidopsis plants can be constructed using T-DNA insertion, gene editing, or RNAi technology to enhance their resistance to pathogens.

Benefits of technology

The Arabidopsis Ataf1 mutant exhibits significant resistance, reducing lesion area and pathogen biomass, and provides genetic resources for disease resistance in rapeseed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344052A_ABST
    Figure CN121344052A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a broad-spectrum sexual disease resistance gene Ataf1. The invention discloses application of inhibiting expression of an arabidopsis S gene Ataf1 in enhancing resistance of plants to pathogenic bacteria. The CDS sequence of the arabidopsis S gene Ataf1 is shown as SEQ ID NO. 1. According to the invention, an S gene Ataf1 of arabidopsis thaliana is selected, the growth phenotype of a homozygous mutant of the gene constructed by a T-DNA insertion method is observed, and inoculation experiments are carried out on the homozygous mutant by using sclerotinia sclerotiorum, botrytis cinerea, pseudomonas syringae tomato pathogenic variants and plasmodiophora brassicae. The result shows that the growth of the Ataf1 mutant is not influenced, the Ataf1 mutant shows obvious resistance to sclerotinia sclerotiorum, botrytis cinerea, pseudomonas syringae and plasmodiophora brassicae, and the scab area and the pathogenic bacterium biomass of the Ataf1 mutant are obviously lower than those of a wild plant. Therefore, the S gene Ataf1 of arabidopsis thaliana can be used as a potential gene resource for a green prevention and control strategy of sclerotinia rot of colza.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of bio-agriculture, and relates to the application of a broad-spectrum resistance susceptible gene Ataf1. BACKGROUND

[0002] Brassica napus L. AACC, 2n=38, originated from the Mediterranean coast, is one of the main oil crops in the world. It is widely planted due to its high oil content, stable yield, and potential for yield increase. Currently, rapeseed is one of the main oil crops in China, and is also an important honey source and traditional ornamental plant. It is also a pioneer crop for vegetable, green manure, and saline-alkali land management. However, during the entire growth period of rapeseed, it is not only affected by drought, low temperature, and soil salinization, but also by various pathogens, insects, and weeds, which seriously affect the quality of rapeseed.

[0003] Sclerotinia sclerotiorum causes sclerotinia disease, which is one of the common diseases during the growth of rapeseed. The plant at each growth stage and each part may be harmed by sclerotinia disease, which reduces the survival rate of rapeseed and reduces yield. In severe cases, it can cause economic losses of more than 80%. The rapeseed root tumor caused by Plasmodiophora brassicae is a disease that mainly harms the roots of rapeseed. Root tumor disease can cause damage to the roots of rapeseed, affecting the absorption of water and nutrients by the plant, thereby causing the growth rate to slow down and the yield to decrease significantly. After the disease occurs, the average yield reduction can reach 50%, and in some severe fields, even absolute yield reduction can occur.

[0004] Currently, using molecular technology to breed disease-resistant varieties has become an economic and effective prevention and control strategy. There are some susceptible genes (Susceptibility gene, S) in plants, which may provide convenient conditions for the invasion of pathogens. Currently, the disease resistance-related functions of some plant susceptible genes have been reported. By regulating these known susceptible genes, researchers have achieved the goal of enhancing the disease resistance of specific plants to a certain extent, providing a reference for plant disease resistance breeding. However, plant gene families are numerous and have high specificity in function. The mechanisms of different genes under different plant species or different disease stresses are significantly different. For the Ataf1 gene, its specific function, whether it is related to the disease resistance process, and how it affects the response of plants to pathogens, there is no any research conclusion that can be referred to, and its function cannot be predicted by the existing research results of susceptible genes.

