Application of ZmAPX1 in regulating resistance of corn to maize chlorotic mottle virus

Abstract

The invention discloses an application of ZmAPX1 (ZmAPX1) in regulating and controlling the resistance of corn to a maize chlorotic mottle virus (MCMV), and belongs to the technical field of plant genetic engineering. Through instantaneous silencing of ZmAPX1 and use of a ZmAPX1 mutant, it is proved that down-regulation of expression of the ZmAPX1 gene can reduce the immunity of plants to MCMV, and through construction of an over-expression ZmAPX1 strain, it is proved that ZmAPX1 can enhance the immunity of plants to MCMV. Therefore, the ZmAPX1 is proved to have the function of positively regulating the MCMV resistance of the corn.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of plant genetic engineering, and in particular to application of ZmAPX1 in regulating maize resistance to maize chlorotic mottle virus. BACKGROUND

[0002] Maize chlorotic mottle virus (MCMV) is an important quarantine virus in China. MCMV was first discovered in Peru in 1971, and in 1978, MCMV was first reported in Kansas to cause maize lethal necrosis disease in cooperation with maize dwarf mosaic virus (MDMV) or wheat streak mosaic virus (WSMV). After that, it was discovered in Kansas, Argentina, Mexico, Hawaii, etc. Since 2010, MCMV has been discovered in Southeast Asia and East Africa, causing serious threats to corn yield and safety. As the only member of the Machlomovirus genus of the Tombusviridae, MCMV infects maize to cause leaf, chlorosis and developmental retardation, necrosis, severe developmental retardation, low seed setting, shortened inflorescence, and premature plant death. When MCMV cooperates with sugarcane mosaic virus (SCMV), MDMV and WSMV, it can cause more serious maize lethal necrosis disease (MLND).

[0003] Active oxygen (ROS) is a necessary product of aerobic metabolism of organisms, including singlet oxygen, superoxide anion, hydroxyl radical and hydrogen peroxide (H2O2). When plants are exposed to harsh environments, the level of ROS will excessively increase, leading to oxidative damage of DNA, RNA, protein and lipid molecules. Plants remove H2O2 through various antioxidant enzymes, including catalase (CAT), ascorbate peroxidase (APX), peroxidase (PRX) and glutathione S-transferase (GST). Among them, APX has the strongest affinity for H2O2.

[0004] APX not only participates in the clearance of H2O2, but also plays an important role in plant growth, development and stress response. For example, APX is involved in lateral root formation, nodule development, leaf senescence, seed germination and programmed cell death (PCD). Overexpression of APX can enhance the resistance of plants to pathogens and oxidative stress, but its function is complex, and some APX mutants show enhanced tolerance to specific stress. However, the mechanism of APX in plant resistance to viral diseases is still unclear. SUMMARY

[0005] The purpose of the present application is to provide the application of ZmAPX1 in regulating the resistance of corn to corn chlorotic mottle virus, in order to solve the problems existing in the prior art.

[0006] To achieve the above-mentioned purpose, the present application provides the following solutions: One of the technical solutions of the present application is the application of ZmAPX1 gene or the protein coded by the gene in improving the resistance of plants to corn chlorotic mottle virus.

[0007] The second technical solution of the present application is the application of recombinant vector, expression cassette or transgenic cell line containing ZmAPX1 gene in improving the resistance of plants to corn chlorotic mottle virus.

[0008] The third technical solution of the present application is a method for improving the resistance of plants to corn chlorotic mottle virus, overexpressing ZmAPX1 gene or improving the level of protein coded by the gene, and improving the resistance of plants to corn chlorotic mottle virus.

[0009] The fourth technical solution of the present application is the application of ZmAPX1 gene or the protein coded by the gene in cultivating corn line with high resistance to corn chlorotic mottle virus, overexpressing ZmAPX1 gene or improving the level of protein coded by the gene, and improving the resistance of plants to corn chlorotic mottle virus.

[0010] The fifth technical solution of the present application is a method for cultivating corn line with high resistance to corn chlorotic mottle virus, overexpressing ZmAPX1 gene or improving the level of protein coded by the gene, and improving the resistance of plants to corn chlorotic mottle virus.

