Blocking agent of environmental DNA for eliminating human pollution and detection method of environmental DNA

Abstract

The invention discloses a blocking agent for eliminating environmental DNA (Deoxyribose Nucleic Acid) of human pollution and a detection method of the environmental DNA, and the blocking agent plays a role in inhibiting amplification of a human source sequence by specifically hybridizing with a human source template and blocking primer annealing or DNA polymerase extension. The invention further provides application of the CRISPR-Cas12a technology to in-vitro removal of human-derived DNA pollution, the method can reduce the sequencing cost and the time cost of bioinformatics processing without affecting detection of target biological groups, and the method is mainly used for treating human pollution in marine environment DNA. And the method can also be used for treating human-derived DNA pollution in similar molecular biology research and application.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and environmental monitoring technology, specifically relating to an inhibitor for eliminating human-contaminated environmental DNA and a method for detecting environmental DNA. Background Technology

[0002] Environmental DNA (eDNA) detection technology analyzes DNA fragments (such as epidermal cells, excrement, and mucus) shed from organisms into the environment in water or sediments to achieve species identification and community monitoring. Compared to traditional fishing or visual surveys, eDNA offers advantages such as non-invasiveness and convenient sampling. Furthermore, supported by high-throughput sequencing and barcode databases, it can simultaneously detect multiple taxa, demonstrating good applicability in challenging areas such as nearshore, deep-sea, and coral reef regions. Currently, eDNA is widely used in biodiversity assessment, ecological health index construction, endangered and rare species monitoring, invasive and harmful organism early warning, and pathogen and pollution risk assessment.

[0003] However, human DNA contamination is difficult to avoid in marine environmental DNA sampling, primarily originating from sewage discharge from sampling platforms (such as ships). Human DNA contamination leads to non-target amplification and background reads, reducing effective sequences and increasing analysis costs. Existing methods largely rely on contamination prevention and post-amplification filtration, making it difficult to simultaneously address specific removal during and after amplification. Therefore, a method that can suppress human sequences without affecting target detection is urgently needed. Summary of the Invention

[0004] This method proposes an inhibitor for eliminating human-contaminated environmental DNA and a method for detecting environmental DNA, thereby addressing the problem of human contamination during environmental DNA detection. The above objective can be achieved through the following technical solutions: An inhibitor for eliminating environmental DNA contaminated by humans, the inhibitor comprising a human-specific blocking oligonucleotide having the sequence shown in SEQ ID No. 1.

[0005] Optionally, the human-specific blocking oligonucleotide in the blocking agent for eliminating environmental DNA contamination by humans is linked to a 3′-C3 spacer at its 3′ end.

[0006] A kit comprising the aforementioned blocking agent for eliminating environmental DNA contamination from humans.

[0007] A method for detecting environmental DNA to eliminate human pollution, comprising the following steps: The target nucleic acid to be detected in the sample is amplified using amplification primers. During the amplification process, the aforementioned blocking agent for eliminating human-contaminated environmental DNA is added to obtain the amplification product. The amplification products are then analyzed to obtain the detection results of the target nucleic acid in the sample.

[0008] Optionally, the final concentration of the blocking agent for eliminating human-contaminated environmental DNA in the amplification reaction system during the amplification process is 2~10 μM; Preferably, the final concentration of the blocking agent for eliminating human-contaminated environmental DNA in the amplification reaction system during the amplification process is 4 μM.

[0009] A method for detecting environmental DNA to eliminate human pollution, comprising the following steps: Step 1) Amplify the target nucleic acid in the sample using amplification primers to obtain the amplification product; Step 2) The RNP complex formed by combining CRISPR-Cas12a and crRNA is used to cleave the human nucleic acid sequence in the amplification product in vitro to obtain the cleaved amplification product; the CRISPR-Cas12a reagent contains: Cas12a protein and crRNA and a compatible reaction buffer. The crRNA includes crRNA1, crRNA2 and crRNA3; the sequence of crRNA1 is shown in SEQ ID No. 2, the sequence of crRNA2 is shown in SEQ ID No. 3 and the sequence of crRNA3 is shown in SEQ ID No. 4; Step 3) Detect the amplified products after cutting to obtain the detection results of the target nucleic acid in the sample.

