Haplotype identification marker of rice flood-resistant gene ARF9 and application of haplotype identification marker

Abstract

The invention relates to the technical field of plant genetic engineering, and discloses a haplotype identification marker of a rice flood-resistant gene ARF9 and application of the haplotype identification marker. The molecular marker is derived from an exon of an ARF9 gene, is located at the 22009082bp and 22010019bp of a No.4 chromosome of rice, and has a basic group of C. The SNP molecular marker is related to the waterflooding resistance of a male parent oryza longistaminate of perennial rice, and the waterflooding resistance of the male parent oryza longistaminate with a locus genotype of CC is obviously higher than that of rice with a locus genotype of non-AA type. Therefore, the invention provides the loop-mediated isothermal amplification primer group for rapidly identifying the ARF9 gene haploid molecular marker, and the loop-mediated isothermal amplification primer group is used for identifying the ARF9 gene haploid molecular marker so as to rapidly screen out waterflooding-resistant rice. The invention provides a group of primers, the flood-resistant rice can be quickly identified by adopting the primers to perform loop isothermal reaction, the detection cost is low, the detection speed is high, the flood-resistant germplasm can be quickly screened in the rice seedling stage by adopting the method provided by the invention, a time-consuming flooding test does not need to be performed in the later stage, and the breeding process is greatly accelerated.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a rice flood-tolerant gene. ARF9 Haplotype identification markers and their applications. Background Technology

[0002] Rice is the staple food for more than half of the world's population, and 90% of the world's rice is produced and consumed in Asia. Currently, yield losses due to floods range from 10% to 100%, depending on the variety, duration of flooding, and agronomic management. There are three main rice cultivation methods: direct seeding, seedling raising and broadcasting, and seedling transplanting. Due to its high and stable yield advantages, rice seedling transplanting has become the main rice cultivation method in my country. However, in direct seeding systems, rapid and uniform germination and normal seedling development under flooded conditions are key to improving seedling vigor, effective nutrient absorption, and increasing yield.

[0003] To cultivate rice varieties suitable for direct seeding, such as rice grown in terraced fields, traditional methods for identifying flood-tolerant phenotypes require long-term flooding tests in the field, which are time-consuming and costly. Conventional molecular markers (such as SSR and SNP chips) rely on sophisticated instruments and have a testing cost of more than ¥5 per sample, which is difficult to meet the needs of efficient rice breeding. Currently, a rapid identification method for flood-tolerant markers is needed. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a rice flood-tolerant gene. ARF9 The haplotype identification marker and its application have the advantages of high efficiency and low cost, and solve the problem that the identification of rice flood tolerance phenotypes requires long-term field flooding tests, which are time-consuming and costly.

[0005] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a rice flood-resistant gene. ARF9 The haplotype molecular marker, which is derived from ARF9 The exons of the gene are located on chromosome 4 of rice at positions 22009082bp and 22010019bp, and the base is C.

[0006] Another objective of this invention is to provide rice flood-resistant genes. ARF9 Application of haplotype molecular markers in the identification of flood-resistant rice germplasm.

[0007] This invention is based on rice flood tolerance genes ARF9 The haplotype molecular markers were designed to obtain primer sets A and B for loop-mediated isothermal amplification; The sequence of primer set A is as follows: A-F3:TCTTGGTCTCTTGGTTGG.

[0008] A-B3:AGAAGGTGAAGCTGGAGG。

[0009] A-FIP:GGACGGACAATAGCCGAAGGGATTCTGTCCTGTAATTATTCGT。

[0010] A-BIP:ATAGAGTTTCACCATGGGAACTGGACGCTTATTCCTCCAATGGA。

[0011] A-LB:CATTGGATGCGAGTAATCCACAAC。

[0012] A-F2:GATTCTGTCCTGTAATTATTCGT。

[0013] A-F1c:GGACGGACAATAGCCGAAGG。

[0014] A-B2:ACGCTTATTCCTCAATGGA。

[0015] A-B1c:ATAGAGTTTCACCATGGGAACTGG。

[0016] I'm going to say: B-F3:TGCATTTATCTTCCTGAGGTA。

[0017] B-B3:AAGTCTCCTTACTCCAACC。

[0018] B-FIP:ATCCGCAACTAAATTGAGTCATGAGCACAATACTAAGCATGTAACTTGA。

[0019] B-BIP:TACAGTTATTACTGGTTTCTTCCGCGTAGCTCACCACTTTCGC。

[0020] B-LF:TGCAAGTGCACCTAATGCCT。

[0021] B-F2:CACAATACTAAGCATGTAACTTGA。

[0022] B-F1c:ATCCGCAACTAAATTGAGTCATGAG。

[0023] B-B2:GTAGCTCACCACTTTCGC。

[0024] B-B1c:TACAGTTATTACTGGTTTCTTCCGC.

