A DNA enzyme triple helix molecular switch detection system suitable for personal blood glucose meter, and a preparation method and application thereof

By combining a DNA enzyme triple helix molecular switch with a home blood glucose meter, the problems of long detection time and insufficient sensitivity in existing food safety testing technologies have been solved, achieving rapid and accurate quantitative detection results.

CN121364301BActive Publication Date: 2026-03-31NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511947752.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-03-31
Estimated Expiration
2045-12-23

AI Technical Summary

Technical Problem

Existing food safety testing methods, such as HPLC-MS/MS, are time-consuming and costly, while enzyme-linked immunosorbent assays (ELISA) lack sufficient sensitivity and accuracy, making it difficult to meet the demand for rapid quantitative detection of harmful substances in food.

Method used

A triple-helix molecular switch for DNase was developed. The DNase forms a triple-helix structure by covalently coupling an aptamer with a magnetic bead. The Pb2+-assisted DNase cleaves the signal tag and is combined with a home blood glucose meter to detect changes in glucose concentration to achieve quantitative detection of the target analyte.

Benefits of technology

It enables rapid and accurate quantitative detection of harmful substances in food, simplifies the operation process, improves the repeatability and stability of detection, and is suitable for the detection of trace contaminants in complex food matrices.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121364301B_ABST
    Figure CN121364301B_ABST
Patent Text Reader

Abstract

The application provides a DNA enzyme triple helix molecular switch detection system suitable for a personal blood glucose meter, and a preparation method and application thereof, and belongs to the technical field of biosensors.The DNA enzyme triple helix molecular switch comprises an aptamer containing two nucleotide arm segments and DNA enzyme covalently coupled with a magnetic bead; the two nucleotide arm segments of the aptamer form a triple helix structure with the DNA enzyme; and the two nucleotide arm segments comprise a 5' end nucleotide sequence SEQ ID NO.1 of the aptamer and a 3' end nucleotide sequence SEQ ID NO.2 of the aptamer.The application uses a terminal fixation strategy to limit the flexibility of the original aptamer, stabilize the spatial conformation thereof, improve the affinity of the aptamer to the target, utilize the triple helix molecular switch containing the DNA enzyme and the nano-enzyme-gold nanoparticles, and realize accurate and sensitive detection of trace pollutants in food through determination of the reduction range of the glucose concentration in the detection liquid by using the household blood glucose meter.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biosensor technology, and particularly relates to a DNA enzyme triple helix molecular switch detection system adapted to personal blood glucose meters, its preparation method and application. Background Technology

[0002] Food safety hazards, such as ochratoxin A (OTA), are toxic metabolites mainly produced by Aspergillus fungi. OTA commonly contaminates grains and their products, such as corn, wheat, and oats, as well as agricultural products like coffee beans and raisins. OTA not only has strong nephrotoxicity—long-term intake of low doses can lead to renal tubular damage and renal failure—but also poses potential risks of carcinogenicity (especially kidney cancer), immunosuppression, and teratogenicity. Because it is colorless, odorless, and stable, it is difficult to completely destroy through conventional processing; therefore, effective detection in food and feed is crucial.

[0003] Currently, commonly used detection methods mainly include the following: High-performance liquid chromatography (HPLC), especially when combined with fluorescence detectors or mass spectrometry detectors (HPLC-MS / MS), is the most commonly used high-precision quantitative method in laboratories. However, it is time-consuming and costly, making it unsuitable for rapid screening of large batches of samples on-site. Enzyme-linked immunosorbent assay (ELISA) and colloidal gold immunochromatographic test strips serve as rapid on-site detection tools, but their sensitivity and accuracy are generally lower than HPLC, mainly providing qualitative or semi-quantitative rough results, which are difficult to meet the requirements of precise quantification.

[0004] Compared to antibodies, aptamers exhibit higher specificity and affinity for target molecules, are easier to obtain, can be synthesized rapidly and in large quantities in vitro, and have simpler preparation methods. They also allow for screening of different types of targets. Meanwhile, portable home blood glucose meters accurately measure blood glucose levels and are characterized by their small size, low cost, and ease of operation, making them essential medical devices for many families, providing accurate quantitative results. Therefore, developing an aptamer biosensor to enable portable blood glucose meters for the quantitative detection of non-glucose substances and other food safety hazards offers convenience for real-time home monitoring of toxins, pesticide residues, and other harmful substances in food, and has broad application prospects. Summary of the Invention

[0005] In view of this, one of the objectives of the present invention is to provide a DNA enzyme triple helix molecular switch.

[0006] The second objective of this invention is to provide a method for preparing the aforementioned DNA enzyme triple helix molecular switch.

[0007] A third objective of this invention is to provide the application of the DNA enzyme triple helix molecular switch or the preparation method in the preparation of products for detecting target analytes.