[0005] Arabidopsis thaliana as a model plant, its gene function research is often used to infer the function of homologous genes in other Brassicaceae plants. Arabidopsis and Brassica belong to the same family of Brassicaceae, and there is high homology between their genomes. The study of the function of Arabidopsis genes can provide an important reference for the function research of homologous genes in Brassica. For example, Arabidopsis AtZntB1 gene has been confirmed to be involved in magnesium ion transport, and the cloning and functional verification of its homologous gene in Brassica also show similar mechanisms. After the Arabidopsis miR395d precursor gene is introduced into Brassica by Agrobacterium transformation, the transgenic plants show similar sulfur metabolism regulation characteristics as Arabidopsis. The homologous genes of Arabidopsis (such as AOP3, BZO1) and Brassica (BnMAM1, BnCYP83A1) show similarity in function and are involved in glucosinolate synthesis pathway. SUMMARY

[0006] The purpose of the present application is to overcome the above-mentioned deficiencies of the prior art and provide the application of broad-spectrum disease-resistant gene Ataf1.

[0007] The purpose of the present application can be achieved by the following technical solutions:

[0008] The application of inhibiting the expression of Arabidopsis S gene Ataf1 in enhancing the resistance of plants to pathogenic bacteria, the CDS sequence of the Arabidopsis S gene Ataf1 is shown as SEQ ID NO. 1, the cDNA sequence is shown as SEQ ID NO. 2, and the encoded protein sequence is shown as SEQ ID NO. 3.

[0009] Preferably, the plant is selected from Arabidopsis, Brassica or tomato.

[0010] Preferably, the pathogenic bacteria are selected from pathogenic fungi or bacteria, the pathogenic fungi are preferably Sclerotinia sclerotiorum, Botrytis cinerea and Plasmodiophora brassicae, and the pathogenic bacteria are Pseudomonas syringae pv. tomato.

[0011] Preferably, the expression of the Arabidopsis S gene Ataf1 is inhibited by T-DNA insertion method, gene editing or RNAi technology.

[0012] The application of inhibiting the expression of Arabidopsis S gene Ataf1 in preventing plant diseases caused by pathogenic fungi or bacteria infection, the CDS sequence of the Arabidopsis S gene Ataf1 is shown as SEQ ID NO. 1.

[0013] Preferably, the plant is selected from Arabidopsis, Brassica or tomato.

[0014] Preferably, the pathogenic bacteria are selected from pathogenic fungi or bacteria, the pathogenic fungi are preferably Sclerotinia sclerotiorum, Botrytis cinerea and Plasmodiophora brassicae, and the pathogenic bacteria are Pseudomonas syringae pv. tomato.

[0015] Preferably, the expression of the Arabidopsis S gene Ataf1 is inhibited by T-DNA insertion method, gene editing or RNAi technology.

[0016] The substance for inhibiting the expression of the Arabidopsis S gene Ataf1 has the CDS sequence of the Arabidopsis S gene Ataf1 shown as SEQ ID NO. 1.

[0017] Preferably, the pathogenic fungi are selected from the group consisting of Sclerotinia sclerotiorum, Botrytis cinerea, Plasmodiophora brassicae, and the pathogenic bacteria is Pseudomonas syringae pv. tomato DC3000.

[0018] Advantages:

[0019] The S gene Ataf1 of Arabidopsis is selected, the growth phenotype of the homozygous mutant of the gene constructed by T-DNA insertion method is observed, and Sclerotinia sclerotiorum (1980), Botrytis cinerea B05.10, Pseudomonas syringae pv. tomato DC3000 and Plasmodiophora brassicae are inoculated for the experiment. The results show that the growth of Ataf1 mutant is not affected, and it shows significant resistance to Sclerotinia sclerotiorum, Botrytis cinerea, Pseudomonas syringae and Plasmodiophora brassicae, and the lesion area and pathogen biomass are significantly lower than those of wild type plants. This shows that the S gene Ataf1 of Arabidopsis can be used as a potential genetic resource for green prevention and control strategy of rapeseed sclerotinia disease. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 . T-DNA primer design principle diagram

[0021] Figure 2 . Arabidopsis mutant Ataf1 homozygous verification and phenotype

[0022] (A) Lane 1: Mark, Lane 2, 3: Wild-type Arabidopsis Col-0, Lane 4, 5: Mutant Arabidopsis Ataf1, LP and RP: primers flanking the T-DNA insertion site on the plant genome; BP: primer on the T-DNA segment. (B) Phenotypes of Arabidopsis at different growth stages. Top: root length phenotype of seeds after 7 days of germination on 1 / 2 MS medium; Middle: phenotype of 4-week-old Arabidopsis; Bottom: phenotype of Arabidopsis at the bolting and flowering stage; Scale bar is 3 cm. (C) Statistical data of Arabidopsis. Top: root length statistics of seeds after 7 days of germination on 1 / 2 MS medium (n=6); Bottom: statistical data of 1000-seed weight of Arabidopsis (n=6).

