Rice seed dormancy gene OsPHS1 and application of encoding protein thereof
By cloning and regulating the rice seed dormancy gene OsPHS1, and using CRISPR/Cas9 technology to regulate rice seed dormancy, the problem of unclear regulation of rice seed dormancy has been solved, and precise regulation of seed dormancy has been achieved, thereby improving the stability of rice production and rice quality.
Patent Information
- Application Number
- CN202511944280.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-22
- Publication Date
- 2026-01-20
AI Technical Summary
The dormancy regulation mechanism of rice seeds is unclear in the existing technology, which leads to serious impacts on thousand-grain weight and rice quality due to panicle germination. Furthermore, both excessively strong and weak dormancy can cause agricultural losses.
By cloning and regulating the rice seed dormancy gene OsPHS1 and its encoded protein, CRISPR/Cas9 was used to knock out or overexpress the gene to regulate the dormancy of rice seeds, thus achieving precise regulation of seed dormancy.
It has achieved effective regulation of rice seed dormancy, enhancing or weakening its dormancy, ensuring normal rice emergence under different conditions and improving rice quality, thereby reducing agricultural losses.
Smart Images

Figure CN121362790A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant genetic engineering, in particular to a rice seed dormancy gene OsPHS1 and application of an encoded protein thereof. BACKGROUND
[0002] Research shows that panicle sprouting seriously affects the thousand-grain weight of rice, significantly reduces the thousand-grain weight, and leads to a decrease in the brown rice rate, milled rice rate and head milled rice rate, and reduces the transparency and gel consistency of rice. These changes impair the processing quality and cooking quality of rice.
[0003] Panicle sprouting is essentially a physiological phenomenon of seed germination without dormancy. In agricultural production, excessive seed dormancy can lead to low and uneven field emergence, which is not conducive to the promotion of direct seeding cultivation of rice, and can also cause weed problems in the next season. On the contrary, if the rice encounters high temperature and rainy weather during the grain filling and maturation period, panicle sprouting is likely to occur, which can seriously reduce the quality, seed quality and yield of rice, and cause significant agricultural losses. Therefore, it is urgent to analyze the mechanism of panicle sprouting of rice, reduce the panicle sprouting of rice and breed panicle sprouting-resistant rice varieties. At present, some rice seed dormancy genes have been reported, but the regulatory mechanism and network are not clear. Therefore, it is of great significance to mine more dormancy genes, analyze their functions and regulatory networks, and breed panicle sprouting-resistant varieties. SUMMARY
[0004] The technical problem to be solved by the present application is to provide a rice seed dormancy gene OsPHS1 and an encoded protein thereof capable of regulating the dormancy of rice seeds, and to develop applications thereof.
[0005] To solve the above technical problems, the present application adopts the following technical solutions:
[0006] The present application provides an application of a rice seed dormancy gene OsPHS1, wherein the gene is used to regulate the dormancy of rice seeds; the nucleotide sequence of the gene is shown in Seq ID No: 1, and the CDS sequence of the gene is shown in Seq ID No: 2.
[0007] Further, the panicle sprouting is regulated by regulating the dormancy of rice seeds.
[0008] Further, the dormancy of rice seeds is increased by overexpressing the gene.
[0009] Further, the dormancy of rice seeds is weakened by losing the function of the gene.
[0010] Further, the dormancy of rice seeds is weakened by losing the function of the gene through gene mutation or gene knockout.
[0011] Further, the gene knockout is carried out by using CRISPR / Cas9, and the knockout target sequence is shown as SEQ ID NO: 4 and SEQ ID NO: 5.
[0012] The application further provides application of a protein encoded by a rice seed dormancy gene OsPHS1, and the protein is used for regulating the dormancy of rice seeds; and the amino acid sequence of the protein is shown as Seq ID No: 3.
[0013] Further, the sprouting of the ear is regulated by regulating the dormancy of the rice seeds.
[0014] Further, the dormancy of the rice seeds is increased by increasing the expression level of the protein.
[0015] Further, the dormancy of the rice seeds is weakened by losing the function of the protein.
[0016] The application finds that the dormancy of the rice seeds is weakened by knocking out the gene or mutating the gene, and the dormancy of the rice seeds is increased to a certain extent by overexpressing OsPHS1 by cloning and identifying the rice seed dormancy gene OsPHS1, verifying the function, finding that the gene plays an important role in developing rice varieties with moderate dormancy, and the site and the encoded gene can be applied to plant genetic improvement to obtain varieties with moderate dormancy, and ensure that rice production and harvesting under different conditions are not or less affected. BRIEF DESCRIPTION OF DRAWINGS
[0017] The above is only a summary of the technical scheme of the application, in order to more clearly understand the technical means of the application, the application is further described in detail below in combination with the drawings and the specific embodiments.