[0008] The fourth objective of this invention is to provide a reagent kit.

[0009] The fifth objective of this invention is to provide a method for detecting a target object.

[0010] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0011] A triple-helix molecular switch for DNA enzymes, the triple-helix molecular switch comprising an aptamer containing two nucleotide arms and a DNA enzyme covalently coupled to a magnetic bead; the two nucleotide arms of the aptamer and the DNA enzyme form a triple-helix structure; the two nucleotide arms include a nucleotide sequence SEQ ID NO.1 located at the 5' end of the aptamer and a nucleotide sequence SEQ ID NO.2 located at the 3' end of the aptamer.

[0012] Preferably, the nucleotide sequence of the DNA enzyme is shown in SEQ ID NO.3.

[0013] Preferably, the aptamer includes an aptamer targeting a specific substance, wherein the specific substance includes ochratoxin A.

[0014] This invention also provides a method for preparing the aforementioned DNAase triple helix molecular switch, comprising the following steps:

[0015] An aptamer containing two nucleotide arms was activated to obtain an activated aptamer; the activated aptamer was added to a DNase covalently coupled to magnetic beads, and then a mixture was added for incubation; the concentration of the aptamer was 50-250 nM; the mixture was 20 mM PBS containing 0-10 mM Mg 2+ pH 7.2.

[0016] The present invention also provides the application of the DNA enzyme triple helix molecular switch or the preparation method in the preparation of products for detecting target analytes, wherein the target analytes are aptamer-targeted analytes.

[0017] The present invention also provides a kit comprising the DNase triple helix molecular switch and SingleDNA labeled with magnetic beads and gold nanoparticles at both ends, respectively; the SingleDNA contains DNase-specific recognition sites.

[0018] The present invention also provides a method for detecting a target object, wherein the target object is an aptamer-targeted target object, and the detection is performed using the aforementioned kit, comprising the following steps:

[0019] The supernatant was removed by magnetic separation of the DNase triple helix molecular switch, 300 μL of the test solution was added, and after incubation at room temperature, the supernatant was removed by magnetic separation. After washing, 300 μL of PBS buffer was added to obtain reaction solution A.

[0020] Single DNA labeled with magnetic beads and gold nanoparticles at both ends was magnetically separated to remove the supernatant, mixed with reaction solution A, and Pb was added. 2+ After reacting for 10-50 minutes, the supernatant is collected by magnetic separation.

[0021] Add glucose solution to the supernatant, react at room temperature for 10-30 minutes, and then use a blood glucose meter to test.

[0022] Preferably, the incubation time at room temperature is 30-60 minutes.

[0023] Preferred, Pb 2+ The concentration is 2~10mM.

[0024] Preferably, the concentration of the glucose solution is 30 mM, and the volume ratio of the supernatant to the glucose solution is 1:2.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] This invention provides a triple-helix molecular switch for DNase, which uses a terminal fixation strategy to restrict the flexibility of the original aptamer, stabilize its spatial conformation, and thus improve the affinity of the aptamer for the target. The triple-helix molecular switch provided by this invention can be used to detect target analytes. After the target analyte specifically binds to the aptamer, the triple-helix molecular switch releases DNase. A solution containing DNase is added to a SingleDNA detection solution with magnetic beads and gold nanoparticles labeled at both ends, respectively, along with the coenzyme ion Pb. 2+ Pb 2+ The dependent DNase replaces the natural enzyme to cleave the signal tag specific site (rA) after target recognition. AuNPs are cleaved and released. The free AuNPs are separated and mixed with glucose solution. The change in glucose concentration is detected by a blood glucose meter. The higher the concentration of the target substance in the detection system, the greater the decrease in glucose concentration. The quantitative detection of the target substance is achieved based on the change in glucose concentration. Attached Figure Description

[0027] Figure 1 This is a schematic diagram of the triple helix molecular switch structure of DNAase;

[0028] Figure 2 TEM images of Au NPs;

[0029] Figure 3 Particle size distribution of Au NPs;

[0030] Figure 4 Here is the UV-Vis absorption spectrum of Au NPs;

[0031] Figure 5This is a graph showing the enzyme activity assay of Au NPs;

[0032] Figure 6 The working curve of the detection method;

[0033] Figure 7 This is a feasibility analysis diagram;

[0034] Figure 8 The graph shows the changes in the detected signal; the left graph shows the detection results for the Blank group, and the right graph shows the detection results for the A11-DNAzyme-OTA-SD-Au group.

