Carrier of snake venom thrombin-like enzyme, yeast engineering bacteria and preparation method of yeast engineering bacteria

Abstract

The invention discloses a vector for expressing snake venom thrombin-like bacteria, yeast engineering bacteria and a preparation method, and belongs to the technical field of gene engineering. Based on pPIC9K, pAO815 alpha, thrombin-like snake venom agkihpin and a pichia pastoris expression system, the co-expression copy number of the agkihpin gene and an auxiliary factor is optimized, the copy number of an auxiliary gene Bmh2 is adjusted, and culture parameters such as the initial pH of a culture medium, the methanol addition amount, the induction time, the induction temperature and an auxiliary agent are improved by the system, so that the expression level of the agkihpin is effectively improved, and the expression level of the agkihpin is improved. And a solid foundation is laid for agkihpin industrial application of the thrombin-like snake venom.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and in particular to a carrier of a snake venom thrombin, a yeast engineering bacterium and a preparation method thereof. BACKGROUND

[0002] Thrombotic diseases such as myocardial infarction, pulmonary embolism, cerebral infarction and peripheral vascular disease pose a serious threat to human health. Thrombolysis has been recognized as the most effective method for treating thrombotic diseases in clinical practice. Currently developed thrombolytic drugs such as anistreplase, batroxobin and urokinase have certain therapeutic effects, but can cause bleeding and re-embolization risks. Agkihpin is a protein isolated from the venom of Jiangzhe viper (Gloydius halys Pallas) by the inventors' team, which has 235 aa, a molecular weight of about 25 kDa, and a PI of about 7.40, with 4 pairs of disulfide bonds. The agkihpin isolated from natural snake venom has thrombolytic and thrombosis-reducing activities, and has no bleeding risk, so it is a very potential thrombolytic drug.

[0003] Currently, there are mainly two methods for obtaining agkihpin components: separation from natural snake venom and in vitro recombinant expression using an Escherichia coli prokaryotic expression system. The extraction process for separation from natural snake venom of Jiangzhe viper is complex, has high production cost, low yield and uncontrollable purity, and the components separated from natural snake venom can even cause adverse reactions in patients in terms of nerves and immunity. Most of the existing researches use the Escherichia coli expression system to obtain recombinant agkihpin protein, which is limited by the expression system, and has limited expression efficiency and expression level, often with inclusion bodies, and the renaturation of the inclusion bodies limits large-scale production. In addition, the Escherichia coli system lacks post-translational modification, which has an important influence on the activity of the glycoprotein agkihpin. Therefore, the above separation methods cause differences in the activity of the recombinant protein and the agkihpin protein, and are not suitable for large-scale production and engineering application. SUMMARY

[0004] To solve the above technical problems, the present application uses a Pichia pastoris expression system, combines optimization of copy number, co-expression of auxiliary factors and optimization of auxiliary factor copy number, and optimizes the initial pH value of the bacterial liquid medium, the inoculum size, the methanol addition amount, the induction time and the induction temperature, thereby laying a foundation for large-scale production of agkihpin. Another object of the present application is to provide a carrier of a snake venom thrombin, a yeast engineering bacterium and a preparation method thereof, to solve the technical problems presented in the background.

[0005] To achieve the above object, the present application adopts the following technical solutions: A vector of a snake venom thrombin, characterized in comprising any of the following: i) a pPIC9K-agkihpin vector, the nucleic acid sequence of which is shown as SEQ ID NO: 1; ii) a pAO815a-agkihpin vector, the nucleic acid sequence of which is shown as SEQ ID NO: 2; iii) a pAO815a-2agkihpin vector, the nucleic acid sequence of which is shown as SEQ ID NO: 3; iv) a pAO815a-3agkihpin vector, the nucleic acid sequence of which is shown as SEQ ID NO: 4.

[0006] Preferably, the enzyme cutting site of the pPIC9K-agkihpin vector is Avr I and Not I.

[0007] Preferably, the pAO815a-agkihpin vector is modified from the secretion signal peptide a-factor of the yeast expression vector pAO815 by homologous recombination, and the vector contains a screening marker HIS4.

