OsHSL1 protein mutant and application thereof in improving herbicide resistance of plants
By enhancing the herbicide degradation activity of the OsHSL1 protein through specific amino acid mutants, the problem of rice sensitivity to mesotrione was solved, and high resistance of plants to triketone herbicides was achieved, which has important application value.
Patent Information
- Application Number
- CN202511382538.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2026-01-23
AI Technical Summary
In the existing technology, rice is sensitive to the triketone herbicide mesotrione, which causes serious damage. The existing OsHSL1 protein mutant has insufficient herbicide degradation activity and cannot meet the production needs.
OsHSL1 protein mutants are provided, and their herbicide-degrading activity is enhanced by specific mutations in the amino acid sequence (such as F140H and Q255P, L90M, F140H, L204F and F298L). The corresponding gene mutants are used to express OsHSL1 protein mutants and to cultivate plants with high herbicide resistance.
The activity of the OsHSL1 protein mutant is increased by more than 2.4 times, which significantly improves the plant's resistance to triketone herbicides and allows for the cultivation of herbicide-tolerant plant varieties.
Smart Images

Figure CN121379998A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, and particularly relates to an OsHSL1 protein mutant and application thereof in improving herbicide resistance of plants. BACKGROUND
[0002] HPPD inhibitor herbicides are mainly divided into isoxazolone, triketone, pyrazolone and other chemical structural types. At present, the main listed varieties of triketone herbicides are sulcotrione, mesotrione, benzobicylon, tembotrione and tefuryltrione. Among them, mesotrione has the advantages of wide weed spectrum, high activity, small dosage, good environmental compatibility, low toxicity to mammals and aquatic organisms, high safety to corn and no phytotoxicity to subsequent crops, and has good application prospect. However, this kind of herbicide often causes serious damage to rice - many important rice varieties are susceptible to this kind of herbicide, and after spraying, leaf whitening and even death and other adverse phenomena occur, which leads to the fact that HPPD inhibitors cannot be widely used in many rice varieties.
[0003] The rice gene HIS1 (HPPD inhibitor sensitive gene 1) encodes a Fe(II) / 2-ketoglutarate-dependent oxygenase, which removes the inhibition of triketone herbicides by catalyzing the hydroxylation of triketone herbicides. Experiments show that HIS1 can catalyze the hydroxylation of the above-mentioned five kinds of triketone herbicides. Current research has made some progress on OsHSL1, restoring its metabolic activity against mesotrione to a level similar to HIS1, but it still cannot meet the production needs. SUMMARY
[0004] In order to solve the problems existing in the prior art, the present application provides an OsHSL1 protein mutant and application thereof in improving herbicide resistance of plants. The OsHSL1 protein mutant has high activity in degrading herbicides and can be used for cultivating plants with high herbicide resistance.
[0005] In the first aspect, the present application provides an OsHSL1 protein mutant, and the amino acid sequence of the OsHSL1 protein mutant is based on the amino acid sequence of the OsHSL1 protein and comprises any one or more of the following mutations: (1) F140H and Q255P; (2) L90M, F140H, L204F and F298L.
[0006] The OsHSL1 protein mutant provided by the application is more than 2.4 times higher than its mutation base (OsHSL1-1MT and OsHSL1-3MT), and can be applied to herbicide degradation, and can also be used for cultivating high herbicide-resistant plant varieties, and has important application value.
[0007] Further, the amino acid sequence of the OsHSL1 protein includes any one of the following: i) the amino acid sequence shown in SEQ ID NO. 1; ii) an amino acid sequence with the same function obtained by adding, replacing or deleting one or more amino acids from the amino acid sequence shown in SEQ ID NO. 1.