[0018] Figure 1 is a comparison diagram of the germination of fresh wild-type NIP and mutant phs1 seeds, wherein (a) is a comparison diagram of the germination phenotype, and (b) is a comparison diagram of the germination rate;
[0019] Figure 2 is a fine mapping diagram of OsPHS1;
[0020] Figure 3 is a diagram of the position of the gene knockout target and the corresponding mutation type;
[0021] Figure 4 is an expression level identification diagram of overexpression materials;
[0022] Figure 5 is a germination diagram of different transgenic materials; wherein (a) is a comparison diagram of the germination phenotype, and (b) is a comparison diagram of the germination rate. DETAILED DESCRIPTION
[0023] Exemplary embodiments of the present application will be described in greater detail below with reference to the accompanying drawings. While exemplary embodiments of the present application are shown in the drawings, it is to be understood that the present application can be embodied in various forms without being limited by the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the present application to those skilled in the art.
[0024] Example 1, Map-based cloning of rice dormancy gene OsPHSl
[0025] 1) Rice (Oryza Sativa L) mutant phsl, original wild type material is japonica variety Nipponbare (NIP).
[0026] 2) Identification of rice seed dormancy
[0027] After the investigation of the heading and flowering period of phsl and NIP, the flowered panicles were marked in detail, and the seeds on the marked panicles were collected on the 35th day after flowering. 50 seeds were selected and evenly spread on a culture dish with two layers of filter paper, 10 ml of sterilized water was added, and the culture dish was placed in an incubator (constant temperature 30°C, humidity 95%, 12 hours of darkness, 12 hours of light). The germination was observed and recorded every day, and 3 replicates were set for each group. The germination rate of seeds was used to evaluate the strength of dormancy, and the standard for germination was that the radicle / embryo reached half the length of the seed. Figure 1 It can be seen that the germination rate of NIP is about 5%, and the germination rate of phsl is close to 100%. It shows that the dormancy of mutant phsl is significantly reduced.
[0028] 3) Genetic analysis and mapping population
[0029] The present application carries out genetic analysis on the phenotype of mutant phsl. 1000 fresh harvested and matured phsl / NIP hybrid F1 seeds were selected for germination test. According to the results of the germination test of mutant phsl and wild type NIP, the seeds germinated in the first 4 days were recorded as mutant phenotype, and the non-germinated seeds were recorded as wild type phenotype. The number of seeds germinated each day was counted, and finally there were 254 mutant phenotypes and 746 wild type phenotypes, with a segregation ratio close to 1:3, consistent with Mendelian inheritance law. In summary, the panicle germination trait is determined by a single recessive gene.
[0030] The mutant phsl and indica rice variety kasalath were selected for hybridization. The F1 generation produced by selfing was harvested to produce F2 population. Subsequently, the fresh harvested F2 seeds were subjected to germination test,
[0031] Seeds that germinated in the first 3 days of the germination experiment were used as the localization population. Approximately 1 gram of leaves from each plant were taken to extract total DNA for gene localization.
[0032] 4) Preliminary and fine mapping of the OsPHS1 gene
[0033] Location steps: First, using 512 pairs of SSR primers, polymorphism screening between parents was performed. The banding pattern from kasalath was recorded as "1", the banding pattern from NIP as "2", and the heterozygous banding pattern as "3". Then, 10 extreme plants that germinated 3 days before the germination test were selected, DNA was extracted, and PCR amplification was performed using polymorphic SSR primers. The results were analyzed by gel electrophoresis, and banding patterns were counted. The marker where all extreme plants showed a banding pattern of "2" was identified as the linkage position, ultimately locating the OsPHS1 gene on the short arm of chromosome 7. To further refine the location and expand the extreme population, polymorphic primers were selected to locate OsPHS1 between markers RM427 and RM3484. To further expand the population, 6 pairs of polymorphic markers were developed, locating OsPHS1 between ID2 and ID5, with a physical distance of 68.8 kb between the two markers. Figure 2 The marker primer sequences used for fine mapping are shown in Table 1. Analysis using the genome annotation website (http: / / rapdblegacy.dna.affrc.go.jp / ) predicted 15 ORFs within a 68.8 kb region (Table 2). Fragment amplification and sequencing of this region revealed a deletion of approximately 12 kb within this range in the mutant, containing ORF14 (LOC_Os07g07520). Sequence analysis showed that ORF14 encodes an F-box protein. Therefore, the deletion of the OsPHS1 gene is likely the cause of the reduced dormancy in the mutant. The nucleotide sequence of OsPHS1 in the wild type is shown in SEQ ID NO.1, its CDS sequence is shown in SEQ ID NO.2, and its protein amino acid sequence is shown in SEQ ID NO.3.