[0008] The application also provides a vector combination comprising the above-mentioned vector and a pPICZ aA-Bmh2; the sequence of the pPICZ aA-Bmh2 vector is shown as SEQ ID NO: 5.

[0009] The application further provides a yeast engineering bacterium containing the above-mentioned expression vector or the above-mentioned vector combination.

[0010] Preferably, the engineering bacterium is preserved in the Guangdong Microbial Culture Collection Center on September 25, 2025, and the preservation number is GDMCC No: 67025. The strain is pAO815a-6agkihpin-2Bmh2 / GS115, Komagataella phaffii, and belongs to the genus Komagataella.

[0011] Preferably, the yeast engineering bacterium host is Pichia pastoris GS115.

[0012] Preferably, the yeast engineering bacterium further comprises an engineering bacterium with 3-9 copies of the agkihpin gene and 1-2 copies of the Bmh2 gene.

[0013] The application also provides a method for expressing a heterologous protein by a yeast engineering bacterium, wherein the initial pH of the BMMY culture medium during the cultivation of the bacterium is 5.0, the initial induction OD is 0.2-0.4, and the induction time is 48-72 hours. 600=2, inducer methanol addition amount is 1.5% (v / v), casein addition amount is 2% (w / v), induction time is 96h, and induction temperature is 25 DEG C.

[0014] Preferably, the method comprises the following steps: (1) introducing the expression vector of claim 1 into Pichia pastoris competent cells by the method of electroporation to obtain the yeast recombinant genetically engineered bacteria containing the expression vector; (2) inoculating the yeast recombinant genetically engineered bacteria obtained in step (1) into YPD liquid medium and aerating for a certain time; (3) inoculating the appropriate amount of recombinant genetically engineered bacteria into YPG medium with initial pH = 6.0, setting appropriate rotation speed and temperature, and culturing for a certain time; (4) centrifuging the bacteria and transferring them into BMMY medium, so that the final OD of the bacteria liquid is 2, adding anhydrous methanol every certain time to the final methanol volume concentration of 1.5% (v / v), setting appropriate rotation speed, aerating on a shaker, and inducing expression for a certain time at appropriate temperature. 600

[0015] The present application has the following beneficial effects compared with the prior art: The present application uses the Pichia pastoris system to efficiently express the snake venom thrombin agkihpin, solves the problems of low expression efficiency of agkihpin protein in the prior art, easy formation of inclusion bodies, and inability to meet the problems of large-scale production and application.

[0016] The present application optimizes the agkihpin gene dose and the copy number of its co-expression with auxiliary factors through codon optimization, adjusts the copy number of the auxiliary gene Bmh2, and simultaneously improves the initial pH of the culture medium, the methanol addition amount, the induction time, the induction temperature, and the auxiliary agent, effectively improves the expression level of agkihpin, and lays a solid foundation for the industrial application of snake venom thrombin agkihpin. Combined with the use of large-scale fermenters in the later stage, the expression level of the protein is greatly improved. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Figure 1 is a pPIC9K-agkihpin vector diagram of Example 1.

[0018] Figure 2 Figure 2 is a pAO815α-agkihpin vector diagram of Example 1.

[0019] Figure 3 Figure 3 is a pPICZαA-Bmh2 vector diagram of Example 4.

[0020] Figure 4 ​Figure 1 is the SDS-PAGE result of agkihpin recombinant protein of Example 1. 1: supernatant of fermentation broth of empty pPIC9K / GS115; 2: supernatant of fermentation broth of pPIC9K-agkihpin / GS115.

[0021] Figure 5 Figure 2 is the Western Blot result of agkihpin recombinant protein of Example 1. 1: supernatant of fermentation broth of empty pPIC9K / GS115; 2: supernatant of fermentation broth of pPIC9K-agkihpin / GS115.

[0022] Figure 6 Figure 3 is the result of parameter test of culture condition optimization of agkihpin expression strain of Example 6. A: induction time; B: methanol concentration test; C: initial pH value parameter test of broth culture medium; D: temperature parameter test; E: casein parameter test; the horizontal axis represents parameter setting value, and the vertical axis represents gray value.