[0008] The amino acid sequence shown in SEQ ID NO. 1: MADESWRTPAIVQELAAAGVEEPPSRYVLGEKDRSDELVAAELPEPIPVVDLSRLAGADEAAKLRAALQNWGFFLLTNHGVETSLMDDVLNLAREFFNQPIERKRKFSNLIDGKNFQVEGYGTDRVVTQDQILDWSDRLFLRVEPKEERNLAFWPDHPESFRDVLNEYASRTKRIRDDIVQAMSKLLGLDEDYFFDRLNKAPALARFNYYPPCPRPDLVFGVRPHSDGSLFTILLVDEDVGGLQIQRDGKWYNVQVTPNTLLINLGDTMEVLCNGIFRSPVHRVVTNAERERISLAMFYSVNDEKDIGPAAGLLDENRPARYRKVSVGEFRAGIIGKFSRRERYIDSLKI*.
[0009] The amino acid sequence after mutation is as follows (OsHSL1-HP): MADESWRTPAIVQELAAAGVEEPPSRYVLGEKDRSDELVAAELPEPIPVVDLSRLAGADEAAKLRAALQNWGFFLLTNHGVETSLMDDVLNLAREFFNQPIERKRKFSNLIDGKNFQVEGYGTDRVVTQDQILDWSDRLHLRVEPKEERNLAFWPDHPESFRDVLNEYASRTKRIRDDIVQAMSKLLGLDEDYFFDRLNKAPALARFNYYPPCPRPDLVFGVRPHSDGSLFTILLVDEDVGGLQIQRDGKWYNVPVTPNTLLINLGDTMEVLCNGIFRSPVHRVVTNAERERISLAMFYSVNDEKDIGPAAGLLDENRPARYRKVSVGEFRAGIIGKFSRRERYIDSLKI*.
[0010] The mutated amino acid sequence is as follows (OsHSL1-HFLM): MADESWRTPAIVQELAAAGVEEPPSRYVLGEKDRSDELVAAELPEPIPVVDLSRLAGADEAAKLRAALQNWGFFLLTNHGVETSLMDDVMNLAREFFNQPIERKRKFSNLIDGKNFQVEGYGTDRVVTQDQILDWSDRLHLRVEPKEERNLAFWPDHPESFRDVLNEYASRTKRIRDDIVQAMSKLLGLDEDYFFDRLNKAPAFARFNYYPPCPRPDLVFGVRPHSDGSLFTILLVDEDVGGLQIQRDGKWYNVQVTPNTLLINLGDTMEVLCNGIFRSPVHRVVTNAERERISLAMLYSVNDEKDIGPAAGLLDENRPARYRKVSVGEFRAGIIGKFSRRERYIDSLKI*.
[0011] In a second aspect, the present application provides a gene mutant, which is used for encoding the aforementioned OsHSL1 protein mutant.
[0012] Further, the nucleotide sequence of the gene mutant comprises any one or more of the following: i) the nucleotide sequence as shown in SEQ ID NO. 2; ii) the complement sequence of the nucleotide sequence as shown in SEQ ID NO. 2; iii) a nucleotide sequence which is able to encode the same functional protein as the nucleotide sequence shown as SEQ ID NO. 2, obtained by adding, replacing or deleting one or more nucleotides.
[0013] a nucleotide sequence shown as SEQ ID NO. 2:
[0014] The nucleotide sequence after mutation is as follows (OsHSLl-HP):
[0015] The nucleotide sequence after mutation is as follows (OsHSLl-HFLM):
[0016] In a third aspect, the present application provides a biological material, which comprises the aforementioned gene mutant; and the biological material is an expression cassette, a vector, a transgenic cell or a recombinant virus particle.
[0017] In a fourth aspect, the present application provides a kit, which comprises the aforementioned OsHSL1 protein mutant, or the aforementioned gene mutant, or the aforementioned biological material.
[0018] In a fifth aspect, the present application provides a herbicide degrading agent, which comprises the aforementioned OsHSL1 protein mutant.
[0019] In a sixth aspect, the present application provides the use of the aforementioned OsHSL1 protein mutant, or the aforementioned gene mutant, or the aforementioned biological material, or the aforementioned kit in any one of the following: (1) degrading herbicide; (2) improving herbicide resistance of plants; (3) cultivating transgenic plants; (4) improving germplasm of plants.