[0023] Figure 3 . Resistance analysis of mutant Ataf1 to S. homoeocarpa 1980

[0024] (A) Phenotype of Arabidopsis leaves after live inoculation of S. homoeocarpa 1980 (36 h). (B) Statistical data of lesion area of Arabidopsis after inoculation of 1980 (36 h) (n=20).

[0025] Figure 4 . Resistance analysis of mutant Ataf1 to Botrytis cinerea B05.10

[0026] (A) Phenotype of Arabidopsis leaves after live inoculation of Botrytis cinerea B05.10 (36 h). (B) Statistical data of lesion area of Arabidopsis after inoculation of B05.10 (36 h) (n=20).

[0027] Figure 5 . Resistance analysis of mutant Ataf1 to Pst DC3000

[0028] (A) Phenotype of Arabidopsis after 5 days of inoculation of bacteria Pst DC3000. (B) Statistical data of bacterial number in Arabidopsis leaves after 72 h of inoculation.

[0029] Figure 6 . Resistance analysis of mutant Ataf1 to Plasmodiophora brassicae

[0030] (A) Phenotype of Arabidopsis after 23 days of inoculation of Plasmodiophora brassicae. (B) Disease index of wild-type Col-0 and mutant Ataf1 after 23 days of inoculation of Plasmodiophora brassicae. (C) Statistical data of relative biomass expression in roots of Arabidopsis after 23 days of inoculation of Plasmodiophora brassicae DETAILED DESCRIPTION

[0031] The test plants and culture conditions involved in the following examples are as follows:

[0032] Tested pathogenic microorganisms: Sclerotinia sclerotiorum 1980, Botrytis cinerea B05.10, Pseudomonas syringae pv. tomato DC3000 Pst DC3000, Plasmodiophora brassica, were all preserved in the laboratory.

[0033] Tested plants: Arabidopsis thaliana: Col-0 (preserved in the laboratory), mutant Ataf1 (AT1G01720) (purchased from https: / / www.arashare.cn / index / Product / index.html), constructed using T-DNA insertion method.

[0034] Pathogenic microorganism culture conditions: Sclerotinia sclerotiorum 1980 was activated and cultured on PDA medium at 20°C; Botrytis cinerea B05.10 was activated and cultured on PDA medium at 20°C; Pst DC3000 was activated and cultured on King’s SB (Kana, Rif) medium at 28°C; Plasmodiophora brassica spores were extracted from the diseased parts of rape clubroot.

[0035] Plant culture conditions: Arabidopsis thaliana was cultured in a plant culture room, and the culture conditions were 22°C, light for 12 h, dark for 12 h, and relative humidity of 75%.

[0036] Example 1 Homozygous verification and phenotype of Arabidopsis thaliana mutant Ataf1

[0037] Arabidopsis thaliana mutant homozygous verification: Arabidopsis thaliana mutant genomic DNA as a template, extraction method using conventional CTAB method. As follows: take 100 mg fresh leaves, placed in 2.0 mL clean centrifuge tube, add sterilized steel ball, liquid nitrogen freeze grinding into dry powder, add 700 μL 2% CTAB extraction buffer and inverted mix, the sample was placed in 65℃ water bath 30 min (every 10 min up and down inverted mix), 12000 r / min centrifugation 10 min, take 500 μL supernatant in a new 2.0 mL, respectively, add 500 μL DNA extraction phenol and chloroform, mix well, 12000 r / min centrifugation 10 min. Take 400 μL supernatant to a new 1.5 mL centrifuge tube, add equal volume of isopropanol mix, at-20℃ for 20 min-30 min, 12000 r / min centrifugation 10 min discard supernatant. Add 700 μL 75% ethanol for rinsing and precipitating, 12000 r / min centrifugation 1 min, discard supernatant, repeat once, the precipitate was placed at room temperature to dry, add 30 μL dd H2O for dissolution, take 1 μL as a template for PCR positive detection.