[0011] Based on the above technical solutions, the present application has the following technical effects: The present application first found that the immunity of plants with transiently silenced ZmAPX1 gene and ZmAPX1 mutant lines to corn chlorotic mottle virus (MCMV) is significantly reduced, while the overexpression of ZmAPX1 gene shows enhanced resistance to MCMV. The above results show that ZmAPX1 plays a positive regulatory role in the process of corn resisting MCMV infection, and can improve the anti-infection ability of plants to MCMV. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 Silencing ZmAPX1 promotes the accumulation of MCMV; wherein, A: detection of ZmAPX1 silencing efficiency; B: phenotype of ZmAPX1 silencing group and control group after inoculation of MCMV; C: qRT-PCR detection of MCMV CP accumulation in corn after inoculation of MCMV for 7 days after CMV-GFP and CMV-ZmAPX1 silencing; D: Western Blot detection of MCMV CP protein accumulation in corn after inoculation of MCMV for 7 days after CMV-GFP and CMV-ZmAPX1 silencing.

[0013] Figure 2 Silencing ZmAPX1 gene mutant promotes the accumulation of MCMV; wherein, A: phenotype of control and ZmAPX1 mutant strain of corn after inoculation of MCMV for 7 days; B: qRT-PCR detection of MCMV CP accumulation in control and ZmAPX1 mutant strain of corn after inoculation of MCMV for 7 days; C: Western Blot detection of MCMV CP protein accumulation in control and ZmAPX1 mutant strain of corn after inoculation of MCMV for 7 days.

[0014] Figure 3 Overexpression of ZmAPX1 reduces the accumulation of MCMV; wherein, A: phenotype of control and ZmAPX1-OE of corn after inoculation of MCMV for 7 days; B: qRT-PCR analysis of MCMV CP accumulation in control and ZmAPX1-OE of corn after inoculation of MCMV for 7 days; C: Western Blot detection of MCMV CP accumulation in corn after inoculation of MCMV for 7 days. DETAILED DESCRIPTION

[0015] The technical solutions described in the present application are conventional solutions in the art if not specifically stated, and the reagents or raw materials used are purchased from commercial channels or published if not specifically stated.

[0016] The present application provides the application of ZmAPX1 gene or the protein encoded by the same in improving the resistance of plants to maize chlorotic mottle virus.

[0017] In some specific embodiments, the nucleotide sequence of the ZmAPX1 gene is shown in SEQ ID NO. 1.

[0018] In some specific embodiments, overexpression of ZmAPX1 gene or improvement of the level of the protein encoded by the same improves the resistance of plants to maize chlorotic mottle virus.

[0019] In some specific embodiments, the plant comprises corn.

[0020] This invention also provides the application of recombinant vectors, expression cassettes, or transgenic cell lines containing the ZmAPX1 gene in improving plant resistance to maize chlorotic mottle virus.

[0021] This invention also provides a method for improving plant resistance to maize chlorotic mottle virus by overexpressing the ZmAPX1 gene or increasing the level of its encoded protein.

[0022] This invention also provides the application of the ZmAPX1 gene or its encoded protein in breeding maize lines with high resistance to maize chlorotic mottle virus, by overexpressing the ZmAPX1 gene or increasing the level of its encoded protein to improve plant resistance to maize chlorotic mottle virus.

[0023] This invention also provides a method for breeding maize varieties with high resistance to maize chlorotic mottle virus by overexpressing the ZmRACK1 gene or increasing the level of its encoded protein to improve plant resistance to maize chlorotic mottle virus.

[0024] In some specific implementation schemes, the following steps are included: introducing the ZmAPX1 gene into the target plant, thus obtaining the desired result.

[0025] In some specific implementations, the ZmAPX1 gene is introduced into the target plant via a recombinant vector, expression cassette, or transgenic cell line containing the ZmAPX1 gene.

[0026] This invention discloses the application of the maize gene ZmAPX1 in regulating plant resistance to maize chlorotic mottle virus (MCMV). Through transient silencing of ZmAPX1 and the construction of ZmAPX1 mutants, this invention demonstrates that downregulating ZmAPX1 gene expression reduces plant immunity to MCMV. Furthermore, by constructing ZmAPX1 overexpression lines, it is shown that ZmAPX1 gene overexpression enhances plant immunity to MCMV, thus proving that ZmAPX1 positively regulates maize's resistance to MCMV.