[0035] Figure 9 This is an agarose gel electrophoresis image of a triple helix structure; where A represents OTA aptamers with different arm lengths, D represents DNase, + indicates presence, and - indicates absence; the lanes from left to right are the gel electrophoresis results for Marker, OTA aptamers without arms, A7, A7+DNase, A9, A9+DNase, A11, A11+DNase, A13, A13+DNase, A15, and A15+DNase;

[0036] Figure 10 The results represent the optimized conditions; where A represents the effect of the suitable concentration on the detection results; and B represents the effect of Mg concentration. 2+ Effect of concentration on results; C is Pb 2+ The effect of concentration on the results; D represents the effect of DNase cleavage time of MB-SingleDNA-Au on the results;

[0037] Figure 11 For the accuracy of the detection method;

[0038] Figure 12 To ensure the stability of the detection method;

[0039] Figure 13 To ensure the specificity of the detection method;

[0040] Figure 14 This refers to the actual sample testing for the detection method. Detailed Implementation

[0041] This invention provides a DNase triple helix molecular switch, the triple helix molecular switch comprising an aptamer containing two nucleotide arms and a DNase covalently coupled to a magnetic bead; the two nucleotide arms of the aptamer and the DNase form a triple helix structure; the two nucleotide arms include the 5' nucleotide sequence SEQ ID NO.1: GCTCGGAGAAG of the aptamer, and the 3' nucleotide sequence SEQ ID NO.2: GAAGAGGCTCG of the aptamer.

[0042] In this invention, the nucleotide sequence of the DNA enzyme is shown in SEQ ID NO.3: CATCTcttctccgagccggtCGAAATAGTGAGT, where lowercase letters represent sequences complementary to the aptamer arm.

[0043] In this invention, the aptamer includes an aptamer targeting a specific substance, which includes ochratoxin A. The nucleotide sequence of the aptamer targeting ochratoxin A, containing two nucleotide arms, is shown in SEQ ID NO.4: GCTCGGAGAAGGATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAGAAGAGGCTCG. This invention, by changing the aptamer for different hazards in the triple-helix molecular switch, can achieve the detection of various hazards, including toxins, pesticides, veterinary drugs, and heavy metals.

[0044] This invention also provides a method for preparing the DNase triple helix molecular switch, comprising the following steps: activating an aptamer containing two nucleotide arms to obtain an activated aptamer; adding the activated aptamer to a DNase covalently coupled to magnetic beads, and then adding a mixing solution for incubation; the concentration of the aptamer is 50-250 nM; the mixing solution is 20 mM PBS containing 0-10 mM Mg 2+ pH 7.2. As one feasible approach, Mg in specific embodiments of the present invention... 2+ The source is magnesium chloride hexahydrate.

[0045] In the method for preparing a triple-helix molecular switch for DNase of the present invention, the aptamer activation is preferably performed at 95 °C for 10 min; the aptamer concentration is preferably 50-250 nM, more preferably 100-250 nM, and even more preferably 200 nM. The present invention has found that the aptamer concentration directly affects the number and stability of the triple-helix structure, and the aptamer concentration provided by the present invention contributes to the formation of the triple-helix structure. The Mg in the mixture described in the present invention... 2+ The concentration is preferably 0-10 mM, more preferably 2.5-10 mM, and even more preferably 5 mM; when the aptamer is mixed with the DNase, the Mg content in the solution is... 2+ A positively charged environment was provided for the formation of the triple helix, and a suitable concentration of Mg... 2+ It will promote the formation of triple helix structures.

[0046] The present invention also provides the application of the DNA enzyme triple helix molecular switch or the preparation method in the preparation of products for detecting target analytes, wherein the target analytes are aptamer-targeted analytes.

[0047] The present invention also provides a kit comprising the DNase triple helix molecular switch and SingleDNA labeled with magnetic beads and gold nanoparticles at both ends, respectively; the SingleDNA contains DNase-specific recognition sites.

[0048] In this invention, the nucleotide sequence of the SingleDNA is NH2-ACTCACTAT / rA / GGAAGAGATG-SH, that is, the 5' segment of the nucleotide sequence 5'-ACTCACTATGGAAGAGATG-3' shown in SEQ ID NO.5 is modified with NH2, the 3' end is modified with SH, and the DNase-specific recognition site rA is modified between the 9th and 10th bases of the nucleotide sequence shown in SEQ ID NO.5.

[0049] This invention also provides a method for detecting a target analyte, wherein the target analyte is an aptamer-targeted analyte, and the detection is performed using the aforementioned kit, comprising the following steps: magnetic separation of a triple-helix DNase molecule to remove the supernatant, adding 300 μL of test solution, incubating at room temperature, magnetic separation to remove the supernatant, washing, and adding 300 μL of PBS buffer to obtain reaction solution A; magnetic separation of SingleDNA labeled with magnetic beads and gold nanoparticles at both ends to remove the supernatant, mixing with reaction solution A, and adding Pb... 2+ After reacting for 10-50 minutes, the supernatant is obtained by magnetic separation. Glucose solution is added to the supernatant, and the mixture is reacted at room temperature for 10-30 minutes before being tested using a blood glucose meter.

