MiRNA capable of reducing cadmium content in plants and application thereof
By regulating cadmium accumulation in plants using microRNA818a and its precursor sequence from wild rice from Dongxiang, the problem of high cadmium accumulation in existing technologies has been solved, achieving precise reduction of cadmium content and promoting the cultivation of low-cadmium rice.
Patent Information
- Application Number
- CN202511970749.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-25
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2045-12-25
AI Technical Summary
There are no existing reports on the use of non-coding small RNA molecules derived from wild rice from Dongxiang to reduce cadmium accumulation in plants, which leads to high cadmium accumulation in rice and other plants under cadmium stress, affecting crop health and quality.
We provide a microRNA818a and its precursor sequence from wild rice from Dongxiang. By constructing a recombinant vector and introducing it into plants, we can regulate the cadmium accumulation process and reduce the cadmium content.
By regulating the specific microRNA818a and its precursor sequence of wild rice from Dongxiang, the cadmium content in the plant can be precisely reduced, and the cadmium accumulation under cadmium stress can be significantly reduced, providing technical support for the cultivation of low-cadmium rice and other crops.
Smart Images

Figure CN121380074B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of plant bioengineering and plant genetic engineering, specifically to a miRNA that can reduce cadmium content in plants and its applications. Background Technology
[0002] Cadmium (Cd) is a highly mobile, easily accumulated, and long-lived toxic heavy metal. Rice ( Oryza sativa Wild rice (L.) is a staple food for more than half of the world's population, and its growth characteristics give it a strong ability to absorb and accumulate cadmium in the soil. Dongxiang wild rice ( Oryza rufipogon Griff. is the northernmost common wild rice species discovered globally. It not only possesses excellent agronomic traits such as high yield potential, cytoplasmic male sterility, and a strong restorer line, but also exhibits outstanding resistance to various abiotic stresses. Most importantly, it demonstrates significant advantages in tolerance and low accumulation of the heavy metal cadmium, providing valuable genetic material for discovering cadmium stress resistance genes and improving cultivated rice varieties.
[0003] Small RNAs (miRNAs) are a class of non-coding RNAs widely distributed in organisms, with a length of approximately 16-29 nucleotides (nt). Increasing research confirms that plant miRNAs participate in the regulation of biotic and abiotic stress responses.
[0004] Current research indicates that in model plants such as Arabidopsis thaliana and rice, the expression of most miRNAs is regulated by multiple stress signals. Heavy metal stress (cadmium), nutrient stress, and viral infection can all significantly affect miRNA accumulation levels. Target gene prediction and functional analysis have confirmed that some stress-induced miRNAs directly participate in plant adaptive responses to stress. Dongxiang wild rice, as a wild relative of cultivated rice, carries abundant genetic resources for stress resistance and shows significant potential in heavy metal tolerance. Systematic analysis of key miRNAs and their regulatory networks in Dongxiang wild rice in response to cadmium stress will not only help reveal the molecular mechanisms of its cadmium tolerance but also provide valuable genetic resources for breeding rice with low cadmium accumulation and tolerance.
[0005] However, to date, there have been no reports of non-coding small RNA molecules derived from Dongxiang wild rice that can reduce cadmium accumulation in rice or other plants. Summary of the Invention
[0006] (a) Technical problems to be solved
[0007] To address the shortcomings of existing technologies in reducing cadmium accumulation in plants, this invention provides a miRNA and its precursor sequence that can reduce cadmium content in plants. By introducing DNA encoding the precursor sequence into a vector to construct a recombinant vector, and then transforming the recombinant vector into the target plant, the amount of cadmium accumulated in the plant can be effectively reduced, providing a new solution for the cultivation of low-cadmium rice and the improvement of the health quality of rice.
[0008] (II) Technical Solution
[0009] In a first aspect, the present invention provides a miRNA that can reduce cadmium content in plants, named Dongxiang wild rice microRNA818a, the sequence of which is shown in SEQ ID NO.1. The Dongxiang wild rice microRNA818a is derived from common wild rice (Oryza sativa). Oryza rufipogon Griff.).
[0010] Secondly, the present invention provides a precursor sequence pri-miRNA of the above-mentioned miRNA, the sequence of which is shown in SEQ ID NO.2.
[0011] Thirdly, the present invention provides a vector comprising the DNA sequence shown in SEQ ID NO.3, which encodes the pri-miRNA described in the second aspect above.