[0027] Example 1 Cloning of the ZmAPX1 gene I. Total RNA extraction from maize B73 1. Place the corn B73 sample into a 2 ml centrifuge tube, add two 4 mm steel balls, and freeze quickly in liquid nitrogen.

[0028] 2. Place a 2 ml centrifuge tube into a vibratory grinder and grind at 22 Hz for 45 s, 4-5 times, until the sample is in powder form.

[0029] 3. Put 2 ml centrifuge tube on ice, add 1 mL Trizol (4℃), homogenate with vortex, stand for 5 min, centrifuge at 12000 g for 10 min in 4℃ centrifuge. Pre-cool chloroform at 4℃.

[0030] 4. Absorb supernatant into a new 1.5 ml centrifuge tube, put on ice, add 250 μL chloroform, homogenate with vortex, stand for 10 min, centrifuge at 12000 g for 10 min in 4℃ centrifuge. Pre-cool isopropanol at -20℃.

[0031] 5. Absorb supernatant into a new 1.5 ml centrifuge tube, put on ice, add equal volume of isopropanol, homogenate with vortex, stand for 20 min, centrifuge at 12000 g for 10 min in 4℃ centrifuge.

[0032] 6. Pour out supernatant, add 1 ml 75 % anhydrous ethanol, homogenate with vortex, centrifuge at 7500 g for 5 min in 4℃ centrifuge.

[0033] 7. Repeat the above step.

[0034] 8. Pour out supernatant, stand at room temperature for 3-5 min, dissolve with DEPC water, homogenate with vortex.

[0035] II. Synthesis of cDNA by reverse transcription Genomic DNA removal; Table 1

[0036] Put into PCR instrument, 42℃, 2 min.

[0037] Synthesis of cDNA; Table 2

[0038] Put into PCR instrument, 37℃ 15 min, 85℃ 5 s, store in -20℃ refrigerator.

[0039] III. RT-PCR amplification of ZmAPX1 gene Using the above cDNA template, and designing primers according to the nucleic acid sequence of ZmAPX1 gene, PCR amplification was carried out, and the reaction system is shown in Table 3.

[0040] Table 3

[0041] The primer sequence used is: Table 4

[0042] After the reagents were mixed, PCR was performed according to the conditions in Table 5.

[0043] Table 5

[0044] After the PCR program was completed, agarose gel electrophoresis was directly performed. After the desired band was obtained, nucleic acid purification was performed according to the QIAquick Gel Extraction Kit instructions, and the full length of the ZmAPXl gene was obtained.

[0045] The nucleotide sequence of the ZmAPXl gene is (SEQ ID NO. 1): ATGGCGAAGAACTACCCGACCGTGAGCGCCGAGTACAGCGAGGCCGTCGAGAAGGCCAGGCGCAAGCTCCGCGCCCTCATCGCCGAGAAGAGCTGCGCGCCCCTCATGCTCCGCCTCGCGTGGCACTCCGCGGGGACGTTCGACGTGTCGTCGAGGACCGGCGGTCCCTTCGGTACTATGAAGTGCCCGGCGGAACTGGCTCACGGCGCCAACGCGGGGCTGGACATCGCGGTGCGGCTGCTCGAGCCCATCAAGGAGGAGTTCCCCACCCTCTCCTATGCCGATTTCTACCAGCTTGCCGGAGTTGTGGCCGTCGAGGTCACCGGTGGGCCTGAGATCCCCTTCCACCCCGGCAGGGAGGACAAGCCTCAGCCGCCACCTGAGGGCCGTCTTCCTGATGCCACCAAGGGTTCTGACCACTTGAGGCAAGTCTTTGGCAAGCAGATGGGTTTGAGTGATCAGGACATTGTTGCCCTCTCTGGTGGCCACACCTTGGGAAGGTGCCACAAAGAGCGGTCTGGTCTTGAGGGGGCCTGGACTACGAACCCTTTGGTCTTTGACAACTCTTACTTCAAGGAACTTCTGAGTGGCGACAAGGAGGGCCTTCTTCAGCTCCCAAGTGACAAAGCCCTGCTGTGCGACCCTGTCTTCCGCCCTCTTGTGGAGAAATATGCTGCAGATGAGAAGGCATTCTTTGATGACTACAAAGAGGCCCACCTCAAGCTCTCCGAACTGGGGTTTGCTGATGCTTAA.