[0023] Figure 7 Figure 4 is the effect of different complete saturation degrees of ammonium sulfate on preparation of agkihpin crude enzyme solution of Example 2. M: StarRuler Color Prestained Protein Marker (10-180kDa); 1-5: 50%, 60%, 70%, 80% complete saturation degrees of ammonium sulfate.

[0024] Figure 8 Figure 5 is the induction fermentation result of different copy number transformants of Example 3.

[0025] Figure 9 Figure 6 is the expression result of agkihpin by Bmh2 joint co-expression of Example 4.

[0026] Figure 10 Figure 7 is the effect of different gene doses of Bmh2 on expression level of agkihpin of Example 5.

[0027] Figure 11 Figure 8 is the standard curve graph of logarithmic copy number of Example 4. DETAILED DESCRIPTION

[0028] In order to make the objects, technical solutions and advantages of the present application clearer, the following preferred embodiments are described in detail with reference to the accompanying drawings. However, it should be noted that many details in the description are only to make the reader have a thorough understanding of one or more aspects of the present application, and these aspects can be realized without these specific details.

[0029] Pichia expression system is one of the most widely used eukaryotic expression systems at present, and there is no information about expressing agkihpin in Pichia in the prior art. Compared with the E. coli system, the Pichia expression system in the eukaryotic system has a post-translational processing system, which is beneficial to the formation of disulfide bonds and the moderate glycosylation of proteins, the expressed snake venom thrombin can be secreted into the culture medium, which is very beneficial to the collection and purification of the product and the product has higher activity. Compared with other eukaryotic systems such as mammalian and insect expression systems, the expression cost of the Pichia expression system is low, the operation is simple and convenient, and high-density fermentation is more conducive to large-scale production of heterologous proteins. The present application is to express snake venom thrombin agkihpin in Pichia efficiently, and provides a method for efficiently expressing the protein.

[0030] In the Pichia expression system, overexpression of auxiliary proteins (such as chaperones, foldases or secretion pathway regulators) is widely considered to alleviate endoplasmic reticulum (ER) stress, optimize the efficiency of the secretion pathway, and thus improve the yield of recombinant proteins.

[0031] The yeast engineering bacteria were preserved in Guangdong Microbial Culture Collection Center on September 25, 2025, and the preservation number is GDMCC No: 67025. The strain is pAO815α-6agkihpin-2Bmh2 / GS115, Komagataella phaffii, belonging to the genus Komagataella. The application unit and the preservation unit are Guangxi Medical University, and Hu Qiping is the first inventor and the biological preserver. It is confirmed that the biological preserver is Guangxi Medical University.

[0032] Figure 1 The English and abbreviations of each element of the pPIC9K-agkihpin vector map are listed as follows:

[0033] Figure 2 The English and abbreviations of each element of the pAO815α-agkihpin vector map are listed as follows:

[0034] Figure 3 The English and abbreviations of each element of the pPICZαA-Bmh2 vector map are listed as follows: Example 1 Preliminary expression of snake venom thrombin agkihpin The application selects agkihpin (GenBank: AGK44857.1) protein as the target protein expressed by Pichia pastoris. The nucleotide sequence encoding agkihpin is designed, codon optimized for Pichia pastoris and 6 histidine tag sequences are added, and the nucleic acid molecule is artificially synthesized. The original sequence of agkihpin and the specific nucleic acid sequence after optimization are shown in SEQ ID NO. 6 and SEQ ID NO. 7.

[0035] The expression vector is selected as pAO815α. The vector is modified from the commonly used commercial yeast expression vector pAO815, and a secretion signal peptide α-factor is added by homologous recombination method, so that the protein can be expressed extracellularly. The vector contains a selection marker HIS4, which is convenient for multi-strategy integration to improve the protein expression amount; the affinity tag of 6 histidines is introduced at the C-terminal of the protein, which can be purified by nickel affinity column; the vector resistance is AmpR.

[0036] The synthetic agkihpin gene is constructed into the pPIC9K backbone vector through Avri I and Not I restriction sites, to obtain the expression vector pPIC9K-agkihpin (vector map is shown in Figure 1 ). The expression vector pAO815α-agkihpin is obtained by constructing into the pAO815α backbone vector (see Figure 2 ).