[0020] Further, the herbicide is a triketone herbicide, preferably one or more of sulcotrione, mesotrione, bicyclopyrone, benzobicylon or pyrasulfotole; and / or, The plant is Arabidopsis or Oryza.
[0021] Further, the (2) comprises: i) expressing the aforementioned OsHSL1 protein mutant, or the aforementioned gene mutant, in cells of a plant; ii) crossing the plant obtained in i) with a wild type plant.
[0022] The present application has the following advantages: The present application has obtained a new OsHSL1 protein mutant, which has an activity of about 2.4 times that of the original mutant, as determined by enzyme activity and kinetic parameters; and the OsHSL1-HFLM has an activity of about 2.82 times that of the original mutant, as determined by enzyme activity and kinetic parameters.
[0023] The OsHSL1 protein mutant provided by the present application can confer herbicide resistance to target plants, and the protein mutant and the encoding gene can be used to cultivate plants with high herbicide resistance, which has a great application prospect in the cultivation of new varieties of herbicide-resistant plants. BRIEF DESCRIPTION OF DRAWINGS
[0024] In order to more clearly illustrate the technical solutions of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows. Obviously, the drawings described below are some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.
[0025] Figure 1 is the crude enzyme test result of the OsHSL1 mutant provided in Embodiment 3 of the present application.
[0026] Figure 2 is the HPLC activity verification result of the L90M, Q255P mutant based on OsHSL1-3MT provided in Embodiment 3 of the present application.
[0027] Figure 3 is the SDS-PAGE analysis result of OsHSL1-3MT and its mutants provided in Embodiment 3 of the present application; wherein, M: Marker; Lane 1: OsHSL1-3MT; Lane 2: OsHSL1-HFLM; Lane 3: OsHSL1-HFLP(F140H / L204F / F298L / L90M).
[0028] Figure 4 is the SDS-PAGE analysis result of OsHSL1-1MT and its mutants provided in Embodiment 3 of the present application; wherein, M: Marker; Lane 1: OsHSL1-1MT; Lane 2: OsHSL1-HM(F140H / L90M); Lane 3: OsHSL1-HP.
[0029] Figure 5 is the kcat(mes) kinetic curve of the OsHSL1 mutant provided in Embodiment 3 of the present application.
[0030] Figure 6 is the test result of T2 generation transgenic Arabidopsis thaliana mesotrione resistance provided in Embodiment 4 of the present application.
[0031] Figure 7 is the test result of T0 generation transgenic rice (Zhonghua 11) mesotrione resistance provided in Embodiment 4 of the present application. DETAILED DESCRIPTION
[0032] In order to make the objects, technical solutions and advantages of the present application more clear, the technical solutions in the present application will be clearly and completely described as follows. Obviously, the described embodiments are some embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.
[0033] The experimental methods involved in the following examples, if not specifically mentioned, are conventional methods in the art, for example, refer to the experimental manual in the art, or according to the conditions suggested by the manufacturer's instructions.
[0034] The experimental materials and reagents involved in the following examples, if not specifically mentioned, can be obtained from commercial channels.
[0035] Example 1 OsHSL1 and mutant expression vector construction OsHSL1 gene was cloned from Ming 63, reverse transcribed into cDNA and amplified, fused with GST tag, cloned into pET-28a vector, constructed recombinant plasmid and electrotransformed into E. coli DE3 (BL21) for expression. The specific process is as follows: 1. Primer: Table 1 OsHSL1 mutant primer information - first part
[0036] Table 2 OsHSL1 mutant primer information - second part
[0037] PCR amplification was performed using pET-28a-GST-OsHSL1 plasmid. The obtained PCR product was added to restriction endonuclease Dpn I and digested at 37℃ for 1-2 h to remove the template, and the digestion product was recovered using a direct recovery kit (omega). The electrotransformed into E. coli expression host cells E. coli DE3 (BL21) to obtain E. coli DE3 strains containing various recombinant plasmids.