[0046] Example 2 Effect of ZmAPXl gene silencing on MCMV infection I. Construction of the silencing vector Systemic silencing of ZmAPX1 gene was performed by using CMV infectious clone mediated VIGS technology. A 300 bp fragment was predicted by SGN VIGS Tool (http: / / vigs.solgenomics.net) from the cDNA of Zea mays B73 and the primer was designed to amplify the target fragment by PCR. The primer sequence is shown in Table 6.

[0047] Table 6

[0048] The fragment was cloned into the VIGS vector by homologous recombination. First, the vector was double digested, and the system is shown in Table 7.

[0049] Table 7 Enzyme digestion system of vector

[0050] The reaction system was placed in a water bath at 37℃ for 6 h. The gel cutting kit was used for purification and recovery.

[0051] The fusion cloning was performed by using homologous recombination ligation kit (C112), and the ligation product was transformed into DH5a. The single colony was picked for colony PCR, and the plasmid was extracted.

[0052] II. Identification of silencing efficiency of ZmAPX1 silenced plants The agrobacterium was transformed with the silencing vector and combined with CMV-RNA1 and CMV-RNA3 vectors to infect Nicotiana benthamiana for 3-5 days. The virus liquid was extracted and used to prick the corn seeds. The leaves were taken at the two-leaf stage, and the silencing efficiency was detected by qRT-PCR.

[0053] The primer sequence is shown in Table 8.

[0054] Table 8

[0055] The reaction system is shown in Table 9.

[0056] Table 9

[0057] The reaction procedure is shown in Table 10.

[0058] Table 10

[0059] The real-time fluorescent quantitative PCR results were analyzed and the data was arranged. The results are shown in Figure 1 As shown in Table A, the relative mRNA level of ZmAPX1 was significantly reduced.

[0060] III. Effect of ZmAPX1 silencing on MCMV infection MCMV (from China Agricultural University) was inoculated into CMV-GFP and CMV-ZmAPX1 infected maize seedlings, and CMV-GFP was used as a control group to verify the effect of ZmAPX1 silencing on MCMV infection. The virus accumulation was detected by qRT-PCR and western blot 7 days after inoculation, and the phenotype was observed (Note: CMV-GFP is a plasmid preserved in the laboratory).

[0061] 1. qRT-PCR detection of virus accumulation The primers used are shown in Table 11.

[0062] Table 11

[0063] 2. Western Blot detection 1) Different protein gel formulations are selected according to the size of the protein.

[0064] 2) Prepare the separation gel according to the formula, add the separation gel to the glass plate, then add ddH2O2 to flatten it. Let it stand for 30 min.

[0065] 3) After the separation gel solidifies, prepare the concentrated gel according to the formula, pour off the ddH2O2 and add the concentrated gel, and insert the comb corresponding to the gel plate, and stand for 30 min.

[0066] 4) Add the deformed protein to the gel well, and adjust the voltage to 120 V after the protein Maker band is separated.

[0067] 5) Cut 8 pieces of filter paper slightly larger than the gel and 1 piece of NC membrane, and soak the NC membrane and filter paper in the transfer solution.

[0068] 6) Transfer according to the order of 4 layers of filter paper-NC membrane-gel-4 layers of filter paper.

[0069] 7) Constant voltage 20 V, 25 min.

[0070] 8) After the transfer is completed, place the NC membrane in the blocking solution and seal it in a horizontal shaker at room temperature for 1 h.

[0071] 9) Add the primary antibody to the blocking solution according to the corresponding proportion, incubate on a horizontal shaker at room temperature for 2 h or in a refrigerator at 4°C overnight, and store the recovered primary antibody diluent in a refrigerator at -20°C.

[0072] 10) Wash the NC membrane with TBST solution 3 times, 10 min each time, and wash on a horizontal shaker at room temperature.