[0034] Table 1 Molecular markers used for fine localization
[0035]
[0036] Table 2. Gene products of 15 ORFs within the fine-mapping region.
[0037]
[0038] Example 2: Construction and dormancy identification of OsPHS1 complementary, knockout, and overexpression materials
[0039] 1) Construction of complementary carriers:
[0040] Binary expression vector pCAMBIA-2300 as a blank of complementary vector, double enzyme digestion of the vector using KpnI and XbaI, agarose electrophoresis after cutting gel recovery linearized vector. According to the OsPHS1 genomic sequence design PCR primers, pCAMBIA-2300-OsPHS1-F (SEQ ID NO. 22): ACGAATTCGAGCTCGGTACCACCCGGATACGATGCTAACGACG, pCAMBIA-2300-OsPHS1-R (SEQ ID NO. 23): GCAGGTCGACTCTAGACTGTAGTGCTGGGAGTGA, amplified fragment containing promoter and gene sequence, using high fidelity enzyme KOD with NIP DNA as template for PCR amplification, agarose electrophoresis after cutting gel recovery of the band. Then link - transformation - pick shake bacteria - extract plasmid sequencing.
[0041] 2) Construction of knock-out vector:
[0042] OsPHS1 genomic sequence was analyzed by CRISPRdirect website (http: / / crispr.dbcls.jp / ), target sites containing NGG (PAM) were selected, the specificity of the selected gRNA sequence was BLASTed in the rice genome through the Gramene website (http: / / www.gramene.org / ), and the influence of non-specific primers was excluded. The 20 bases upstream of the gRNA sequence were selected. Two targets were selected, Target 1 sequence (SEQ ID NO: 4) was (CCCCGTGGATGTGCTCGGGGAGG), and Target 2 sequence (SEQ ID NO: 5) was (TGGCCATCGCGGATGGCAAACGG). According to the CRISPR / Cas vector construction kit instructions (Baige Gene Technology Co., Ltd.), primers Cr-OsPHS1-1F / R (SEQ ID NO. 24: TGATTGCCCCGTGGATGTGCTCGGGG, SEQ ID NO. 25: AAACCCCCGAGCACATCCACGGGGCA), Cr-OsPHS1-2F / R (SEQ ID NO. 26: TGATTGTGGCCATCGCGGATGGCAAA, SEQ ID NO. 27: AAACTTTGCCATCCGCGATGGCCACA) were designed. Synthesize oligo dimer: mix 1 μL Target-F / R (10 μM) and 18 μL Buffer Aneal, respectively, 95°C constant temperature metal bath for 3 min, then slowly cool to 20°C. Then link - transformation - pick shake bacteria - extract plasmid sequencing.
[0043] 3) Construction of overexpression vector:
[0044] pRGV as overexpression vector empty, using Sac I and Hind III double enzyme digestion of the vector, agarose electrophoresis after cutting gel recovery linearization vector. According to the OsPHS1 gene CDS sequence design PCR primer, pRGV-OsPHS1-F (SEQ ID NO. 28): ATCCCCGGGTGAGCTCATGGCGGAGGAGCGGAGG, pRGV-OsPHS1-R (SEQ ID NO. 29): CCGCACTAGTAAGCTTTCACCAAACGGGGAACAGAG, the amplified product contains the complete coding region of the gene, the PCR product was recovered and purified. Then link - transformation - pick a spot shake bacteria - extraction plasmid sequencing.
[0045] 4) Agrobacterium transformation:
[0046] The pCAMBIA-2300-OsPHS1, pCRISPR-OsPHS1-1, pCRISPR-OsPHS1-2 and pRGV-OsPHS1 constructed by heat shock method into Agrobacterium (EHA105).
[0047] 5) Genetic transformation:
[0048] Agrobacterium-mediated genetic transformation was used, in which the EHA105 strain of pCAMBIA-2300-OsPHS1 vector was used to dip the mutant phs1 callus, and the EHA105 strain of pCRISPR-OsPHS1-1, pCRISPR-OsPHS1-2 and pRGV-OsPHS1 vector was used to dip the wild type NIP callus. Then, the callus was cultured on the selection medium, then pre-differentiation medium was used for culture, and finally the transgenic plants were obtained by culturing on the differentiation medium.