[0038] The specific PCR reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 51℃ annealing for 30 sec, 72℃ extension for 3 min 5 sec, a total of 32 cycles; 25℃ incubation for 5 min.
[0039] The specific PCR reaction system (50 μL) is as follows: 4 μL dNTPs (2.5 mM), 10 μL 5×FastPfu Buffer, 1 μL of forward and reverse primers, 1 μL of template, 1 μL of FastPfu DNA polymerase (5 U / µL), and H2O to 50 μL.
[0040] The specific Dpn I digestion reaction system (50 μL) is as follows: 5 μL 10X QuickCut Buffer, 1 μg DNA, 1 μL QuickCut Dpn I, and H2O to 50 μL.
[0041] Example 2 Expression of mesotrione-degrading gene protein The E. coli DE3 strain containing the recombinant plasmid prepared in Example 1 was streaked on a LB plate containing 25 μg / mL kanamycin and incubated overnight, inoculated into 10 mL of LB liquid medium containing 25 μg / mL kanamycin, and cultured at 180 rpm and 37°C overnight.
[0042] The culture was transferred to a large triangular flask containing 500 mL of LB liquid medium at an inoculation amount of 1%, and cultured at 37°C for about 4.5 h. When the OD 600 reached 0.6, isopropyl β-D-thiogalactoside (IPTG) was added to a final concentration of 0.1 mmol / L, and induced at 18°C and 180 rpm for 16 h.
[0043] After induction, the bacteria were collected by centrifugation at 7000 rpm for 5 min, washed with pre-cooled Hepes buffer (pH = 7.0), centrifuged to remove the supernatant, washed twice, resuspended in 100 mL of fresh Hepes buffer, and then broken by a low-temperature high-pressure disruptor. The cell lysate was collected and centrifuged at 16000 rpm and 4°C for 20 min. The supernatant was collected and subjected to Ni column affinity chromatography purification. After washing, 1 mL of Hepes buffer containing 100 μL of 3C protease was added, and the enzyme was cut for 16-24 h to completely remove the GST tag of the fusion protein and release the target protein without the tag.
[0044] SDS-PAGE electrophoresis detection showed that each mutant successfully purified the target protein, which was about 39.9 kDa, consistent with the predicted value.
[0045] Example 3 Determination of mesotrione degradation effect In this example, the purified enzyme was used to detect the degradation effect of the target protein on mesotrione, including: The absorption peak of mesotrione was detected by high performance liquid chromatography. The chromatographic column was an Agilent C18 reverse phase chromatographic column, the mobile phase was acetonitrile: water = 50:50, the flow rate was 1 mL / min, and after the mobile phase was configured, it was filtered with a 0.22 μm filter paper and degassed with an ultrasonic instrument for 20 min.
[0046] In this example, the enzyme activity was determined by detecting the decrease in the amount of substrate. The decrease in the amount of substrate after reaction was determined by HPLC under the same reaction conditions with different concentrations of substrate.
[0047] In the embodiment, the preparation method of the mesotrione standard curve comprises: using mesotrione standard, respectively configuring mesotrione standard solutions with concentrations of 0.05 mM, 0.1 mM, 0.2 mM, 0.5 mM, 0.75 mM, 1 mM and 1.5 mM, detecting the peak area of the absorption peak at 286 nm by high performance liquid chromatography according to the foregoing conditions, and drawing a standard curve thereof.
[0048] In the embodiment, the enzyme kinetic parameter determination reaction system is as follows: 0.27 μM purified protein, (0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.75 mM, 1 mM) mesotrione, FeSO4 10 mM, α-ketoglutaric acid 60 mM, and the rest is supplemented with Hepes buffer solution. The prepared system is reacted at 30°C for 40 min, and then inactivated at 85°C for 4 min (three parallel controls are set for each group). The degradation activity is detected by HPLC, the reduction amount of mesotrione is quantified, and the K m (Michaelis constant) and V max (maximum reaction rate) are calculated by software Graphpad Prism 6, and then the catalytic constant k cat is calculated by substituting the protein concentration.