[0010] Optionally, during the in vitro cleavage of the human-derived nucleic acid sequence in the amplification product using the RNP complex, the final concentration of crRNA is 10–50 nM; and the molar ratio of Cas12a protein:crRNA:substrate is 10–20:10–20:1. Here, the substrate refers to the DNA in the amplification product.

[0011] Optionally, in step one), the blocking agent for eliminating human-contaminated environmental DNA is added during the amplification process to obtain the amplification product.

[0012] Preferably, the amplification primers are general or specific primers used to amplify target sequences of the subclass Elasmobranchis.

[0013] Preferably, the forward primer for amplification is shown in SEQ ID No. 5, and the reverse primer is shown in SEQ ID No. 6.

[0014] Compared with the prior art, the present invention has the following outstanding advantages: This invention designs a human-specific blocking oligonucleotide. This blocking oligonucleotide, through specific hybridization with a human template during the amplification stage, blocks primer annealing and polymerase extension, making it difficult for human DNA to be amplified and significantly reducing human background reads in subsequent detection. Experimental verification of its effectiveness helps reduce human-derived DNA amplification products in eDNA samples, improves the accuracy of community interpretation, and reduces the burden of subsequent processing.

[0015] This invention also proposes a method for removing human-derived sequences in vitro after amplification. An RNP formed by CRISPR-Cas12a and crRNA specifically cleaves human-specific sites in the amplified product, thereby reducing the proportion of human fragments. The efficiency of the two methods used alone was compared and analyzed, and the synergistic or antagonistic effects of using the two methods simultaneously were verified. This reduces sequencing costs and bioinformatics analysis time costs without affecting the detection of the target biological group. The main purpose is to address human-derived DNA contamination in eDNA, and it can also be used to address human-derived DNA contamination events in similar molecular biology research and applications. Attached Figure Description

[0016] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0017] Figure 1 The gel electrophoresis results are presented as an image. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention. It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the present invention.

[0019] Furthermore, regarding the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention.

[0021] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0022] First, the present invention proposes an inhibitor for eliminating environmental DNA contaminated by humans, wherein the inhibitor is a human-specific blocking oligonucleotide, the sequence of which is shown in SEQ ID No. 1.

[0023] Optionally, the 3′ end of the human-specific blocking oligonucleotide is linked to a 3′-C3 spacer to block DNA polymerase elongation.

[0024] A kit comprising the aforementioned blocking agent for eliminating environmental DNA contamination from humans.

[0025] Optionally, the blocking agent is used in a method for detecting environmental DNA, comprising the following steps: The target nucleic acid to be detected in the sample is amplified using amplification primers. During the amplification process, the aforementioned blocking agent for eliminating human-contaminated environmental DNA is added to obtain the amplification product. The amplification products are then analyzed to obtain the detection results of the target nucleic acid in the sample.

[0026] Optionally, the final concentration of the blocking agent for eliminating human-contaminated environmental DNA in the amplification reaction system during the amplification process is 2~10 μM.

[0027] Preferably, the molar ratio of the blocking agent to each amplification primer is 5–20:1; Preferably, the concentration of the blocking agent for eliminating human contamination of environmental DNA in the amplification reaction system during the amplification process is 4 μM.

[0028] A method for detecting human-contaminated eDNA includes the following steps: The target nucleic acid to be detected in the sample is amplified using amplification primers to obtain amplification products; The human-derived nucleic acid sequence in the amplification product was cleaved in vitro using an RNP (ribonucleoprotein) complex formed by pre-complexing CRISPR-Cas12a protein and crRNA (guide RNA, gRNA) to obtain the cleaved amplification product. The amplified products after cleavage were detected to obtain the detection results of the target nucleic acid in the sample.