[0050] In the method for detecting the target analyte of this invention, the incubation time at room temperature is preferably 30-60 min, more preferably 40-50 min; this invention releases DNase by competitively binding the target analyte to the aptamer during room temperature incubation. (Pb is added.) 2+ The subsequent reaction is preferably carried out for 20–45 min, and more preferably for 40 min. Pb 2+ The preferred concentration is 2-10 mM, more preferably 4-8 mM, and even more preferably 6 mM; This invention has found that Pb... 2+ It has an auxiliary effect on DNase cleavage of single DNA, and the Pb in this invention is used. 2+ The concentration can promote DNase cleavage of single DNA. The glucose solution concentration is preferably 30 mM, and the volume ratio of supernatant to glucose solution is preferably 1:2. As one possible implementation, Pb in a specific embodiment of the present invention... 2+ The source is lead nitrate.

[0051] In the detection method provided by this invention, the specific binding of the target analyte to the aptamer triggers the release of DNase via a triple helix molecular switch. A solution containing DNase is added to a SingleDNA detection solution with magnetic beads and gold nanoparticles labeled at both ends, respectively. Simultaneously, coenzyme ions Pb are added. 2+ Pb 2+ A DNase-dependent enzyme, replacing the natural enzyme, cleaves the signal tag-specific site (rA) after target recognition. AuNPs are released, and the free AuNPs are separated and mixed with a glucose solution. The mixed AuNPs possess glucose oxidase activity, catalyzing the degradation of some glucose. The accurate concentration of remaining glucose is detected using a blood glucose meter. The higher the concentration of the target analyte in the detection system, the more aptamers bind to it, the more triple-helix molecular switches are consumed, and the more DNase is released. This results in more AuNPs generated after recognizing and cleaving Au-Single DNA, and a greater decrease in glucose concentration. Therefore, quantitative detection of the target analyte can be achieved based on changes in glucose concentration.

[0052] This invention rationally utilizes a triple-helix molecular switch containing DNase and nanozyme-gold nanoparticles to accurately measure the decrease in glucose concentration in the test solution using a home blood glucose meter. This enables the accurate and sensitive detection of trace contaminants in complex food matrices, avoiding the complex work and techniques required by previous blood glucose meter technologies, such as coupling glucose oxidase or plotting working curves for instrument calibration. This simplifies the operation and greatly improves the repeatability and stability of the detection, ensuring the accuracy of the test results and showing great promise for practical applications.

[0053] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0054] Example 1

[0055] A triple helix molecular switch for DNA enzymes.

[0056] In this embodiment, the aptamer is an aptamer that targets ochratoxin A.

[0057] The nucleotide sequence of the aptamer targeting ochratoxin A (denoted as A11) containing two nucleotide arms is shown in SEQ ID NO.4: GCTCGGAGAAGGATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAGAAGAGGCTCG.

[0058] The nucleotide sequence of the DNA enzyme is shown in SEQ ID NO.3: CATCTcttctccgagccggtCGAAATAGTGAGT.

[0059] The preparation method is as follows:

[0060] 1. Activation of carboxyl groups on the surface of magnetic beads:

[0061] Take 100 μL of Mag-COOH (300nm, 10mg / mL, surface carboxyl content ≥70 μM / g) magnetic beads into a 1 mL centrifuge tube, remove the supernatant by magnetic separation, wash twice with 200 μL of MEST solution (100 mM MES, pH 5.0, containing 0.05% Tween 20), and then remove the supernatant; quickly add 100 μL of freshly prepared EDC solution (10 mg / mL, using the above MEST solution as a dispersant) and 100 μL of NHS (10 mg / mL, using the above MEST solution as a dispersant) to the centrifuge tube containing the magnetic beads, vortex to fully suspend the magnetic beads, activate at 25 ℃ for 30 min, during which time keep the magnetic beads in suspension (you can use a vertical mixer to invert and mix).

[0062] 2. Covalent coupling of magnetic beads (MB) with DNase:

[0063] The supernatant was removed by magnetic separation, and 300 μL of 200 nM DNase was added. The mixture was coupled at 25 °C for 2 h. After coupling, the supernatant was removed by magnetic separation, and the magnetic beads were resuspended in 200 μL of PBS solution (0.1M, pH 7.2, containing 1% BSA). The mixture was reacted at 25 °C for 1 h to block the unreacted activated carboxyl groups on the surface of the magnetic beads. After blocking, the beads were washed, and the MB-DNase was refloated in PBS solution (20 mM PBS, pH 7.2).