[0049] The results are as follows: After detection, the crude enzyme test results of the OsHSL1 mutant are as shown in Figure 1 . The HPLC activity verification results of the L90M, Q255P mutant based on OsHSL1-3MT are as shown in Figure 2 .
[0050] Finally, according to the prediction results of the mutation sites of OsHSL1, excellent mutants, namely OsHSL1-HP (OsHSL1-F140H-Q255P) and OsHSL1-HFLM (OsHSL1-L90M / F140H / L204F / F298L) are found. The SDS-PAGE results of the two mutants are as shown in Figure 3 and Figure 4 . The k cat(mes) kinetic curve is as shown in Figure 5 .
[0051] The enzyme kinetic parameter determination results are as shown in the following table. As can be seen from the table, the K m of OsHSL1-HP is 0.2 mM, the k cat is 7.47 min -1 , the k cat / K m is 37.99 mM / min -1Compared with the reported OsHSL1-1MT (OsHSL1-F140H), the affinity is significantly improved, and the relative catalytic activity is increased by about 2.4 times.
[0052] K m of 0.28 mM, k cat of 9.86 min -1 , k cat / K m of 34.86 mM / min -1 Compared with the reported OsHSL1-3MT (OsHSL1-F140H / L204F / F298L), the affinity is improved, and the relative catalytic activity is increased by about 2.82 times.
[0053] Table 3 Kinetic parameters of OsHSL1-HFLM and OsHSL1-HP
[0054] Example 4 Construction of sHSL1-HP gene plant expression vector and verification of transformed plant In order to analyze the mesotrione resistance of OsHSL1-HP gene in plants, the transgenic Arabidopsis containing OsHSL1-HP and Flag tag was constructed by using pCAMBIA2306 vector, Arabidopsis Col-0 as the receptor, and by flower infection method, and the specific process was as follows: (I) Construction of transgenic vector.
[0055] 1. Preparation of pCAMBIA2306 vector and amplified OsHSL1-HP.
[0056] The pCAMBIA2306 / E. coli DH5α was streaked from the glycerol tube stored at -80°C, and single colonies were picked for liquid culture, and the plasmid was extracted and stored for standby. According to the sequence information of pCAMBIA2306, Kpn I and Sal I enzyme cutting sites were selected.
[0057] 2. Amplification of target genes OsHSL1-1MT and OsHSL1-HP.
[0058] PCR amplification was performed with plasmid pET28a-GST-OsHSL1-HP, pET28a-GST-OsHSL1-1MT as templates, and the primers used were 2306-HSL1-F (ACGCGTCGACTCAGATCTTCAGGGAGAGTCG), 2306-HSL1-R (GGGGTACCATGGCTGACGAGTCATGG). The PCR reaction conditions were as follows: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 sec, 52 ℃ annealing for 30 sec, 72 ℃ extension for 40 sec; 34 cycles; 72 ℃ extension for 10 min, 25 ℃ preservation for 5 min, and then termination.
[0059] 3. The PCR product was separated by agarose gel electrophoresis, and the template gene amplification product was recovered by using a gel recovery kit.
[0060] The electrophoresis completed gel block was placed under a UV lamp, the target band was cut and transferred to a 1.5 mL centrifuge tube, 100 μL XP2 Binding Buffer was added to each 100 mg gel block, and the gel was completely melted in a 55 ℃ water bath. The gel solution was added to a 2 mL adsorption tube and centrifuged at 4 ℃ and 12000 r / min for 1 min, 600 μL eluent was added and centrifuged for 1 min, 600 μL eluent was added and centrifuged for 1 min, the buffer was discarded and centrifuged for 2 min, and then the DNA was eluted and collected by adding 20 μL ultrapure water.