[0037] A series of successfully constructed vectors are subjected to single enzyme digestion using Sal I, and are electroporated into Pichia pastoris GS115 strain, and are screened by using MD solid plate. Single colonies on the plate are randomly selected and inoculated in 5 mL YPD liquid medium, and are cultured for 16 h. The genomic DNA of the single clone is extracted for PCR verification. The positive clone strain is inoculated in 50 mL BMMY medium (initial pH 6.0) for culture, and is subjected to shake flask fermentation by using a shaker at 30°C and 250 rpm / min. 100% methanol is added every 24 h, and the final methanol concentration is 1% (v / v), and the expression is induced for 96 h. 12% precast gel and corresponding electrophoresis buffer are used for SDS-PAGE electrophoresis detection (see Figure 4 ) and Western Blot (see Figure 5 ).

[0038] SDS-PGAE result detection of recombinant agkihpin protein: the electrophoresis result shows that there are diffused protein expression bands in the range of 25-45 kDa molecular weight, and the bands are homogenized after glycosidase treatment, indicating that the diffused protein is recombinant agkihpin protein, which shows that the recombinant agkihpin protein is successfully expressed in Pichia pastoris.

[0039] Preparation of agkihpin crude enzyme solution in Example 2 Take 50 mL of yeast induction liquid supernatant into a 250 mL beaker, and place it on ice to cool to 0°C. Set the speed of the magnetic stirrer to 150 rpm. According to the 0°C ammonium sulfate saturation table, slowly add a small amount of ammonium sulfate powder each time until the saturation of ammonium sulfate is 50%, 60%, 70%, 80%, and 90%. Four degrees are placed overnight, 12000 rpm, centrifuged for 20 min, and the precipitate is collected. Add 1 mL of Tris-HCl (pH 8.0) to dissolve the precipitate, and take 10 ul of protein solution for SDS-PAGE electrophoresis. The optimal ammonium sulfate precipitation concentration is 70%, and the experimental results are shown in the following table: Figure 7 .

[0040] Example 3: Increasing the expression of agkihpin by increasing the copy number of target protein Increasing the copy number of the target gene can effectively improve the expression level of the target protein. In this application, different copy numbers of agkihpin expression vectors were constructed by biological brick method to test the effect of multiple copies of agkihpin on the expression amount, and the optimal copy number was selected. The construction method of multiple copy vectors is referred to: Patent Publication No. CN105647959A, entitled "A method for constructing a yeast multiple copy expression vector", published on June 7, 2016. The same tail enzyme BamH I and Bgl II were used.

[0041] Example 4: Identification of the copy number of recombinant agkihpin engineering strain According to the method disclosed in Patent Application CN103981112A, the specific steps are as follows: Respectively construct plasmids containing target genes and internal reference genes; respectively according to the AOX1 promoter sequence of Pichia pastoris and the DNA sequence of single copy 3-phosphoglyceraldehyde dehydrogenase gene (GAPDH) in the genome of Pichia pastoris GS115, use VectorNTI 11.3 software to design primers, GAPDH-F: TTCACCACTTTGGAGGGTGC, GAPDH-R: GGAGTGGACGGTGGTCATCA; OAX-F: TAGGCTACTAACACCATGAC, OAX-R: GTTCATCTTGGATGAGATCA, respectively amplify DNA fragments of about 237 bp of each gene, and connect them to pEASY-E1 vector by blunt end. Get standard plasmids pEASY-E1-OAX1 and pEASY-E1-GAPDH. The operation method is referred to the blunt end cloning kit of pEASY-E1.

[0042] The copy number of the target gene and the internal reference gene is calculated by formula; the above-mentioned plasmid is linearized by Sac I enzyme cutting, and the concentration is measured by nucleic acid micro-detection instrument after gel recovery. First, according to the calculation of the absolute copy number of the standard plasmid: plasmid sample copy number (copies / μL) = A260*volume*Avogadro constant*dilution multiple / (660*plasmid base number) The linearized plasmid is diluted to a concentration of 10 8 copies / ul, and then diluted according to 10 1 , 10 2 , 10 3 , etc. The diluted plasmid DNA is used as a template for qPCR to establish a standard curve. The qPCR system is prepared according to the PerfectStart Green qPCR SuperMix instruction manual of Beijing Quanshijin Company, and the reaction conditions are set.