[0012] Preferably, the vector is a recombinant vector obtained by inserting the DNA sequence shown in SEQ ID NO.3 between the KpnI and SalI restriction sites of the pCAMBIA1300-35s vector.
[0013] Fourthly, the present invention provides a transgenic plant with low cadmium accumulation, which contains the aforementioned miRNA, the aforementioned miRNA precursor sequence pri-miRNA, or the aforementioned vector.
[0014] Preferably, the transgenic plant is a monocotyledonous plant or a dicotyledonous plant; more preferably, the monocotyledonous plant is rice.
[0015] Fifthly, the present invention provides a method for reducing cadmium content in plants, comprising the following steps:
[0016] (1) Cloning the DNA sequence encoding the precursor sequence of microRNA818a from wild rice in Dongxiang, the DNA sequence being shown in SEQ ID NO.3;
[0017] (2) The DNA sequence described in step (1) is introduced into a vector to construct a recombinant vector;
[0018] (3) The recombinant vector is transformed into the target plant to reduce the cadmium accumulation in the target plant.
[0019] Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant; more preferably, the monocotyledonous plant includes rice.
[0020] In a sixth aspect, the present invention provides the application of the miRNA sequence shown in SEQ ID NO.1, the pri-miRNA sequence shown in SEQ ID NO.2, or the DNA sequence encoding the pri-miRNA sequence shown in SEQ ID NO.3 in the cultivation of plants with low cadmium accumulation; the plants are preferably monocotyledonous plants.
[0021] (III) Beneficial Effects
[0022] This invention regulates cadmium accumulation in plants using microRNA 818a and its precursor sequence specific to wild rice from Dongxiang. Compared to non-specific techniques, this method can precisely reduce cadmium content in plants, thus enabling the cultivation of plants with low cadmium accumulation characteristics. The non-coding RNA and its precursor sequence provided by this invention can effectively reduce cadmium accumulation in plants under cadmium stress, providing important technical support for the cultivation of low-cadmium rice and other crops. Attached Figure Description
[0023] Figure 1 A schematic diagram of the empty vector structure of the expression vector pCAMBIA1300-35s.
[0024] Figure 2 Agarose gel electrophoresis results of positive detection of transgenic rice lines miROE-3140 and miROE-3147 overexpressing microRNA818a from wild rice in Dongxiang.
[0025] Figure 3 The figure shows the results of identifying the expression level of microRNA818a in transgenic rice.
[0026] Figure 4 Figure 1 shows the cadmium content determination results of the aboveground (A) and underground (B) parts of the transgenic rice overexpressing microRNA818a from wild rice in Dongxiang. Detailed Implementation
[0027] To more clearly illustrate the technical solution of the present invention and facilitate understanding, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. In the following embodiments, unless otherwise specified, the experimental methods used are all conventional molecular biology methods; the materials, reagents, and kits used are all commercially available conventional products unless otherwise specified.
[0028] Example 1
[0029] In this embodiment, the gene encoding the microRNA818a precursor sequence (SEQ ID NO. 3) was cloned from wild rice in Dongxiang. The specific operation is as follows:
[0030] (1) Extraction of genomic DNA from wild rice in Dongxiang:
[0031] Select 0.5g of wild rice seedlings from Dongxiang at the four-leaf stage, place them in a mortar, add liquid nitrogen and grind rapidly into powder, then transfer to a 2mL centrifuge tube; add 600μL of CTAB extraction buffer (formula: 0.012g CTAB, 0.06mL 1M Tris-HCl (pH 8.0), 0.024mL 0.5M EDTA (pH 8.0), 0.049g...) to the centrifuge tube. After mixing with NaCl, the mixture was vortexed and incubated in a 65℃ water bath for 30 min; centrifuged at 12000 rpm for 10 min, and the supernatant was transferred to a new 1.5 mL centrifuge tube; an equal volume of chloroform / isoamyl alcohol (volume ratio 24:1) was added, and the mixture was slowly inverted and mixed, and then incubated on ice for 30 min; centrifuged at 12000 rpm for 10 min, and the supernatant was collected, 700 μL of pre-cooled isopropanol was added, and the mixture was incubated at -20℃ for 90 min to precipitate; centrifuged at 12000 rpm for 10 min, the supernatant was discarded, the precipitate was washed twice with 75% ethanol, and after air drying at room temperature, 100 μL of ddH2O was added to dissolve it to obtain the genomic DNA of wild rice from Dongxiang.