[0038] The three primer method (LP, BP, RP) was used to detect the genotype of Arabidopsis thaliana mutant homozygote.

[0039] Ataf1-LP: TCCCAGGGACAGAAAATATCC

[0040] Ataf1-RP: AAATATTAAATTGATTGCGGCAC

[0041] Universal-BP: ATTTTGCCGATTTCGGAAC

[0042] The principle of the three-primer method is to design an upstream primer LP and a downstream primer RP at positions 200 bp-400 bp on either side of the insertion site, and a specific primer BP on the T-DNA insert. Two pairs of reactions are set up: one using primers LP and RP, and the other using primers BP and RP. In the former reaction, wild-type (WT) and heterozygous mutant plants (HZ) can both amplify bands; in the latter reaction, homozygous mutant plants (HM) and heterozygous mutant plants (HZ) can amplify bands. Because no T-DNA insertion has occurred on either chromosome of the WT target gene, only the LP to RP PCR product can be amplified; T-DNA insertion has occurred on both chromosomes of the HM target gene, so products amplified using BP and RP as primers can be obtained, but because the inserted T-DNA fragment is too long, it will inhibit the formation of the target gene-specific amplification product, so the LP to RP PCR product cannot be amplified; T-DNA has been inserted on only one chromosome of the HZ target gene, so products from both reactions can be obtained.

[0043] Phenotypic observation of Arabidopsis mutants: Seeds of Arabidopsis thaliana that were verified to be homozygous were collected. A portion of the seeds were disinfected with 75% alcohol for 15 min, washed more than 3 times with sterile dd H2O in a laminar flow hood, and vernalized for 3 days at 4℃ with a portion of dd H2O remaining. The seeds were then sown on 1 / 2 MS plates in a laminar flow hood and sealed. The seeds were placed in a plant culture room for 7 days to observe the differences in root length among different mutants. The seedlings were transplanted to small cups with nutrient soil (imported soil: domestic soil: vermiculite = 8:4:1), marked, and continued to be cultured. The differences in leaf phenotype and plant differences among mutants were observed in the third and fourth weeks. The differences in bolting period among mutants were observed in the fifth and sixth weeks. After bolting, the plants were managed in a 25℃ culture room and the seeds were collected.

[0044] To determine whether the obtained Arabidopsis seeds were homozygous mutants, the effects of gene deletion on the plant's agronomic traits were analyzed. The Arabidopsis mutant seeds were vernalized for 3 days, then sown on 1 / 2 MS medium and grown for 5-7 days before being transplanted into potting soil. Three weeks later, DNA was extracted from individual mutant plants, and the homozygous genotype of the Arabidopsis mutants was determined using a three-primer method (LP, BP, RP). The results showed that the identified plants were homozygous mutants. Figure 2 A). Simultaneously, seeds of homozygous Arabidopsis mutants were collected and planted using the same method to observe phenotypes and examine whether the mutation of the target gene affected the plant's growth phenotype. Results showed that: the root length of the mutant Ataf1 at the seedling stage was not significantly different from that of the wild-type Col-0; the growth status of the mutant plants at approximately 4 weeks was not significantly different from that of the wild-type Col-0; and the phenotype of the mutant at the bolting and flowering stage was also not significantly different from that of the wild-type Col-0. Figure 2B and C). The results showed that mutation of Ataf1 gene had no significant effect on the agronomic traits of Arabidopsis.

[0045] Example 2

[0046] 2.1 Analysis of resistance of Arabidopsis mutant Ataf1 to S. sclerotiorum and B. cinerea

[0047] Culture of S. sclerotiorum and B. cinerea: Using a needle to take the wild type S. sclerotiorum 1980 or wild type B. cinerea B05.10 mycelial block, the mycelium was inoculated on a 90 mm diameter PDA medium with the mycelium facing down, and was placed in a 20°C fungal culture room for continuous activation for three generations; using a puncher to take a fresh mycelial block on the edge of a 90 mm diameter PDA medium with 17.5 mL of 2xSY medium, and was placed in a 20°C fungal culture room for 36 h of culture.