[0029] The CRISPR-Cas12a reagent contains: Cas12a protein, crRNA, and a compatible reaction buffer; The crRNA includes crRNA1, crRNA2 and crRNA3; the sequence of crRNA1 is shown in SEQ ID No. 2, the sequence of crRNA2 is shown in SEQ ID No. 3 and the sequence of crRNA3 is shown in SEQ ID No. 4.

[0030] Optionally, the final concentration of crRNA in the reaction system for cutting human DNA using CRISPR-Cas12a reagent is 10-50 nM, preferably about 30 nM.

[0031] Optionally, proteinase K is added after the in vitro cleavage reaction is completed to terminate and dissociate the complex.

[0032] Optionally, during the amplification process of the target nucleic acid to be detected in the sample using amplification primers, the aforementioned blocking oligonucleotide (non-crRNA) for eliminating human contamination of environmental DNA is added to inhibit the amplification of human DNA.

[0033] Optionally, the amplification primer is the universal primer Elas02 for target sequences in the subclass Elasmobranchis.

[0034] In the following examples I. Sampling and DNA Extraction Sampling location and area: Northern South China Sea, latitude and longitude range: 111.0-117.0°E, 18.5-22.0°N Extending approximately 240 nautical miles from the Pearl River Estuary into the open sea, to a depth of about 3,000 meters, and along the western coastal area of ​​Guangdong Province towards the eastern waters of Guangxi and Hainan, it extends for about 240 nautical miles.

[0035] Sampling time and quantity: Sampling will be conducted once per quarter in 2024. Four parallel samples will be taken from the surface and four from the bottom layer at each location.

[0036] Filtration and On-site Contamination Prevention: Upon returning to the ship's laboratory, a 2.5L seawater sample was filtered using a peristaltic pump fitted with a Sterivix (0.45 μm; Merck Millipore, UK) filter membrane. The filtration process was conducted in a clean environment, and all touchable surfaces and non-sterilizable consumables were disinfected using the standard procedure of 75% alcohol - 10% bleach - 75% alcohol. After filtration, the remaining liquid in the filter tube was drained, 0.3ml of ATL buffer was added, the tube was sealed, shaken well, and stored at -20°C. Simultaneously, negative controls of at least 10% of the total sample size were established, including field negative controls, extraction negative controls, and amplification negative controls. Environmental DNA sample extraction Extraction was performed under laboratory conditions. Prior to the experiment, the experimental environment was disinfected with a mixture of 75% ethanol, 10% bleach, and irradiated with ultraviolet light. All eDNA samples and blank controls were extracted using the DNeasy Blood & Tissue Kit (QIAGEN, Germany). DNA concentration was determined using quantitative PCR (Qubit) and then stored at -20 °C until DNA amplification.

[0037] Example 1 In this embodiment, a human DNA-specific blocker was designed. The design method was as follows: using the human mitochondrial 12S rRNA sequence as a template, the blocker was designed using CHOPCHOP v3 software.

[0038] The blocking agent sequence is: 5′-TGCCAGCCACCGCGGTCACACGATTAAC-3′, with a 3′-C3Spacer (i.e., a three-carbon spacer, which acts as a blocking group and cannot be extended) attached to its 3′ end.

[0039] This blocking agent specifically hybridizes with the human template during the PCR amplification stage, but is blocked at the 3′ end and not extended by polymerase, thus failing to serve as an amplification template, thereby effectively blocking the amplification of human-derived contaminant fragments in environmental DNA amplification systems.

[0040] Example 2 In this embodiment, the specific blocking agent obtained in Example 1 is used for the amplification and detection of DNA in the marine environment.

[0041] Reagents required for testing: (1) Reactive enzyme 2 × Taq Plus Master Mix Novozymes P211 (2) Primers: Elas02 amplification primers for the subclass Elasmobranchis. Primer-F: GTTGGTHAATCTCGTGCCAGC Primer-R: CATAGTAGGGTATCTAATCCTAGTTTG (3) Enzyme-free water: ddH2O.