[0032] (2) PCR amplification and product recovery:
[0033] Using the genomic DNA of wild rice from Dongxiang extracted in step (1) as a template, PCR amplification was performed using specific primers containing restriction enzyme sites. The amplification system (50 μL) was as follows: 2 μL template DNA, 0.5 μL Q5 high-fidelity polymerase, 10 μL 5×Q5 reaction buffer, 4 μL 10 mM dNTPs, 0.7 μL 10 μM left-end primer, 0.7 μL 10 μM right-end primer, and ddH2O was added to make up to 50 μL.
[0034] The primer sequences are shown in Table 1. The underlined part of the left primer is the KpnI restriction site, and the underlined part of the right primer is the SalI restriction site.
[0035] Table 1: Primer sequences
[0036] ;
[0037] PCR amplification program: 95℃ pre-denaturation for 30s; 95℃ denaturation for 10s, 65℃ annealing for 30s, 72℃ extension for 30s, for a total of 38 cycles; 72℃ final extension for 5min, and incubation at 10℃.
[0038] The amplified products were separated by 1.5% agarose gel electrophoresis, and the target band with a molecular weight of approximately 1393 bp was excised under UV transilluminator. The target fragment was recovered using the agarose gel DNA recovery kit from Solarbio Science & Technology Co., Ltd.
[0039] The recovered target fragment was sequenced, and the sequencing results showed that the fragment was the DNA sequence shown in SEQ ID NO.3, which is the coding sequence for the precursor (pri-miRNA) of Dongxiang wild rice microRNA818a. Its transcription product was the pri-miRNA sequence shown in SEQ ID NO.2. After being processed and cleaved by nucleases in plant cells, the pri-miRNA generates the mature miRNA sequence microRNA818a (SEQ ID NO.1). The mature microRNA818a can influence the absorption and accumulation of cadmium in plants by regulating the expression of target genes.
[0040] Example 2
[0041] In this embodiment, the DNA sequence shown in SEQ ID NO.3 obtained in Example 1 was inserted into the pCAMBIA1300-35s vector to construct a recombinant overexpression vector. The specific operation is as follows:
[0042] (1) Ligation of the target fragment with the T vector
[0043] The ligation reaction was performed using the Takara pMD™18-T Vector Cloning Kit. The ligation system (10 μL) consisted of 2 μL of recovered DNA fragment, 0.5 μL of pMD™18-T vector, 2.5 μL of ligase premix, and ddH2O to a final volume of 10 μL. The reaction was carried out at 16°C for 4 h or incubated overnight at room temperature.
[0044] (2) Transformation of ligation products and screening of positive clones
[0045] ① Culture medium preparation: Prepare LB liquid medium (formula: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl, and ultrapure water to a final volume) and LB solid medium (LB liquid medium with 15 g / L agar powder added). After high temperature and high pressure sterilization, when cooled to about 50℃, add ampicillin (final concentration 100 μg / mL) or kanamycin (final concentration 50 μg / mL) respectively, pour into plates, and seal and store at 4℃ for later use.
[0046] ② Transformation of competent cells: Take Trans5α Chemically Competent Cell (100 μL / tube) from Transgen Biotech and thaw on ice; add the above ligation product, mix gently, and incubate on ice for 30 min; heat shock at 42℃ for 90 s, then immediately incubate on ice for 5 min; add 600 μL of antibiotic-free LB liquid medium and incubate at 37℃ and 150 rpm for 1 h with shaking; in a clean bench, spread the bacterial culture evenly on LB solid medium containing ampicillin, air dry, invert the plate, and incubate overnight at 37℃.
[0047] ③ Positive clone identification: Select single colonies and identify them using bacterial culture PCR. The reaction system (15 μL) consists of: 2 μL bacterial culture, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and 10×Taq Buffer (containing Mg). 2+ 1.5 μL of Taq polymerase, 0.2 μL of 10 mM dNTPs, and 0.3 μL of ddH2O were added to bring the total volume to 15 μL; the upstream primer was GAGGTGTCACGCAAGTGGAAA (SEQ ID NO. 6), and the downstream primer was CAGGCCCTTATTCACTCCAA (SEQ ID NO. 7).
[0048] After the PCR products were verified by 1.5% agarose gel electrophoresis, positive clones were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.