[0048] Inoculation and disease detection of S. sclerotiorum and B. cinerea: Selecting homozygous Arabidopsis mutants to be cultured in small cups containing nutrient soil, and placed in a plant culture room for about four weeks of culture. Using a 3 mm puncher to take a mycelial block on a 2xSY medium, and inoculating it on the right side of the leaf blade of the pure Arabidopsis mutant close to the leaf vein, and making good moisture. After 36 h of inoculation of 1980, and 48 h of inoculation of B05.10, the lesion diameter was measured by cross method, and the lesion area was calculated. The test was repeated three times.

[0049] The results showed that the lesion area of wild type Col-0 was about 115.48 mm 2 around, and the lesion area of mutant Ataf1 was about 69.41 mm 2 around Figure 3 A and B). The above results showed that the lesion area of mutant Ataf1 was significantly smaller than that of wild type Col-0, proving that mutant Ataf1 had strong resistance to S. sclerotiorum 1980.

[0050] After 48 h of inoculation of B. cinerea B05.10 mycelial block, it was found that the lesion area of wild type Col-0 was about 101.65 mm 2 around, and the lesion area of mutant Ataf1 was about 49.01 mm 2 around Figure 4 A and B). The above results showed that the resistance results of inoculation of B. cinerea B05.10 were similar to those of inoculation of 1980, and the lesion area of mutant Ataf1 was significantly smaller than that of wild type Col-0, indicating that mutant Ataf1 also had strong resistance to B. cinerea B05.10.

[0051] 2.2 Detection of resistance of Arabidopsis mutant Ataf1 to P. syringae Pst.DC3000

[0052] Culture of Pseudomonas syringae Pst DC3000: Pst DC3000 was streaked on King's B (Kana, Rif) solid medium and incubated at 28°C for two days to grow single colonies. The single colonies were inoculated in 500 μL of King's B (Kana, Rif) liquid medium and shaken until turbid. Then the culture was diluted 1:1000 and shaken overnight until OD600=1.0. The bacteria were collected by centrifugation at 4000 r / min for 10 min, washed twice with 10 mM MgCL2, and resuspended in 10 mM MgCL2 to OD600=0.1. The bacteria were diluted to 1×10 5。

[0053] Inoculation of Pst DC3000 and disease assay: The lower epidermis of Arabidopsis was injected with 1 mL syringe. The injected area of the leaves was marked, and the leaves were sampled at 0 h and 72 h after injection to detect the number of bacteria in the leaves. The experiment was repeated three times.

[0054] The leaves of wild type Col-0 and mutant Ataf1 were inoculated with Pst DC3000 at 4 weeks old. After 5 days, more yellow spots were observed on the leaves of wild type Col-0, and the leaves turned yellow and chlorosis. However, the leaves of mutant Ataf1 showed less yellowing, and no obvious yellowing was observed on the main veins. The disease condition of mutant Ataf1 was lighter than that of wild type Col-0. Figure 5 B). The above results showed that mutant Ataf1 had stronger resistance to Pst DC3000. Figure 5

[0055] 2.3 Resistance of Arabidopsis mutant Ataf1 to Plasmodiophora brassicae

[0056] ​Extraction of Plasmodiophora brassicae chlamydospores: 10 g of galling tissue was chopped, added with 50 mL sterilized water, and ground finely in a mortar or crushed with a fruit juice squeezer; filtered with 4 layers of gauze, and the filtrate was transferred into a clean 50 mL centrifuge tube, centrifuged at 3100 r / min for 15 min, and the supernatant was discarded; the precipitate was resuspended in 50 mL sterilized water, centrifuged at 3100 r / min for 10 min, and this step was repeated 2-3 times. The supernatant was discarded; 5 mL 50% sucrose solution was added to the precipitate, mixed well, and centrifuged at 3100 r / min for 10 min; the supernatant was carefully transferred into a clean centrifuge tube with a syringe, added with 30 mL sterilized water, centrifuged at 3100 r / min for 10 min, and the supernatant was discarded; the precipitate was resuspended in 30 mL sterilized water, centrifuged at 3100 r / min for 10 min; this step was repeated 2-3 times, and the precipitate was resuspended in 5 mL sterilized water for use; and stored at 4°C in the dark.