[0061] 4. Double enzyme digestion of pCAMBIA2306 plasmid and PCR product
[0062] The pCAMBIA2306 plasmid and OsHSL1-HP, OsHSL1-1MT were double-digested with Kpn I and Sal I at 37 ℃ overnight. The enzyme digestion system is shown in the following table.
[0063] Table 3 Double enzyme digestion system of pCAMBIA2306 plasmid (100 μL system)
[0064] After agarose gel electrophoresis verification, the enzyme digestion product was recovered, and the recovery of the enzyme digestion product was performed according to the instructions of the gel recovery kit.
[0065] 5. The recovered target gene product after enzyme digestion was connected with the linear vector.
[0066] 10 μL ligation system contains: Kpn I and Sal I double enzyme cut pCAMBIA2306 linear carrier 0.03 nmol; Kpn I and Sal I double enzyme cut target gene 0.20 nmol; T4 DNA ligase 1 μL; 10×T4 DNA ligase buffer 1 μL; add dd H2O to 10 μL, enzyme connection at 4 ℃ overnight.
[0067] (II) enzyme connection product transformation E. coli TG1.
[0068] 1. Chemical transformation.
[0069] Take 10 μL of the enzyme connection product obtained in the previous step and mix it with 100 μL of E. coli TG1 competent cells. After 30 min of ice bath, heat shock at 42 ℃ for 90 sec, ice bath again for 5-10 min, add 1 mL of preheated antibiotic-free LB medium, recover at 37 ℃, 180 r / min for 1 h; centrifuge at 5000 r / min for 5 min to collect the bacterial cells, discard most of the supernatant, suspend the bacterial cells with the remaining supernatant (about 200 μL), and plate on LB plates containing 50 μg / mL kanamycin at 37 ℃ overnight. Pick the transformants and plate on LB plates containing 50 μg / mL kanamycin and perform colony PCR verification.
[0070] PCR reaction conditions: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 sec, 50 ℃ annealing for 30 sec, 72 ℃ extension for 1 min; 34 cycles; 72 ℃ extension for 10 min, 25 ℃ preservation for 5 min, and end. DNA gel electrophoresis detection.
[0071] 2. Transformation of Agrobacterium GV3101.
[0072] Take 1 μL of the constructed plant recombinant vector plasmid and mix it with 50 μL of Agrobacterium competent cells GV3101, add to a pre-cooled 1 mm electric transfer cup, and use a 1.8 KV voltage to shock; quickly add 600 μL of liquid LB medium, recover at 28 ℃ for 3 h; plate on LB plates containing kanamycin and rifampicin, and culture at 28 ℃. Two days later, pick the transformants and perform colony PCR verification again.
[0073] 3. Agrobacterium-mediated transformation of Arabidopsis.
[0074] Cultivate Arabidopsis sterile seedlings, select an appropriate amount of wild type Col-0 mature seeds and add them to a 2 mL EP tube, and perform seed disinfection in a clean bench. The specific steps are as follows: Add 2 mL of the seed washing solution I (75% ethanol and 0.05% SDS) to the EP tube, invert it up and down for 5 min, and discard the washing solution; Add 2 mL of the seed washing solution II (70% ethanol) to the EP tube, invert it up and down for 5 min, and discard the washing solution; Add 2 mL of the seed washing solution III (95% ethanol) to the EP tube, invert it up and down for 2 min, and discard the washing solution; Pour the seeds on a sterilized filter paper, dry them in the clean bench, and then evenly spread them on the 1 / 2 MS medium without antibiotics.