[0049] (3) Double digestion and ligation of the target fragment and expression vector
[0050] ① Plasmid extraction: Select positive clones with correct sequencing results, inoculate them into 5 mL of LB liquid medium containing ampicillin, and incubate overnight at 37°C with shaking at 200 rpm; use Genview GV-Plasmid DNA Mini Extraction... The kit extracts plasmids using the following steps: Collect bacterial culture into a 1.5 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, and discard the supernatant; add 250 μL of GS1 solution and vortex vigorously to resuspend the bacterial cells; add 250 μL of GS2 solution, gently invert 4-6 times, and let stand at room temperature for no more than 2 min; add 350 μL of GS3 solution, invert to mix, and let stand at room temperature for 2 min; centrifuge at 12000 rpm for 10 min; add 200 μL of BL solution to the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the permeate; transfer the supernatant from centrifugation to the adsorption column, let stand at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min; add 500 μL of wash buffer W1, let stand for 2 min, and centrifuge at 12000 rpm for 1 min; add 500 μL of wash buffer W2, and centrifuge at 12000 rpm for 2 min; place the adsorption column in a new 1.5 mL centrifuge tube, open the cap and air dry, then add 50 μL of... Preheat ddH2O to 65℃, centrifuge at 12000rpm for 2min, and collect the plasmid.
[0051] ② Double enzyme digestion reaction: The extracted plasmid and pCAMBIA1300-35s vector were digested with KpnI and SalI respectively. The digestion system (50μL) was: plasmid DNA 5μL, 10×NEBuffer 2.1 5μL, KpnI 1μL, SalI-HF 1μL, and ddH2O was added to make up to 50μL; the reaction was carried out at 37℃ overnight.
[0052] ③ Vector ligation: Ligation was performed using Biolabs T4 DNA Ligase. The ligation system (10 μL) consisted of: 1 μL of the digested target fragment, 3 μL of the digested pCAMBIA1300-35s vector, 1 μL of 10×T4 DNA Ligase Buffer, and 0.5 μL of T4 DNA Ligase. ddH2O was added to bring the total volume to 10 μL. The reaction was carried out overnight at room temperature to obtain the recombinant vector pCAMBIA1300-35s-microRNA818a.
[0053] ④ Transformation of recombinant vector: Following the competent cell transformation method in step 2, transform the recombinant vector into Trans5α competent cells, plate them on LB solid medium containing kanamycin, incubate overnight at 37°C, and screen for positive clones.
[0054] Example 3
[0055] In this embodiment, the recombinant vector constructed in Example 2 was introduced into Zhonghua 11 rice to obtain transgenic rice, which was then identified. The specific operation is as follows:
[0056] ① Agrobacterium transformation: The recombinant vector pCAMBIA1300-35s-microRNA818a was transformed into Agrobacterium EHA105, plated on a kanamycin-resistant plate, and positive clones were screened and named EHA105 / pCAMBIA1300-35s-microRNA818a. The plasmid of the positive clone was extracted for verification.
[0057] ② Genetic transformation of rice: Zhonghua 11 rice was transformed using Agrobacterium-mediated transformation (Agrobacterium-mediated transformation). Oryza sativa L. cvZhonghua11 (abbreviated as wild-type rice ZH11) callus: After infecting rice callus with EHA105 / pCAMBIA1300-35s-microRNA818a, the callus was washed 5 times with sterile water containing 300mg / L cephalosporin, the water was blotted dry with sterile filter paper, and the callus was transferred to N6D2S1 medium for screening the first generation; after 2 weeks, the callus was transferred to N6D2S2 medium for screening the second generation (2 weeks per generation); vigorous resistant callus was selected and transferred to differentiation medium (1), and cultured in a differentiation incubator (12h photoperiod, daytime temperature 28℃, nighttime temperature 25℃) for 7 days; then transferred to differentiation medium (2), and cultured until regenerated seedlings emerged; the regenerated seedlings were transferred to rooting and seedling strengthening medium, and cultured until the seedlings grew to about 10cm. The container sealing film was opened and the seedlings were hardened off for 2-3 days, and then transplanted to an artificial climate chamber for cultivation to obtain 15 T0 generation microRNA818a transgenic rice lines. The culture medium formulations used are shown in Table 2:
[0058] Table 2: Culture medium formulations used
[0059] ;
[0060] ③ Identification of genetically modified rice:
[0061] Positive detection: Total DNA was extracted from T2 generation rice seedlings transgenic with microRNA818a lines miROE-3140 and miROE-3147. PCR identification was performed using hygromycin (HYG) gene-specific primers. Primer sequences: left primer CGAGAGCCTGACCTATTGCAT (SEQ ID NO. 8), right primer CTGCTCCATACAAGCCAACCAC (SEQ ID NO. 9). PCR reaction system (20 μL): template DNA 2 μL, Taq DNA polymerase 0.2 μL, 10× Buffer (containing Mg...) 2+1.5 μL of 10 mM dNTPs, 0.3 μL of 10 μM left primer, 1 μL of 10 μM right primer, and ddH2O were added to bring the volume to 20 μL; the amplified product was separated by 1.5% agarose gel electrophoresis to obtain the target band with a molecular weight of approximately 481 bp (e.g., ...). Figure 2 (As shown). Positive T0 generation plants were cultivated in a greenhouse and seeds were harvested. Homozygous T2 generation seeds were obtained through propagation. The miROE-3140 and miROE-3147 lines were selected for subsequent experiments. Figure 2 ZH11 corresponds to the wild-type rice lane, miROE-3140 and miROE-3147 correspond to the two transgenic positive lanes, and the DL2000 lane is the DNA bar lane; the size of the target DNA fragment can be quickly estimated by comparing the position of the target band with the DL2000 band.