[0057] Inoculation of Plasmodiophora brassicae: Arabidopsis or rape was cultured for about 2 weeks (14 d), 1 mL of Plasmodiophora brassicae chlamydospores with a concentration of 1×10 6 or 1×10 7 / mL was taken with a pipette and used to irrigate the roots for inoculation, and the disease index was counted 21 d after inoculation.

[0058] Statistical standard of Plasmodiophora brassicae disease index: according to a five-grade classification standard, 0 grade, no disease; 1 grade, very few tumors on lateral roots, and the damage to the main root can be ignored; 2 grade, the main root and a few lateral roots are covered with small tumors; 3 grade, the main root has medium to large spherical tumors; 4 grade, the lateral roots and the main root have serious tumors, the main root is completely swollen, and the lateral roots are completely damaged; and 5 grade, the root is completely swollen and rotten.

[0059] Extraction of total DNA from P. arisaemae: The infected root was washed clean, cut into small pieces, and then frozen in liquid nitrogen. The frozen root was ground in a mortar and pestle and transferred to a 2 mL centrifuge tube. 800 μL of 2% CTAB extraction buffer was added and mixed well. The mixture was incubated at 65 °C for 15-30 min with gentle mixing every 5 min. Then, 400 μL of chloroform and Tris-saturated phenol solution were added to the mixture, which was centrifuged at 12 000 r / min for 15 min. The supernatant was transferred to another 2 mL centrifuge tube and extracted with an equal volume of chloroform. The mixture was centrifuged at 12 000 r / min for 15 min, and 450 μL of the supernatant was mixed with an equal volume of isopropanol. The mixture was precipitated at -20 °C for 10-15 min, and then centrifuged at 12 000 r / min for 15 min. The supernatant was discarded, and the precipitate was washed twice with 1 mL of 75% ethanol. The precipitate was dried in a 37 °C oven, and then dissolved in 30 μL of deionized water containing 25 μg / mL of RNase A. The DNA concentration was measured, and the DNA was stored at -20 °C (Allen et al 2006).

[0060] Detection of the relative biomass of P. arisaemae in infected roots: Arabidopsis plants were inoculated with P. arisaemae according to the inoculation method. At 23 days after inoculation, the infected roots of Arabidopsis were collected as experimental materials. Three infected roots of each family were used as a sample. The total DNA was extracted from the infected roots of Arabidopsis using the CTAB method. The DNA concentration was measured using a Nanodrop, and the total DNA concentration was diluted to 100-200 ng / μL. The diluted DNA was used as a template for qPCR to detect the content of the reference gene of P. arisaemae relative to the reference gene of Arabidopsis. The relative biomass of P. arisaemae was represented by the content of the ACTIN gene of P. arisaemae (AY452179.1, primers: Pbactin-qF: CACCGACTACCTGATGAA, Pbactin-qR: CAGCTTCTCCTTGATGTC) relative to the ACTIN2 gene of Arabidopsis (AT3G18780, primers: ACTIN2-qF: GCACCCTGTTCTTCTTACGGA, ACTIN2-qR: GTGAGACACACCATCACCAGA).

[0061] The wild-type Col-0 and the mutant Ataf1 inoculated with P. arisaemae for 23 days were counted. The results showed that the disease index of the wild-type Col-0 was 68.5, and the disease index of the mutant Ataf1 was 48.5 Figure 6A and B). The above results showed that the disease index of mutant Ataf1 was significantly smaller than that of wild type Col-0, and the control effect on Plasmodiophora was 20%. By detecting the biomass of Plasmodiophora in diseased root systems, we found that the biomass of Plasmodiophora in Ataf1 diseased root systems was significantly lower than that in Col-0 (Fig. 1C). These results indicated that the mutant Ataf1 enhanced the resistance of Arabidopsis to pathogenic bacteria. Figure 6 C). The results showed that the mutant Ataf1 enhanced the resistance of Arabidopsis to pathogenic bacteria.