[0064] 3. Construction of the DNAse triple helix molecular switch (THMS):

[0065] MB-DNAase was magnetically separated to remove the supernatant, and 300 μL of 200 nM A11 was added (activated at 95 °C for 10 min, then cooled at 4 °C for 20 min). A11 and MB-DNAase were then dissolved in PBS (20 mM PBS containing 5 mM Mg). 2+ The mixture was thoroughly mixed in PBS (pH 7.2) and incubated at 37°C for 1.5 h to form THMS (MB-DNAase-A11). The resulting solution was magnetically separated to remove the supernatant, washed, and resuspended in PBS (20 mM PBS, pH 7.2) to obtain the DNAase triple-helix molecular switch. The structure of the obtained DNAase triple-helix molecular switch is shown below. Figure 1 As shown.

[0066] Example 2

[0067] A reagent kit.

[0068] The kit in this embodiment includes the DNA enzyme triple helix molecular switch of Example 1, and also includes SingleDNA labeled with magnetic beads and gold nanoparticles at both ends.

[0069] The nucleotide sequence of the single DNA is NH2-ACTCACTAT / rA / GGAAGAGATG-SH.

[0070] The preparation method of SingleDNA labeled with magnetic beads and gold nanoparticles at both ends is as follows:

[0071] 1. Preparation of AuNPs:

[0072] Before preparing AuNPs, all glassware was cleaned with freshly prepared aqua regia solution (1:3 HNO3 / HCl) and rinsed with water. 1 mL of 1% (w / w) HAuCl4 solution was added to 95 mL of distilled water and heated to boiling with stirring. Then, 1% (w / w) Na3C6H5O7·2H2O was rapidly added; under vigorous stirring, the solution changed from pale yellow to wine red. The wine red solution was boiled again for 15 min, cooled to room temperature, and stored in a refrigerator (4°C) for later use.

[0073] 2. Characterization of AuNPs:

[0074] The morphology of AuNPs was observed using transmission electron microscopy (TEM). Figure 2 ) and particle size distribution ( Figure 3 AuNPs were uniformly dispersed in a spherical shape. The average size of the AuNPs was measured to be 26 nm. A local surface plasmon resonance peak (λ) was observed in the AuNPs solution at 520 nm. max () Figure 4 ).

[0075] 3. Assay of glucose oxidase activity in AuNPs:

[0076] To determine the glucose oxidase activity of AuNPs nanozymes, Fe was used to... 3+ The gluconic acid and H2O2 produced by glucose oxidation were verified using the hydroxylamine method and the HRP / TMB colorimetric method. The results are as follows: Figure 4 As shown, gluconic acid can react with hydroxylamine and Fe. 3 + The reaction forms a red complex, thus significantly enhancing absorbance. Similarly, when TMB and HRP coexist, the characteristic peak of oxTMB appears at 652 nm, indicating the presence of H2O2 in the glucose-catalyzed reaction using AuNPs. Figure 5 ).

[0077] 4. Activation of carboxyl groups on the surface of magnetic beads:

[0078] Take 100 μL of Mag COOH (300nm, 10mg / mL, surface carboxyl content ≥70 μM / g) magnetic beads into a 1 mL centrifuge tube, remove the supernatant by magnetic separation, wash twice with 200 μL of MEST solution (100 mM MES, pH 5.0, containing 0.05% Tween 20), and then remove the supernatant; quickly add 100 μL of freshly prepared EDC solution (10 mg / mL, using the above MEST solution as a dispersant) and 100 μL of NHS (10 mg / mL, using the above MEST solution as a dispersant) to the centrifuge tube containing the magnetic beads, vortex to fully suspend the magnetic beads, activate at 25 ℃ for 30 min, during which time keep the magnetic beads in suspension (you can use a vertical mixer to invert and mix).

[0079] 5. Covalent coupling of magnetic beads (MB) with SingleDNA:

[0080] After removing the supernatant by magnetic separation, 300 μL of 200 nM SingleDNA was added and coupled at 25 °C for 2 h. After coupling, the supernatant was removed by magnetic separation, and the magnetic beads were resuspended in 200 μL of PBS solution (pH 7.2, containing 1% BSA). The mixture was reacted at 25 °C for 1 h to block the unreacted activated carboxyl groups on the surface of the magnetic beads. After blocking, the beads were washed and reduced at room temperature for 30 min by adding TCEP (10 mM). After reduction, the beads were washed and the MB-SingleDNA was refloated in 300 μL of PBS solution (20 mM PBS, pH 7.2) for later use.

[0081] 6. MB-SingleDNA conjugation with AuNPs:

[0082] Take the AuNPs solution and adjust the pH to 8.5. Take 2 mL of the pH 8.5 AuNPs solution and centrifuge (10000 rpm, 15 min). After centrifugation, discard the supernatant. Then add 400 μL of ultrapure water to each tube and mix well to obtain a concentrated AuNPs solution. Take 1 mL of the concentrated AuNPs solution and add it to TCEP-activated MB-SingleDNA, followed by aging with NaCl (2 M) solution. Repeat the salt aging process until the sodium chloride concentration in the system reaches 50 mM (use a syringe to add 2M NaCl dropwise until the concentration reaches 50 mM). Then mix and let stand for 8 h to allow the MB-SingleDNA and AuNPs to fully couple (volume ratio MB-SingleDNA:AuNPs = 1:2). After coupling, magnetically separate to remove the supernatant, wash, and store in PBS (20 mM PBS, pH 7.2).