[0043] qPCR reaction system

[0044] qPCR reaction conditions

[0045] The Ct value obtained by qPCR is used to construct a standard curve with the corresponding copy number logarithm, and the standard curve equation is calculated, and the results are as follows Figure 11 .

[0046] Calculation of the copy number of the agkihpin gene in the genome of the transformant: the genome of the obtained single clone transformant with different G418 resistance is used as a sample template, and the real-time fluorescent quantitative PCR reaction is carried out according to the reaction system in (1) above. The Ct value obtained is brought into the standard curve equation to calculate the absolute copy number of the target gene and the internal reference gene in each sample, and then the target is calculated according to the following formula.

[0047]

[0048]

[0049] Real-time fluorescent quantitative PCR results of transformants Table 1 agkihpin copy number in different recombinant strains

[0050] As can be seen from the table, the selected transformants have 1 copy, 2 copies, 3 copies, 4 copies, 5 copies and 6 copies.

[0051] Comparison of shake flask fermentation of agkihpin strains with different copies The recombinant strains with 1, 2, 3, 4, 5, and 6 copies of the target gene were selected for methanol fermentation, and the expression levels of different transformants were compared. The specific method is referred to the steps of Example 1.

[0052] The induction fermentation results of different copy number transformants screened in this example are shown in the following table: Figure 8 As can be seen from the figure, the expression level of single copy agkihpin is the lowest, and the expression levels of transformants with more than 2 copies are not much different.

[0053] The experimental results show that increasing the copy number of the target gene can improve the expression level of heterologous protein in the strain, but when the copy number of the target gene exceeds 2, the improvement of the expression level of the target protein is limited. After comprehensive comparison, it is considered that the 2-copy transformant has good application potential under the condition of no auxiliary factor.

[0054] The level of transcription is not only related to the promoter, but also closely related to the copy number of the target gene in the expression host. Optimizing the copy number of the target gene can achieve the highest level of protein expression. Generally, the more the copy number of the target gene, the higher the yield of the protein. More and more studies have shown that within a certain copy number range, the yield of the protein is positively correlated with the copy number of the gene. Beyond this copy number range, even if the copy number is increased, it will not help to increase the yield of the protein, and even will lead to the decrease of the yield of the target protein. Therefore, optimizing the copy number of the target protein is of great significance to improve the expression level of the protein.

[0055] Example 4: Co-expression of agkihpin with auxiliary factor Bmh2 to improve the expression level of agkihpin In Pichia pastoris expression, the overexpression of heterologous proteins often leads to saturation or overload of the secretion pathway. This phenomenon usually occurs in the endoplasmic reticulum (ER), where the transport of proteins from ER to Golgi body is usually the rate-limiting step. At present, by co-expressing molecular chaperones or other auxiliary proteins with target genes to alleviate the burden of endoplasmic reticulum, it has become a common strategy to improve protein yield and activity. In this invention, agkihpin and auxiliary factor Bmh2 are co-expressed to further improve the expression level of agkihpin of snake venom thrombin.

[0056] The auxiliary factor Bmh2 was cloned into the expression vector pPICZαA, and the construction method is referred to: According to the gene sequence of the auxiliary protein, the primers Bmh2-F / R were designed to amplify the Bmh2 gene of Pichia pastoris GS115. The PCR product was purified by gel recovery and then double-digested with BstBI and NotI. The expression vector pPICZαA was also double-digested with BstBI and NotI. The gene fragment and the vector fragment were ligated at 16°C overnight, and the ligation product was used to transform the DH5α competent cells. The LLB plates containing zeocin (25 μg / mL) were used for screening, and the positive clones were verified by colony PCR. The positive clones were sent to Guangzhou Qikexin for sequencing, and finally the recombinant vector pPICZαA-Bmh2 with correct sequence was obtained (see Figure 3 ).