[0075] When the second leaf grows, move the Arabidopsis from the medium to the soil, make the whole tray of Arabidopsis germinate, cut off the seeds that have been sown, and leave the flower buds, ready for Agrobacterium infection experiment. The specific steps are as follows: (1) The positive Agrobacterium (containing the aforementioned target gene) obtained in step 2 is streaked on LB (Rif+Kan) plate and cultured at 28°C for 2-3 days; a single colony is inoculated in 4 mL of liquid LB (Rif+Kan) medium and shaken at 180 r / min overnight (18 h); (2) Take 1 mL of the overnight bacteria and inoculate in 100 mL of liquid (Rif+Kan) LB medium containing two antibiotics, and culture at 28°C in the dark at 180 r / min overnight; the OD 600 At about 2.0, pour into a sterilized 50 mL EP, centrifuge at 5000 rpm and 28°C for 8 min, collect the bacteria, and discard the supernatant culture solution; (3) Suspend the collected Agrobacterium bacteria in the transformation penetration solution (100 mL: 5% sucrose and 30-40 μL silwet) to make the OD600 value about 0.8; (4) Place the Arabidopsis flower bud part in the EP tube containing the Agrobacterium penetration solution for 1 min, end the infection, gently dip the excess bacteria solution on the absorbent paper, pour and place in the dark for 24 h, and then normally culture; (5) To improve the transformation efficiency of Arabidopsis, the Arabidopsis flower soaking infection work can be carried out again after 3-7 days, and the mature seeds can be collected after about 2 weeks.
[0076] After the Arabidopsis seeds (T0) are maturely harvested, the transgenic Arabidopsis seed verification is carried out, including the following processes: (1) Marker gene screening: The harvested seeds are planted on the 1 / 2 MS medium containing 150 mg / mL kanamycin after being disinfected with the seed washing solution, and the resistant seedlings are screened out.
[0077] (2) PCR detection: extract Arabidopsis genome, PCR amplification, nucleic acid electrophoresis to observe whether there is a target gene.
[0078] Arabidopsis mutant detection: (1) Take 50 μL of Arabidopsis DNA identification buffer in a 2ml EP tube, add a steel ball in each EP tube; (2) Cut the leaf tissue of the size of the steel ball in the fresh leaves of Arabidopsis in the EP tube, and store it in liquid nitrogen for a short time; (3) Use the grinding instrument to prepare the sample, set the condition as 45 HZ, 90 sec, repeat once; (4) Pour out the steel ball, add 450 μL of the above buffer, centrifuge at 4 ℃, 12000 r / min for 10 min, take the supernatant in a new EP tube; (5) Add equal proportion of isopropyl alcohol, place at -20 ℃ for 30 min, then centrifuge at 4 ℃, 12000 r / min for 8 min; (6) Discard the supernatant, add 500 μL of 75% ethanol, centrifuge at 12000 r / min for 8 min; (7) After discarding the supernatant, place it in a 55 ℃ oven for 15 min to dry, then add 50 μL of dd H2O, and store at -20 ℃ for standby.
[0079] (8) PCR amplification using pCAMBIA2306 specific primers 2306-F (GGAGAGAACACGGGGGACGAGC) and 2306-R (GACGAACGTTGTCGAAACCG). PCR reaction conditions: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 sec, 50 ℃ annealing for 30 sec, 72 ℃ extension for 1 min; 34 cycles; 72 ℃ extension for 10 min, 25 ℃ storage for 5 min.
[0080] (Three) DNA gel electrophoresis detection.
[0081] When the T2 generation of transgenic Arabidopsis positive seedlings grow to 4-6 leaf stage, 0-300 g a.i. ha of mesotrione herbicide is sprayed on the surface of wild type Arabidopsis and OsHSL1-HP, OsHSL1-1MT transgenic Arabidopsis leaves -1 , and after 14 days, the plant growth is observed and the resistance is recorded.
[0082] Mesotrione resistance experiment proves that Figure 6 , wild type plants are resistant to 15 g a.i. ha -1The white death under the action of mesotrione with concentration of 120 g a.i. ha -1 , and the highest tolerance concentration of OsHSL1-HP transgenic Arabidopsis is 300 g a.i. ha -1 , which indicates that the transgenic plants have more than 2 times higher resistance on the previous basis, and have high application potential.