[0083] Example 3

[0084] A method for detecting a target object.

[0085] In this embodiment, the target substance is ochratoxin A, which is detected using the kit from Example 2. The detection method is as follows:

[0086] The DNase triple helix molecule was magnetically separated to remove the supernatant, and 300 μL of the test solution was added. The reaction was carried out at room temperature for 40 min, and the supernatant was removed by magnetic separation. The mixture was washed and added to PBS (20 mM PBS, pH 7.2) for storage to obtain reaction solution A.

[0087] SingleDNA labeled with magnetic beads and gold nanoparticles at both ends was magnetically separated, and the supernatant was removed. The DNA was then mixed with reaction solution A, and 6 mM Pb was added. 2+ The reaction was carried out for 40 min, and the DNase cleaved MB-SingleDNA-Au. The supernatant was magnetically separated and glucose solution (30 mM glucose solution concentration, volume ratio of supernatant to glucose solution 1:2) was added to the supernatant. The mixture was stirred at room temperature for 30 min until homogeneous, and then the blood glucose was measured with a blood glucose meter.

[0088] The method constructed in this embodiment was used to detect different concentrations of OTA (0, 0.01, 0.02, 0.05, 0.1, 0.25, 0.5, 1, 2.5, 5, 10, 25, 50 ng / mL) within the concentration range of 0–50 ng / mL. A working curve was established by fitting the data to a four-parameter logistic regression model (4-PL) (Formula 1). Figure 6 ).

[0089] Y=A+(DA) / (1+(X / C)^B) (Formula 1);

[0090] In the formula, A and D represent the lower asymptote and the upper asymptote, respectively; C and B represent the inflection point concentration and the Hill slope, respectively; X represents the OTA concentration in the sample; and Y represents the glucometer response value.

[0091] The fitting results show that the 4-PL model has a high goodness of fit, with a coefficient of determination R0. 2 The value was 0.98. Within the range of 0.01–0.1 ng / mL, the OTA concentration showed a linear relationship with the blood glucose meter detection signal, y = -8.306x + 7.416, R0. 2 0.99 or higher ( Figure 6 (Illustration in the image), the detection limit for OTA is 0.09 ng / mL.

[0092] Example 4

[0093] Validation and optimization of detection methods.

[0094] 1. Verify the feasibility of the test.

[0095] Blank: 30mM glucose solution, to be tested directly using a blood glucose meter;

[0096] SD-Au: The Single DNA labeled with magnetic beads and gold nanoparticles at both ends in Example 3 was magnetically separated, the supernatant was removed, and it was mixed with a single DNase and 6 mM Pb was added. 2+ The reaction was carried out for 40 min. The supernatant was magnetically separated and glucose solution (30 mM glucose solution concentration, volume ratio of supernatant to glucose solution of 1:2) was added to the supernatant. After mixing well, the blood glucose was measured with a blood glucose meter.

[0097] A11-DNAzyme-SD-Au: The test solution was detected using the method in Example 3. The test solution was 300 μL PBS (20 mM PBS, pH 7.2).

[0098] A11-DNAzyme-OTA-SD-Au: The test solution was detected using the method in Example 3. The test solution was 300 μL of OTA solution (10 ng / mL).

[0099] The results are as follows Figure 7 and Figure 8 As shown, in the SD-Au group, because the DNase did not form a triple helix structure, its shearing ability was the strongest, resulting in the largest amount of Au being sheared off and the smallest amount of Au remaining, thus yielding the lowest detection result. In the A11-DNAzyme-SD-Au group, because a triple helix structure was formed, the DNase's shearing ability was inhibited. Since the test solution did not contain OTA specifically binding to the aptamer, the DNase was not released, resulting in the smallest amount of Au sheared off, or even none at all, and the largest amount of Au remaining, thus yielding a detection result comparable to Blank. In the A11-DNAzyme-OTA-SD-Au group, OTA specifically bound to the aptamer, opening the triple helix structure and releasing the DNase. This resulted in the largest amount of Au sheared off and the smallest amount of Au remaining, thus yielding a detection result comparable to Single-Au. This indicates that Single-DNA-Au alone has the strongest catalytic ability, resulting in the lowest detected glucose concentration in the system. When a triple helix structure is formed, the DNase's ability to shear Single-DNA-Au is inhibited, resulting in the highest detected glucose concentration in the system. When OTA is added, the triple helix molecular switch opens, the exposed DNase cleaves single DNA-Au, and the released Au catalyzes glucose, causing a signal change.