[0042] (4) Human blocker, a specific blocker of human-specific fragments in contaminated DNA in Example 1.

[0043] (5) Dilute environmental DNA samples to 8-9 ng / μL, and perform 5 replicates for each sample.

[0044] The reaction system is shown in Table 1: Table 1

[0045] The PCR reaction cycle settings are shown in Table 2: Table 2

[0046] After amplification, parallel products from the samples were combined, and the amplified products were detected by electrophoresis. The combined amplified products were then washed with magnetic beads, followed by library preparation and sequencing.

[0047] Comparative Example 1: No human DNA-specific blocking agent was added during the amplification conditions without special treatment. 2.1.1 Reagents required for the experiment: (1) Reactive enzyme 2 × Taq Plus Master Mix Novozymes P211 (2) Primers: Elas02 amplification primers for the subclass Elasmobranchis. Primer-F: GTTGGTHAATCTCGTGCCAGC Primer-R: CATAGTAGGGTATCTAATCCTAGTTTG (3) Enzyme-free water: ddH2O (4) Dilute environmental DNA samples to 8-9 ng / μL, and perform 5 replicates for each sample.

[0048] 2.1.2 The reaction system is shown in Table 3: Table 3

[0049] 2.1.3 The PCR reaction cycle settings are shown in Table 4: Table 4

[0050] After PCR, the parallel products of the samples were combined, and the amplification products were detected by electrophoresis to observe the amplification results.

[0051] Example 3 In this embodiment, the amplification product from Comparative Example 1 was used to cut human DNA using CRISPR-Cas12a reagent; then it was sent for sequencing. The CRISPR-Cas12a reagent contains: Cas12a nuclease prepared from crRNA and proteinase K.

[0052] The crRNA sequence information design includes: The design method is as follows: using the human mitochondrial 12S rRNA sequence as a template, the online platform Cas-Designer (http: / / www.rgenome.net / cas-designer) was used for design. The design process combined the recognition characteristics of Cas12a for TTTV PAM sequences and sites with no significant off-target risk. This invention designed three crRNA sequences targeting different regions. Due to the frequent degradation and sequence variation of environmental DNA, a single crRNA may not be able to completely cleave all contaminant fragments. Through multi-site synergistic cleavage, a wider range of variation forms can be covered, enhancing the stability of contaminant removal and effectively blocking the replication of contaminant fragments during amplification, thereby achieving a more thorough and reliable human contaminant removal effect. The designed crRNA sequences were screened using the following method: the target enzyme was set as AsCpf1 (Cas12a), the PAM sequence was set as TTTV (V represents A / C / G), and a reference sequence was imported for crRNA site prediction. The screening criteria include: (1) PAM sequence is TTTV (V=A / C / G); (2) target sequence is highly specific and has a low off-target risk (assessed by Cas-OFFinder); (3) site sequence is stable and covers common areas of human contamination; (4) non-overlapping amplification primer regions.

[0053] As shown in Table 5, three 21nt highly specific target sequences were screened for blocking human gene contamination, with start positions of 884, 948, and 1038, respectively.

[0054] Table 5

[0055] Methods for processing human DNA using CRISPR-Cas12a reagents to cut amplified products include: Reagents required for processing: crRNA, CRISPR-Cas12a nuclease, dilution reagent, and proteinase K. Cas12a nuclease: EnGen lba Cas12a (CPF1) (NEB #M0653) 1 μM 70 pmol Diluent: 10X NEBuffer r2.1 reaction buffer (M0653S) Proteinase K: NEB #P8107 crRNA: A working concentration of 300 nM crRNA was prepared by diluting the stock solution with nuclease-free water on ice. The crRNA is a single-stranded crRNA required by the CRISPR-Cas12a system and can be obtained through in vitro chemical synthesis. Preferably, the crRNA used in this invention was designed and synthesized by Integrated DNA Technologies (IDT) based on the target sequence and purified by PAGE. Before use, the crRNA is dissolved in enzyme-free water and diluted to the recommended concentration, allowing it to directly complex with the CRISPR-Cas12a protein to form an RNP (ribonucleoprotein) complex for the recognition and cleavage of contaminating DNA targets.