[0062] Summary and discussion

[0063] Oilseed rape and other crops are severely affected by Sclerotinia sclerotiorum and Plasmodiophora brassicae, and the control of these diseases is a great challenge. These diseases not only cause huge economic losses in China, but also in the global range. Therefore, effective control of these diseases has become an urgent problem to be solved. The rapid development of molecular biology has made the molecular breeding technology more and more perfect. At the same time, the research on the interaction between plants and pathogenic microorganisms is deepening, and the gene engineering technology is continuously innovating and applying. The disease-resistant germplasm resources bred by transgenic and gene editing technology not only can greatly shorten the breeding time of resistant varieties, but also can breed new varieties with persistent and broad-spectrum disease resistance. Plant R genes can recognize the attack of pathogen and trigger the defense mechanism of plants against pathogens. Unlike R genes, there are some S genes in plants, which help the pathogen to invade the plant. The known S genes have the following characteristics: they promote the compatibility of pathogen and plant, maintain this compatibility, and negatively regulate the immune signaling of plant. These genes help the pathogen to invade, reproduce and spread by inhibiting the disease resistance of plant. Therefore, by interfering or destroying the function of plant S genes, it is expected to obtain materials with broad-spectrum and persistent disease resistance. In this study, we found that the mutant of Arabidopsis S gene Ataf1 showed high resistance to S. sclerotiorum and Botrytis cinerea, which indicated that Ataf1 could be used as a potential genetic resource for breeding varieties resistant to S. sclerotiorum.

Claims

1. Use of inhibiting expression of Arabidopsis S gene Ataf1 in enhancing plant resistance to pathogenic fungi or bacteria, wherein the CDS sequence of the Arabidopsis S gene Ataf1 is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The plant is selected from Arabidopsis, Brassica or tomato.

3. Use according to claim 1, characterized in that, The pathogenic fungi or bacteria are selected from pathogenic fungi or bacteria, wherein the pathogenic fungi are preferably Sclerotinia sclerotiorum, Botrytis cinerea, Plasmodiophora brassicae, and the pathogenic bacteria are Pseudomonas syringae pv. tomato.

4. Use according to claim 1, characterized in that, The expression of the Arabidopsis S gene Ataf1 is inhibited by T-DNA insertion, gene editing or RNAi technology.

5. Use of inhibiting expression of Arabidopsis S gene Ataf1 in preventing plant diseases caused by pathogenic fungi or bacteria, wherein the CDS sequence of the Arabidopsis S gene Ataf1 is shown as SEQ ID NO.

1.

6. Use according to claim 5, characterized in that, The plant is selected from Arabidopsis, Brassica or tomato.

7. Use according to claim 5, characterized in that, The pathogenic fungi or bacteria are selected from pathogenic fungi or bacteria, wherein the pathogenic fungi are preferably Sclerotinia sclerotiorum, Botrytis cinerea, Plasmodiophora brassicae, and the pathogenic bacteria are Pseudomonas syringae pv. tomato.

8. Use according to claim 5, characterized in that, The expression of the Arabidopsis S gene Ataf1 is inhibited by T-DNA insertion, gene editing or RNAi technology.

9. Use of a substance for inhibiting expression of Arabidopsis S gene Ataf1 in constructing transgenic plants resistant to pathogenic fungi or bacteria, wherein the CDS sequence of the Arabidopsis S gene Ataf1 is shown as SEQ ID NO.

1.

10. Use according to claim 9, characterized in that, The pathogenic fungi or bacteria are selected from pathogenic fungi or bacteria, wherein the pathogenic fungi are preferably Sclerotinia sclerotiorum, Botrytis cinerea, Plasmodiophora brassicae, and the pathogenic bacteria are Pseudomonas syringae pv. tomato.