[0100] 2. The effect of aptamer arm length on triple helix structure.

[0101] The difference between this embodiment and Embodiment 1 is that the ochratoxin A aptamer sequence is shown in Table 1.

[0102] Table 1 Nucleotide Sequences

[0103]

[0104] Note: Lowercase letters represent the nucleotide sequences of the two arms of the aptamer.

[0105] The formation of THMS was verified by agarose gel electrophoresis. The results are as follows: Figure 9 As shown, a stable triplet is formed only when the arm length exceeds 11 base pairs. Compared with A11 or the DNase component, the electrophoretic migration rate of the triplet complex is significantly delayed. Therefore, A11 was chosen for subsequent experiments.

[0106] 3. The effect of aptamer concentration on the results during the preparation of triple helix structures.

[0107] The preparation method in Example 1 was adopted, except that the aptamer concentrations were set to 0, 50, 100, 200, and 250 nM respectively to prepare different triple helix structures. The kits were different from those used in Example 2, which used SingleDNA labeled with magnetic beads and gold nanoparticles at both ends. The method in Example 3 was used to detect PBS (20 mM PBS, pH 7.2).

[0108] The results are as follows Figure 10 As shown in Figure A, the higher the concentration of A11, the more triple helix structures are formed, the fewer DNases are exposed, the fewer AuNPs are cleaved, the less glucose is catalyzed, the more glucose remains, and the higher the blood glucose meter reading. At an A11 concentration of 200 nM, the most triple helix structures are formed, resulting in the highest reading.

[0109] 4. Mg during the preparation of the triple helix structure 2+ The effect of concentration on the results.

[0110] The preparation method described in Example 1 is adopted, except that: Mg is prepared separately. 2+ Different triple helix structures were prepared at concentrations of 0, 2.5, 5, 7.5, and 10 mM. These were used to prepare different kits from the SingleDNA with magnetic beads and gold nanoparticles labeled at both ends in Example 2. The PBS (20 mM PBS, pH 7.2) was tested using the method described in Example 3.

[0111] The results are as follows Figure 10 As shown in B, Mg 2+ A positively charged environment was provided for the formation of the triple helix, and a suitable concentration of Mg... 2+It promotes the formation of triple helix structures; when preparing triple helix molecular switches, adding Mg to the system will promote the formation of triple helix structures. 2+ Magnesium chloride hexahydrate, prepared by separation, contains different concentrations of Mg 2+ The triple-helix molecular switch, when the test solution does not contain OTA, results in a higher concentration of magnesium ions, leading to more triple-helix structures, fewer exposed DNases, fewer cleaved AuNPs, less catalyzed glucose, more remaining glucose, and higher blood glucose meter readings. Mg 2+ At a concentration of 5 mM, the triple helix structure is most abundant, and the detection result value is the highest.

[0112] 5. During Pb detection 2+ The effect of concentration on the results.

[0113] The method described in Example 3 was used to detect 10 ng / mL OTA standard, the difference being that Pb was added at concentrations of 2, 4, 6, 8, and 10 mM respectively during the detection. 2+ .

[0114] The results are as follows Figure 10 As shown in C, after OTA binds to the aptamer, the DNase is separated and exposed, and the Pb in the detection system is then analyzed. 2+ The higher the concentration of Pb, the better the effect of DNase cleavage, the more AuNPs are cleaved, the more glucose is catalyzed, the less uncatalyzed glucose remains in the solution, and the lower the detected value of the blood glucose meter. 2+ When the concentration was 6 mM, the detection result was the lowest, and the result remained basically unchanged as time increased.

[0115] 6. The effect of the time for DNase to cleave MB-SingleDNA-Au on the results.

[0116] The method described in Example 3 was used to detect 10 ng / mL OTA standard, the difference being that Pb was added. 2+ After reacting for 10, 20, 30, 40 and 50 min respectively, the supernatant was magnetically separated for subsequent reactions.

[0117] The results are as follows Figure 10 As shown in D, after OTA binds to the aptamer, the exposed DNase is separated and placed in Pb. 2+ Under assisted shearing conditions, the longer the shearing time, the more AuNPs are sheared off, the more glucose is catalyzed, the less uncatalyzed glucose remains in the solution, and the lower the blood glucose meter reading. The lowest reading is obtained after 40 minutes of shearing, and the result remains essentially unchanged over time.

[0118] Example 5

[0119] Detection accuracy and stability.

[0120] The kit from Example 2 and the method from Example 3 were used for detection.

[0121] 1. Repeatability:

[0122] Repeat the test of 10 ng / mL OTA standard solution 5 times and calculate the RSD value of the 5 results: RSD = (standard deviation SD / arithmetic mean X) × 100%.