[0062] Quantitative real-time PCR identification: Total RNA was extracted from the above T2 generation seedlings.
[0063] The Sangon Biotech miRNA First Strand cDNA Synthesis (Stem-loop Method) kit was used to synthesize cDNA via reverse transcription (16℃ for 30 min, 37℃ for 30 min, and 85℃ for 5 min) using stem-loop primers (5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGTCC-3', see SEQ ID NO.10). The cDNA was diluted 10-fold and used as a template. Specific primers (left primer CGCGCGAATCCCTTATATTATG, right primer AGTGCAGGGTCCGAGGTATT, see SEQ ID NO.11-12) and internal control U6 primers (left primer CGATAAAAATTGGAACGATACAGA, right primer ATTTGGACCATTTCTCGATTTGT, see SEQ ID NO.13-14) were used, along with TaKaRa's TB Green™ Premix Ex Taq™ II (Tli RNaseH) kit. The Plus kit was used for amplification on a StepOne™ real-time quantitative PCR instrument. The program was: 95℃ for 30s; 95℃ for 5s, 60℃ for 30s, for a total of 40 cycles; 95℃ for 15s, 60℃ for 1min, 95℃ for 15s. The results are as follows: Figure 3 As shown, compared with wild-type rice (ZH11), the expression level of microRNA818a in miROE-3140 and miROE-3147 lines was significantly upregulated, indicating that the target gene was overexpressed at the transcriptional level.
[0064] Empty vector control: The empty vector pCAMBIA1300-35s was transformed into wild-type rice using the same method as above to obtain T2 generation empty vector-transformed rice. It was identified that its microRNA818a was not overexpressed and served as an experimental control.
[0065] Example 4
[0066] This embodiment verifies the cadmium accumulation characteristics of the transgenic rice obtained in Example 3 through a cadmium stress treatment experiment. The specific operation is as follows:
[0067] ① Rice cultivation and cadmium stress treatment
[0068] Seeds of T2 generation transgenic microRNA818a rice lines (miROE-3140, miROE-3147) and wild-type rice (Zhonghua 11, ZH11, abbreviated as WT) were selected and sown separately in pure water and germinated in an incubator at 32℃. After germination, the seeds were transferred to Kimura B culture medium and incubated in a light incubator (light intensity 10000 μmol / m²). 2 The cells were cultured in an incubator with a light cycle of 14 h / d and a temperature of 30 °C until they reached the 4-leaf stage. CdCl2 solution (final concentration 10 μmol / L) was added to the culture medium, and the cells were cultured for another 7 days. The experiment was performed in triplicate, with 24 plants planted per replicate for each line.