[0025] Preferably, a method for identifying flood tolerance markers in rice includes the following steps: (1) Extract DNA from the rice to be tested.

[0026] (2) Loop-mediated isothermal amplification was performed using primers A and B respectively. After amplification, SYBR Green I dye was added to the product. According to the color development results, when the amplification results of both primers A and B are positive, the rice to be tested is flood-resistant rice.

[0027] Preferably, the conditions for loop-mediated isothermal amplification are an isothermal reaction at 60±1℃ for 25±1 min.

[0028] Preferably, the positive criterion is: after adding SYBR Green I dye, the product fluoresces under UV light or its color changes from orange to yellow.

[0029] Compared with existing technologies, this invention provides a rice flood-resistant gene. ARF9 The haplotype molecular markers and their applications have the following beneficial effects: (1) This invention discovers rice ARF9 Molecular markers of genes, said molecular markers are derived from ARF9 The exons of the gene are located on chromosome 4 of rice at 22009082bp and 22010019bp, with the base C. This invention further utilizes this molecular marker to design a specific loop-mediated isothermal amplification primer set, which can efficiently detect flood-resistant rice at an early stage, eliminating the need to wait for time-consuming flooding tests in the later stages, and greatly accelerating the breeding process.

[0030] (2) The present invention also features low cost and easy operation, and can more effectively solve industrial problems and create economic and social benefits. Attached Figure Description

[0031] Figure 1 for ARF9 cc haplotype and ARF9 Other haplotypes showed differences in coleoptile length under flooding.

[0032] Figure 2 This diagram illustrates the primer design principles and primer sites.

[0033] Figure 3 The results were used to identify the products of the ring isothermal reaction in rice.

[0034] Figure 4 This study aims to identify the phenotypes of rice tolerating flooding and to statistically analyze the germination and survival rates under flooding stress. Detailed Implementation

[0035] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] Example 1 By statistically analyzing the coleoptile lengths of 370 rice germplasm resources under floodwater conditions (see Table 1), and specifically for the CC haplotype (chromosome 4, bp 22009082 and 22010019, C base) or other haplotypes (chromosome 4, bp 22009082 and 22010019, non-C base) of the 370 accessions, it can be found that... ARF9 The average length of the coleoptile in the CC haplotype submerged was 1.38 cm. ARF9 The length of other haplotypes was 0.98 cm, and the difference was significant (p<0.01). ARF9 The CC haplotype is associated with the length of the coleoptile in flooded areas.

[0037] Table 1370 rice samples with coleoptile length and corresponding types under flooded conditions. Example 2 Primer design Primer design and reaction principle, such as Figure 2As shown in (a), each set of primers for the loop isothermal reaction includes two outer primers: F3 and B3, two inner primers: FIP and BIP (note that F1P=F1c+F2, BIP=B1c+B2), and one loop-leading primer: LOOP F or LOOP B. Figure 1 (b) indicates ARF9 Hap CC The design locations of the primer sites are shown in Figure 2, where AL represents the A LAMP primer set and BL represents the B LAMP primer set. Table 2 Primer Summary Example 3 The ring isothermal fluorescence identification of rice is not feasible because there are many varieties of rice. Therefore, this embodiment randomly selects 10 varieties of rice for experimental verification, including the following steps: (1) Extract DNA from the rice to be tested to obtain the genomic DNA to be tested; the steps are as follows: (a) Wash and dry the fresh plant tissue, and place about 2 cm of rice leaf, a steel ball and 1 mL of DNA extraction buffer in a 2 mL centrifuge tube. Each 1 mL of the DNA extraction buffer contains 12.1 g of Tris, 3.7 g of EDTA·2H2O, 58.5 g of NaCl and 24.6 g of CH3COONa.

[0038] (b) Shake it up and down quickly with your hands.

[0039] (c) Allow the sample obtained by crushing in step (b) to settle naturally, and transfer the supernatant to a new 1.5 mL centrifuge tube.

[0040] (d) Add 600 μL of anhydrous ethanol at -80℃ to the supernatant obtained in step (c), mix by inverting the mixture, centrifuge at 10000 rpm for 1 min, and carefully discard the supernatant.