[0123] The results of the 5 tests are as follows Figure 11 As shown, the RSD value of the five test results was 1.41%, indicating that the constructed detection method has good accuracy.

[0124] 2. Stability:

[0125] The kit from Example 2 was stored at 4°C for 5 days, and the 10 ng / mL OTA standard solution was tested once daily. The test results were compared over 5 consecutive days. Figure 12 The results show that the detection intensity remains relatively stable as the storage time increases, indicating that the constructed sensor has high stability.

[0126] 3. Specificity:

[0127] To verify the specificity of the detection method, ACE, IMD, and Pb were selected. 2+ CPF and CRB were used as interfering substances for specific analysis, and ACE, IMD, and Pb were also analyzed. 2+ CPF and CRB were mixed with OTA to prepare the test solution, so that ACE, IMD, and Pb in the test solution were reduced. 2 + The concentrations of CPF and CRB were 50 ng / mL, and the concentration of OTA was 10 ng / mL.

[0128] The results are as follows Figure 13 As shown, when other interfering toxins coexist with OTA (10 ng / mL) at a concentration of 50 ng / mL, their signal response is not significantly different from the detection signal when OTA exists alone. Therefore, this strategy has excellent specificity for the target analyte and is helpful for the determination of OTA in complex real-world samples.

[0129] 4. Accuracy:

[0130] To evaluate the effectiveness and practicality of this method, a spiked recovery test was conducted on actual samples of OTA. Corn was thoroughly pulverized, and 5 g of the pulverized sample was mixed with 10 mL of methanol-water solution (Vmethanol:Vwater = 7:3). The mixture was vortexed for 15 min, then allowed to stand for 5 min, and centrifuged three times (6000 rpm, 10 min) to obtain the original sample solution, which was stored at 4 ℃. HPLC was used to verify that the original sample solution did not contain OTA. The original sample solution was diluted 5-fold, and different concentrations (0, 0.01, 0.02, 0.05, 0.1, 0.25, 0.5, 1, 2.5, 5, 10, 25, 50 ng / mL) of OTA standard were added to obtain actual samples, which were then analyzed. The results are as follows: Figure 14 As shown, corn, a crop easily contaminated by OTA, was selected as the actual sample. The spiked recovery rate was between 90.40% and 103.00%, indicating that the established method is less affected by matrix effects and can be applied to the detection of OTA in food in daily life, showing broad application prospects.

[0131] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method of detecting a target object, the method comprising: The target object is an object targeted by an aptamer, and a DNA enzyme triple helix molecular switch and a Single DNA labeled with a magnetic bead and a gold nanoparticle at two ends are used for detection, the Single DNA containing a DNA enzyme specific recognition site; the method comprises the following steps: The DNA enzyme triple helix molecular switch is removed by magnetic separation, 300 muL of a to-be-detected solution is added, and after incubation at room temperature, the supernatant is removed by magnetic separation, 300 muL of PBS buffer is added after washing, and reaction solution A is obtained; The supernatant of SingleDNA magnetic separation marked with magnetic beads and gold nanoparticles at both ends was removed, mixed with reaction solution A, and Pb 2+ After 10-50 min of post-reaction, the supernatant was removed by magnetic separation; Glucose solution is added to the supernatant, and after reaction at room temperature for 10-30 min, a blood glucose meter is used for detection; The triple helix molecular switch comprises an aptamer containing two nucleotide arm segments and a DNA enzyme covalently coupled with a magnetic bead; the two nucleotide arm segments of the aptamer form a triple helix structure with the DNA enzyme; the two nucleotide arm segments comprise a 5' end nucleotide sequence SEQ ID NO. 1 of the aptamer and a 3' end nucleotide sequence SEQ ID NO. 2 of the aptamer.

2. The method of claim 1, wherein, The nucleotide sequence of the DNA enzyme is shown as SEQ ID NO.

3.

3. The method of claim 1, wherein, The aptamer comprises an aptamer targeting a target object, and the target object comprises ochratoxin A.

4. The method of claim 1, wherein, The preparation method of the DNA enzyme triple helix molecular switch comprises the following steps: The aptamer containing two nucleotide arm segments is activated to obtain an activated aptamer; the activated aptamer is added to DNAzyme covalently coupled with magnetic beads, and a mixed solution is further added for incubation; the concentration of the aptamer is 50-250 nM; the mixed solution is 20 mM PBS containing 0-10 mM Mg 2+ , pH 7.

2.

5. The method of claim 1, wherein, The incubation time at room temperature is 30-60 min.

6. The method of claim 1, wherein, Pb 2+ at a concentration of 2-10 mM.

7. The method of claim 1, wherein, The concentration of the glucose solution is 30 mM, and the volume ratio of the supernatant to the glucose solution is 1:2.