[0069] ② Kimura B culture medium preparation method
[0070] Kimura B culture medium was prepared according to the following formula: Take 5 mL of stock solution A, 5 mL of stock solution B, 1 mL of EDTA-Fe stock solution, 1 mL of trace element stock solution, and 100-300 mg of sodium silicate. Dilute with distilled water to 1 L, and adjust the pH to 5.8 with 1 mol / L HCl to obtain Kimura B culture medium. The formulas for each stock solution and reagent are as follows:
[0071] Mother liquor A: Each 1L contains 9.64g (NH4)2SO4, 4.96g KH2PO4, 3.7g KNO3, 3.18g K2SO4, and 29.965g MgSO4·7H2O;
[0072] B mother liquor: Each 1L contains 17.235g Ca(NO3)2·4H2O;
[0073] EDTA-Fe mother liquor: Each 1L contains 7.45g Na2EDTA and 5.57g FeSO4·7H2O;
[0074] Trace element stock solution: Each 1L contains 2.86g H3BO3, 0.08g CuSO4·H2O, 0.22g ZnSO4·7H2O, 1.81g MnCl2·4H2O, and 0.09g H2MoO4·H2O;
[0075] 1 mol / L HCl: Measure 8.3 mL of 37% concentrated hydrochloric acid, slowly add it to an appropriate amount of distilled water, stir well, and then dilute to 1000 mL with distilled water and shake well.
[0076] ③ Cadmium content determination
[0077] Seven days after cadmium stress treatment, the above-ground parts (stems and leaves) and underground parts (roots) of each plant strain were harvested. Above-ground part pretreatment: Stems and leaves were rinsed 3-4 times with distilled water to remove surface dust and residual culture medium, and then dried with absorbent paper. Underground part (root) pretreatment: Roots were quickly rinsed 2-3 times with distilled water to remove a large amount of culture medium adhering to the surface, then immersed in 5 mmol / L EDTA-2Na solution for 15-20 minutes (gently agitated 3-5 times during this period) to chelate and remove free cadmium ions adsorbed on the root surface; after immersion, roots were rinsed 5-6 times with distilled water until no cadmium ions were detected in the rinsing solution (this can be quickly verified by ICP-MS or atomic absorption spectrophotometry), and then dried with absorbent paper. Cadmium content was then determined using inductively coupled plasma mass spectrometry (ICP-MS) or atomic absorption spectrophotometry (specific detection methods refer to GB 5009.15-2014 "National Food Safety Standard - Determination of Cadmium in Food").
[0078] ④ Experimental Results
[0079] After treatment with 10 μmol / L CdCl2, the cadmium content of each strain was determined as follows: Figure 4 As shown:
[0080] Statistical analysis showed that, compared with wild-type ZH11, the cadmium content in both the aboveground and underground parts of miROE-3140 and miROE-3147 lines was significantly reduced, with the reduction in cadmium content in the aboveground parts being more significant. This demonstrates that overexpression of microRNA818a from wild rice in Dongxiang can effectively reduce cadmium accumulation in rice plants.
[0081] Cadmium content in the above-ground parts, such as Figure 4 (A): Wild-type ZH11 was 34.9303 mg / kg, miROE-3140 strain was 23.5333 mg / kg, and miROE-3147 strain was 17.8804 mg / kg;
[0082] Cadmium content in underground parts, such as Figure 4(B): Wild-type ZH11 was 804.5877 mg / kg, miROE-3140 strain was 668.1304 mg / kg, and miROE-3147 strain was 674.7649 mg / kg.
[0083] ④ Results Analysis
[0084] The above experimental results show that after introducing DNA (SEQ ID NO. 3) encoding the precursor sequence of Dongxiang wild rice microRNA818a into rice, the resulting microRNA818a overexpressing lines had significantly lower cadmium accumulation than non-transgenic wild rice under the same cadmium stress conditions. This demonstrates that Dongxiang wild rice microRNA818a can reduce cadmium absorption and accumulation in rice plants by regulating related metabolic pathways, providing key gene resources and technical support for breeding low-cadmium-accumulation rice varieties.
[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features. These modifications or substitutions, or combinations of technical features in the above embodiments that do not conflict with each other, can be made in accordance with the manner described in the embodiments. These modifications, substitutions or combinations do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for reducing cadmium content in plants, characterized in that, It includes the following steps: (1) Cloning the DNA sequence encoding the precursor sequence of microRNA818a from wild rice in Dongxiang, the DNA sequence being shown in SEQ ID NO.3; (2) The DNA sequence described in step (1) is introduced into a vector to construct a recombinant vector; (3) The recombinant vector is introduced into the target plant to reduce the cadmium accumulation in the target plant; the plant is rice.
2. Application of the pri-miRNA shown in SEQ ID NO.2 or the DNA encoding pri-miRNA shown in SEQ ID NO.3 in the cultivation of low cadmium accumulation rice.