[0056] DNA substrate: Using the product after mixing the amplified products with the library, the stock solution was diluted with nuclease-free water on ice to prepare 30 nM substrate DNA with a single target sequence.

[0057] (1) Assemble the reactants in the following order at room temperature. The components are shown in Table 6: Table 6

[0058] (2) Pre-incubate at 25°C for 10 minutes.

[0059] (3) Add 3 μL of 30 nM substrate DNA (final volume 30 μL).

[0060] (4) Mix thoroughly and centrifuge in a microcentrifuge.

[0061] (5) Incubate at 37°C for 10 minutes.

[0062] (6) Add 1 μL of proteinase K to each sample, mix thoroughly, and pulsate in a microcentrifuge.

[0063] (7) Incubate at room temperature for 10 minutes.

[0064] (8) Magnetic bead cleaning to remove short-segment cut fragments.

[0065] (9) Electrophoretic gel imaging was used to observe the cleaning results.

[0066] Example 4 In this embodiment, the amplification product from Example 2 above was used to cut human DNA using CRISPR-Cas12a reagent; then it was sent for sequencing. The CRISPR-Cas12a reagent contains: Cas12a nuclease prepared from crRNA and proteinase K.

[0067] The crRNA used and the specific steps for cutting human DNA were the same as in Example 3.

[0068] The test results of the examples and comparative examples are as follows: PCR amplification and subsequent library mixing and CRISPR-Cas12a editing were performed according to the conditions of the examples and comparative examples. The products were then subjected to gel electrophoresis for imaging. Using a UV imaging camera, equal volumes of samples were loaded and exposed to the same gel at the same time to obtain the desired results. Figure 1 As shown, from left to right: The first from the left: DNA marker - 50bp from Qingke Biotechnology, with the brightest band at 250bp.

[0069] Second from left: The group using CRISPR-Cas12a in combination with human blocker in Example 4, product concentration: 34.8 ng / μL.

[0070] Third from the left: Example 3, using CRISPR-Cas12a alone, product concentration: 55.3 ng / μL.

[0071] Fourth from the left: Example 2, using human blocker alone, product concentration: 19.7 ng / μL.

[0072] Fifth from the left: Comparative Example 1, amplification group under original conditions, product concentration: 9.8 ng / μL.

[0073] Sequencing and Quality Control: Raw reads (FASTQ) obtained from sequencing samples from all groups were processed using a standardized workflow: adapter removal and quality shearing (Q≥30), and aligned to human reference GRCh38 (containing mtDNA) and the target taxa reference library (a self-built database of Elasmobranchia species in the South China Sea). Only the unique aligned reads were retained for counting. Negative controls (field / extraction / amplification blanks) were used for background assessment during batch processing.

[0074] Indicator Calculation: Calculate the following separately: percentage of human reads (%Human), target retention (based on comparison 1), and removal efficiency.

[0075] The calculation results of the indicators are shown in Table 7: Compared to Example 1 (without any measures), the average percentage of human reads (%Human) was 93.8%, and the target retention rate was 100%. In Example 2, the percentage of human reads (%Human) was 26.8%, corresponding to a removal rate of 71.4% and a target retention rate of 105%. In Example 3, the percentage of human reads (%Human) was 10.4%, corresponding to a removal rate of 88.9% and a target retention rate of 125%. In Example 4, the percentage of human reads (%Human) was 16.8%, corresponding to a removal rate of 82.1% and a target retention rate of 115%.