[0049] 6) Identification of transgenic plants:
[0050] DNA of the complementary transgenic T0 generation plants was extracted, a pair of primers Primer 1-F and Primer 1-R were designed at the sequence of OsPHS1 gene, with an amplification length of 575 bp, and the positive plants were selected as the plants with successful complementation, which were selected for further generations, and the homozygous stable complementary lines COM-1 and COM-2 were selected according to the PCR results, which were used for germination test. Sequencing primers were designed before and after Target 1 and Target 2 sequences, Primer 2-F and Primer 2-R were used to identify the knockout transgenic plants obtained by transforming pCRISPR-OsPHS1-1 vector strain, and 1 mutant homozygous line (CR-1) was selected for germination test. Primer 3-F and Primer 3-R were used to identify the knockout transgenic plants obtained by transforming pCRISPR-OsPHS1-2 vector strain, and 1 mutant homozygous line (CR-2) was selected for germination test. Two kinds of mutation methods are shown in Figure 3 Primer 4-F was designed at the sequence of pRGV vector, and Primer 4-R was designed at the CDS sequence of OsPHS1 gene, which was used to detect the overexpression transgenic plants obtained by transforming pRGV-OsPHS1 vector strain, with an amplification length of 747 bp, and the positive plants were selected as the plants with successful overexpression, which were selected for further generations, and the homozygous stable overexpression lines were selected according to the PCR results, and the expression amount was detected by q-RT (RT primers Primer 5-F and Primer 5-R), and finally OE-1 and OE-2 were selected for germination test Figure 4 ).
[0051] Table 3. List of primers
[0052]
[0053] 7) Phenotype identification
[0054] The heading and flowering period of NIP, phs1, complementary material (COM-1 and COM-2), knockout material (CR-1 and CR-2) and overexpression material (OE-1 and OE-2) was investigated, the flowering spikes were labeled, the seeds were collected 35 days after flowering, 50 seeds were selected and evenly scattered on the culture dish covered with two layers of filter paper, 10 ml sterilized water was added, and it was placed in the incubator (constant temperature 30℃, humidity 95%, 12 hours darkness, 12 hours light), and the germination was observed and recorded every day, and 3 replicates were set for each group. The standard of germination was that the radicle / embryo was more than half of the seeds, and the seed germination rate was used to evaluate the strength of dormancy. The germination rate was calculated by Figure 5As can be seen, the germination rate of NIP is about 10%, phsl is about 100%, COM-1 is about 12%, COM-2 is about 11%, CR-1 is about 95%, CR-2 is about 96%, OE-1 is about 2%, and OE-2 is about 2%. This shows that OsPHSl can indeed affect the dormancy of seeds.
[0055] The above merely illustrates the preferred embodiments of the present application, but is not intended to limit the present application in any form. Any simple modification, equivalent change or modification made by those skilled in the art based on the disclosed technical contents falls within the protection scope of the present application.
Claims
1. Use of a rice seed dormancy gene OsPHS1, characterized in that, The gene is used for regulating the dormancy of rice seeds; the nucleotide sequence of the gene is shown as Seq ID No: 1, and the CDS sequence of the gene is shown as Seq ID No:
2.
2. The use of the rice seed dormancy gene OsPHS1 according to claim 1, characterized in that, The spike sprouting is regulated by regulating the dormancy of rice seeds.
3. The use of the rice seed dormancy gene OsPHS1 according to claim 1, characterized in that, The dormancy of rice seeds is increased by overexpressing the gene.
4. The use of the rice seed dormancy gene OsPHS1 according to claim 1, characterized in that, The dormancy of rice seeds is weakened by loss-of-function of the gene.
5. The use of the rice seed dormancy gene OsPHS1 according to claim 4, characterized in that, The dormancy of rice seeds is weakened by loss-of-function of the gene through gene mutation or gene knockout.
6. The use of the rice seed dormancy gene OsPHS1 according to claim 5, characterized in that, Gene knockout is carried out by using CRISPR / Cas9, and the knockout target sequence is shown as SEQ ID NO: 4 and SEQ ID NO:
5.
7. Use of a protein encoded by a rice seed dormancy gene OsPHS1, characterized in that, The protein is used for regulating the dormancy of rice seeds; the amino acid sequence of the protein is shown as Seq ID No:
3. 8.The application of the encoded protein of the rice seed dormancy gene OsPHS1 according to claim 7, characterized in that, The spike sprouting is regulated by regulating the dormancy of rice seeds. 9.The application of the encoded protein of the rice seed dormancy gene OsPHS1 according to claim 7, characterized in that, The dormancy of rice seeds is increased by increasing the expression level of the protein. 10.The application of the encoded protein of the rice seed dormancy gene OsPHS1 according to claim 7, characterized in that, The dormancy of rice seeds is weakened by loss-of-function of the protein.
Citation Information
Patent Citations
Rice seed dormancy regulation gene OsMPK14 and application thereof
CN108047319A
Rice grain fatty acid regulation gene KCS18, protein coded by same and application of rice grain fatty acid regulation gene KCS18
CN118879660A
Oryza sativa-derived gene for enhancing resistance to pre-harvest sprouting, and use thereof
WO2018084522A1
Cited By
SNP (Single Nucleotide Polymorphism) molecular marker related to pre-harvest sprouting resistance character of rice, detection primer and application of SNP molecular marker
CN121915194A