[0041] (e) Add 1 mL of 70% ethanol to the centrifuge tube from step (d), carefully pour off the supernatant again, invert the centrifuge tube onto paper to absorb the liquid, and then put it in an oven to dry the liquid thoroughly.

[0042] (f) Add 100 mL of TE to the centrifuge tube, shake, centrifuge at 5000 rpm for 10 seconds, and transfer all the supernatant to a new centrifuge tube, which is the rice DNA.

[0043] (2) Establish a reaction system using the genomic DNA to be detected obtained in step (1), and perform loop isothermal amplification of the genomic DNA to be detected using the A primer set and B primer set of LAMP described in Example 2. The amplification system is shown in Table 3. After preparing the reaction system as shown in Table 2, react isothermally at 60°C for 25 min.

[0044] Table 3 (2) After the ring isothermal reaction, the product is observed with the naked eye or under ultraviolet light. A positive result is determined by colorimetric method (orange turning yellow indicates a positive result) or by fluorescence under UV exposure. For flood-resistant rice, the following conditions must be met: both primer groups A and B amplification products show positive results. Figure 3 As can be seen from (a), PR25, PR26 and Ol are double positive, and PR25, PR26 and Ol are candidate varieties of flood-tolerant rice.

[0045] (3) The product is subjected to 3% TBE agarose gel electrophoresis. If a ladder-shaped DNA band appears, it indicates a positive result. Figure 3 Table 4 in (b) shows that PR25, PR26 and Ol are double positive, and PR25, PR26 and Ol are candidate varieties for flood tolerance.

[0046] Table 4 Example 4 Flood tolerance assessment of rice The rice seeds used in Example 3 were germinated until they showed signs of germination, then cultured in a 15cm deep water layer. For each rice variety, 20 seeds were planted per plot, with three replicates. The temperature was 28 / 22℃, and the daytime was 12 hours. The number of surviving plants was counted after 21 days. Figure 4 As can be seen in (a), the survival rate of PR25 and PR26 is higher than that of other perennial rice varieties; in addition... Figure 4 The statistics in (b) also show that varieties PR25 and PR26 have a survival rate higher than 60%. This demonstrates the feasibility of this method in identifying rice's tolerance to flooding.

Claims

1. A haplotype marker for a rice gene ARF9 characterized by: The identification marker is from ARF9 Exon of gene, consisting of 2 SNP sites, SNP site information as follows: SNP1 is located at the genomic position of 22009082bp on chromosome 4 of rice, and the base at this position is C; SNP2 is located at the genomic position of 22010019bp on chromosome 4 of rice, and the base at this position is C.

2. A rice gene according to claim 1 ARF9 Use of the haploid identification marker in identifying flood-tolerant rice germplasm.

3. Use according to claim 2, characterized in that: The primer sequences used for identifying the submergence-tolerant rice germplasm include the A group primers and the B group primers; The A primer group sequences are as follows: A-F3: TCTTGGTCTCTTGGTTGG; A-B3: AGAAGGTGAAGCTGGAGG; A-FIP: GGACGGACAATAGCCGAAGGGATTCTGTCCTGTAATTATTCGT; A-BIP: ATAGAGTTTCACCATGGGAACTGGACGCTTATTCCTCAATGGA; A-LB: CATTGGATGCGAGTAATCCACAAC; A-F2: GATTCTGTCCTGTAATTATTCGT; A-F1c: GGACGGACAATAGCCGAAGG; A-B2: ACGCTTATTCCTCAATGGA; A-B1c: ATAGAGTTTCACCATGGGAACTGG; The B primer group sequences are as follows: B-F3: TGCATTTATCTTCCTGAGGTA; B-B3: AAGTCTCCTTACTCCAACC; B-FIP: ATCCGCAACTAAATTGAGTCATGAGCACAATACTAAGCATGTAACTTGA; B-BIP: TACAGTTATTACTGGTTTCTTCCGCGTAGCTCACCACTTTCGC; B-LF: TGCAAGTGCACCTAATGCCT; B-F2: CACAATACTAAGCATGTAACTTGA; B-F1c: ATCCGCAACTAAATTGAGTCATGAG; B-B2: GTAGCTCACCACTTTCGC; B-B1c: TACAGTTATTACTGGTTTCTTCCGC.

4. Use according to claim 2, characterized in that: Specifically comprising the following steps: (1) extracting the DNA of the rice to be detected; (2) respectively using the A group primers and the B group primers for loop-mediated isothermal amplification, and when the results of amplification with the A group primers and the B group primers are both positive, the rice to be detected is a submergence-tolerant rice.

Images