[0073] 11) Add secondary antibody into blocking solution with corresponding ratio, incubate on a horizontal shaker at room temperature for 1 h, pour out secondary antibody dilution and wash the NC membrane with TBST for 3 times.

[0074] 12) Add ECL chemiluminescence developing solution to the front of the NC membrane, and develop with ultra-sensitive multifunctional imager.

[0075] Results are shown in Figure 1 Compared with the control, the accumulation of MCMV CP in the ZmAPX1 transiently silenced plants was significantly higher.

[0076] Example 3 Effect of ZmAPX1 gene silencing mutant on MCMV infection I. Phenotype observation after inoculation of MCMV MCMV was inoculated on ZmAPX1 silenced mutant line (donated by College of Agriculture, Henan Agricultural University) and control corn, and symptoms were observed 7 days after inoculation. The ZmAPX1 silenced mutant line showed more severe mosaic symptoms than the control group Figure 2 A).

[0077] II. qRT-PCR and analysis of virus accumulation Compared with the control, the accumulation of MCMV CP in the ZmAPX1 silenced mutant line was significantly higher Figure 2 B).

[0078] III. Western Blot detection Compared with the control, the accumulation of MCMV CP in the ZmAPX1 silenced mutant line was significantly higher Figure 2 C).

[0079] Example 4 Effect of overexpression of ZmAPX1 gene on MCMV infection I. Vector construction A transgenic vector for overexpression of ZmAPX1 was constructed, and transgenic corn overexpressing ZmAPX1 (ZmAPX1-OE) was obtained by transformation.

[0080] II. Phenotype after inoculation of MCMV MCMV was inoculated on ZmAPX1-OE and control corn A188 B73 hybrid, and symptoms were observed 7 days after inoculation. The systemic leaf mosaic symptoms of ZmAPX1-OE were milder than those of the control Figure 3 A).

[0081] III. qRT-PCR analysis of virus accumulation Compared with the control group, the accumulation level of MCMV CP was significantly reduced in plants overexpressing ZmAPX1. Figure 3 (B)

[0082] IV. Western Blot Detection Compared with the control group, the accumulation level of MCMV CP was significantly reduced in plants overexpressing ZmAPX1. Figure 3 (C)

[0083] This invention demonstrates that transient silencing of ZmAPX1 and the use of ZmAPX1 mutants confirm that downregulating the expression of the ZmAPX1 gene reduces the plant's immunity to MCMV; furthermore, by constructing ZmAPX1 overexpression lines, it is demonstrated that ZmAPX1 can enhance the plant's immunity to MCMV, thus proving that ZmAPX1 positively regulates maize's resistance to MCMV.

[0084] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. Application of the ZmAPX1 gene or its encoded protein in improving plant resistance to maize chlorotic mottle virus.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the ZmAPX1 gene is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, Overexpression of the ZmAPX1 gene or increase in the level of its encoded protein can enhance plant resistance to maize chlorotic mottle virus.

4. The application according to claim 1, characterized in that, The plant mentioned includes corn.

5. Application of recombinant vectors, expression cassettes, or transgenic cell lines containing the ZmAPX1 gene in improving plant resistance to maize chlorotic mottle virus.

6. A method for improving plant resistance to maize chlorotic mottle virus, characterized in that, Overexpression of the ZmAPX1 gene or increase in the level of its encoded protein can enhance plant resistance to maize chlorotic mottle virus.

7. The application of the ZmAPX1 gene or its encoded protein in breeding maize lines with high resistance to maize chlorotic mottle virus, characterized in that, Overexpression of the ZmAPX1 gene or increase in the level of its encoded protein can enhance plant resistance to maize chlorotic mottle virus.

8. A method for breeding maize varieties with high resistance to maize chlorotic mottle virus, characterized in that, Overexpression of the ZmAPX1 gene or increase in the level of its encoded protein can enhance plant resistance to maize chlorotic mottle virus.

9. The method according to claim 8, characterized in that, Includes the following steps: The ZmAPX1 gene is introduced into the target plant to obtain the desired result.

10. The method according to claim 9, characterized in that, The ZmAPX1 gene is introduced into the target plant via the recombinant vector, expression cassette, or transgenic cell line containing the ZmAPX1 gene as described in claim 5.

Images