[0076] Table 7

[0077] The results showed that Example 3, using CRISPR-Cas12a alone, achieved the best cleavage effect, reducing the proportion of human reads from 93.8% to 10.4% (Removal 88.9%) with a target retention of approximately 125%. Example 4, using CRISPR-Cas12a in combination with a human blocker, reduced the proportion of human reads to 16.8% with a target retention of approximately 115%. Example 2, using the human blocker alone, reduced the proportion of human reads to 26.8% with a target retention of approximately 105%. Finally, the control group (without any intervention) had a human read proportion of 93.8% (baseline, target retention 100%). Therefore, under the experimental conditions, Example 3 was superior to Example 4 in combination with the blocker alone; however, the combination showed no significant gain compared to using CRISPR-Cas12a alone.

[0078] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A blocking agent for eliminating environmental DNA contamination from humans, characterized in that, The blocking agent for eliminating environmental DNA contamination from humans comprises a human-specific blocking oligonucleotide, the sequence of which is shown in SEQ ID No.

1.

2. The blocking agent for eliminating environmental DNA contamination from humans according to claim 1, characterized in that, The human-specific blocking oligonucleotide in the inhibitor for eliminating environmental DNA contamination from humans is linked to a 3′-C3Spacer at its 3′ end.

3. A reagent kit, characterized in that, Contains an environmental DNA blocking agent for eliminating human pollution as described in claim 1 or 2.

4. A method for detecting environmental DNA to eliminate human pollution, characterized in that, Includes the following steps: The target nucleic acid to be detected in the sample is amplified using amplification primers. During the amplification process, the blocking agent for eliminating human contamination of environmental DNA as described in claim 1 or 2 is added to obtain the amplification product. The amplification products are then analyzed to obtain the detection results of the target nucleic acid in the sample.

5. The detection method according to claim 4, characterized in that, The final concentration of the blocking agent used to eliminate human-contaminated environmental DNA in the amplification reaction system during the amplification process is 2~10μM; Preferably, the final concentration of the blocking agent for eliminating human-contaminated environmental DNA in the amplification reaction system during the amplification process is 4 μM.

6. A method for detecting environmental DNA to eliminate human pollution, characterized in that, Includes the following steps: Step 1) Amplify the target nucleic acid in the sample using amplification primers to obtain the amplification product; Step 2) The RNP complex formed by combining CRISPR-Cas12a reagent and crRNA is used to cleave the human nucleic acid sequence in the amplification product in vitro to obtain the cleaved amplification product; the CRISPR-Cas12a reagent contains: Cas12a protein, crRNA and reaction buffer. The crRNA includes crRNA1, crRNA2 and crRNA3; the sequence of crRNA1 is shown in SEQ ID No. 2, the sequence of crRNA2 is shown in SEQ ID No. 3 and the sequence of crRNA3 is shown in SEQ ID No. 4; Step 3) Detect the amplified products after cutting to obtain the detection results of the target nucleic acid in the sample.

7. The method for detecting environmental DNA to eliminate human pollution according to claim 6, characterized in that, During the in vitro cleavage of the human-derived nucleic acid sequence in the amplified product using the RNP complex, the final concentration of crRNA is 10–50 nM; and the molar ratio of Cas12a protein:crRNA:substrate is 10–20:10–20:

1.

8. The method for detecting environmental DNA to eliminate human pollution according to claim 6, characterized in that, In step one), the blocking agent for eliminating human-contaminated environmental DNA is added during the amplification process to obtain the amplification product.

9. The method for detecting environmental DNA to eliminate human pollution according to any one of claims 4 to 8, characterized in that, The amplification primers are universal or specific primers used to amplify the target nucleic acid; Preferably, the amplification primers are general or specific primers used to amplify target sequences of the subclass Elasmobranchis.

10. The method for detecting environmental DNA to eliminate human pollution according to claim 9, characterized in that, The forward primer for amplification is shown in SEQ ID No. 5, and the reverse primer is shown in SEQ ID No. 6.

Images