[0083] (Four) Application of OsHSL1 mutant in rice.
[0084] The present application further uses the same Agrobacterium-mediated method as the foregoing to transform japonica rice Zhonghua 11, and uses pCAMBIA2306 specific primers 2306 pass-F and 2306 pass-R to perform PCR amplification.
[0085] The PCR reaction conditions are: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 sec, 50 ℃ annealing for 30 sec, 72 ℃ extension for 1 min; 34 cycles; 72 ℃ extension for 10 min, 25 ℃ preservation for 5 min to end. DNA gel electrophoresis detection is performed.
[0086] The T0 generation tissue culture seedlings successfully overexpressing OsHSL1-1MT and mutant OsHSL1-HP are selected, and when the transgenic rice positive seedlings grow to the 4-6 leaf stage, 0-480 g a.i. ha -1 of mesotrione herbicide is sprayed on the surface of the leaves of the OsHSL1-1MT and OsHSL1-HP transgenic rice, and after 14 days, the plant growth is observed and the resistance is recorded.
[0087] The results of the transgenic rice show that Figure 7 , the OsHSL1-1MT transgenic rice starts to have white symptoms from 180 g a.i. ha -1 of mesotrione, and the symptoms gradually deepen with the increase of the concentration; the OsHSL1-HP transgenic rice is not affected by mesotrione, and the highest tolerance concentration is 480 g a.i. ha -1 .
[0088] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. An OsHSL1 protein mutant, characterized in that, The amino acid sequence of the OsHSL1 protein mutant is any one or more of the following mutations based on the amino acid sequence of the OsHSL1 protein: (1) F140H and Q255P; (2) L90M, F140H, L204F and F298L.
2. The mutant OsHSLl protein according to claim 1, characterized in that, The amino acid sequence of the OsHSL1 protein includes any one of the following: i) the amino acid sequence shown as SEQ ID NO. 1; ii) an amino acid sequence with the same function obtained by adding, replacing or deleting one or more amino acids from the amino acid sequence shown as SEQ ID NO.
1.
3. A gene mutant for encoding the OsHSL1 protein mutant of claim 1 or 2.
4. The mutant gene of claim 3, wherein The nucleotide sequence of the gene mutant includes any one or more of the following: i) the nucleotide sequence shown as SEQ ID NO. 2; ii) the complement of the nucleotide sequence shown as SEQ ID NO. 2; iii) a nucleotide sequence capable of encoding a protein with the same function obtained by adding, replacing or deleting one or more nucleotides from the nucleotide sequence shown as SEQ ID NO.
2.
5. A biomaterial, characterized by, The biological material includes the gene mutant of claim 3 or 4; and the biological material is an expression cassette, a vector, a transgenic cell or a recombinant viral particle.
6. A kit characterized in that, The kit includes the OsHSL1 protein mutant of claim 1 or 2, or the gene mutant of claim 3 or 4, or the biological material of claim 5.
7. A herbicide degrading agent, characterized by comprising a microorganism belonging to the genus Pseudomonas. It includes: The OsHSL1 protein mutant of claim 1 or 2.
8. Use of the OsHSL1 protein mutant of claim 1 or 2, or the gene mutant of claim 3 or 4, or the biological material of claim 5, or the kit of claim 6 in any one of the following: (1) degrading herbicides; (2) improving the herbicide resistance of plants; (3) cultivating transgenic plants; (4) improving the germplasm of plants.
9. Use according to claim 8, characterized in that, The herbicide is a triketone herbicide, preferably one or more of sulcotrione, mesotrione, bicyclopyrone, benzobicylon or pyrasulfotole; and / or, The plant is Arabidopsis or Oryza.
10. Use according to claim 8 or 9, characterized in that, The (2) includes: i) expressing the OsHSL1 protein mutant of claim 1 or 2, or the gene mutant of claim 3 or 4, in the cells of a plant; ii) crossing the plant obtained in i) with a wild type plant.