[0057] The recombinant plasmid was linearized with SacI and then transformed into the competent cells. The recombinant bacteria were plated on the YPDS plates containing 200 μg / mL of zeocin for screening.

[0058] After 96 h of methanol induction, the supernatant of the fermentation broth was collected and analyzed by SDS-PAGE and Western Blot. The relative secretory expression amount was also calculated. Bmh2 can significantly improve the expression level of agkihpin, and the expression amount is increased by 68%. The above experimental results show that Bmh2, as a key auxiliary protein of the protein secretion pathway, has a significant promoting effect on the expression of agkihpin. The experimental results are shown in Figure 9 .

[0059] Example 5: Effect of gene dosage of Bmh2 on the expression level of agkihpin The linearized recombinant plasmid pPICZαA-Bmh2 was introduced into the recombinant strains containing 3 copies, 6 copies, and 9 copies of agkihpin by electroporation. Zeocin was used for preliminary screening. The absolute fluorescent quantitative PCR method was used to determine the copy number of Bmh2 gene in the recombinant strains. The recombinant strains containing different copies of agkihpin and Bmh2 were successfully screened.

[0060] The recombinant strains containing different copies of agkihpin and Bmh2 are shown in Table 2 Table 2: Recombinant strains containing different copies of agkihpin and Bmh2

[0061] The recombinant strains containing different copies of agkihpin and Bmh2 were induced in a shake flask according to Example 1.

[0062] The experimental results show that when the copy number of Bmh2 gene in the co-expression strain is 1, the expression amount of agkihpin gene is increased to different degrees regardless of the change of the copy number of agkihpin gene. Specifically, 1 copy of Bmh2 makes the expression amount of the recombinant strain increased by 68%, and 2 copies of Bmh2 further increases the expression amount by 80%. However, when the copy number of Bmh2 is increased to 3, not only the expression of agkihpin in the recombinant strain is not promoted, but also the expression amount of agkihpin is decreased. The statistical results are attached Figure 10 Therefore, pAO815α-3agkihpin-2Bmh2 / GS115, pAO815α-6agkihpin-2Bmh2 / GS115 and pAO815α-9agkihpin-2Bmh2 / GS115 are the optimal strains for expressing the snake venom thrombin agkihpin obtained by the present application.

[0063] Example 6: Optimization of expression conditions to increase the expression amount The culture conditions of the strain are also important factors affecting the expression amount of protein in the Pichia pastoris expression system. In the culture conditions of the strain, the initial pH value of the culture medium, the methanol addition amount, the induction time, the induction temperature and other parameters are the most important influencing factors.

[0064] According to the Pichia pastoris expression manual, the present application first sets the reference culture conditions of the strain as follows: the initial pH value of the culture medium is 6.0, the initial OD value is 2, the methanol addition amount is 0.5%, the induction time is 24 h, and the induction temperature is 22°C. Then, each parameter is tested and optimized one by one, and the set values of each parameter during the test are shown in Table 3, and the results are shown in Table 4. 600 Figure 6 The specific culture and induction expression operation steps of the strain are referred to Example 1.

[0065] Table 3: Optimization parameters of the culture conditions of the snake venom thrombin protein agkihpin expression strain

[0066] Using pAO815α-6agkihpin / GS115 and pAO815α-6agkihpin-2Bmh2 / GS115 as test strains, the optimal parameter conditions are determined by changing each parameter one by one under the reference culture conditions of the strain, as follows: the initial pH value of the culture medium is 6.0, the initial OD value is 2, the methanol addition amount is 0.5%, the induction time is 96 h, and the induction temperature is 28°C. 600

[0067] ​​The above merely describes the preferred embodiments of the present application, and it should be pointed out that, for those skilled in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.

Claims

1. A carrier for a snake venom thrombin, characterized in that, Any one of the following: i) a pPIC9K-agkihpin vector, the nucleic acid sequence of which is shown as SEQ ID NO: 1; ii) a pAO815α-agkihpin vector, the nucleic acid sequence of which is shown as SEQ ID NO: 2; iii) a pAO815α-2agkihpin vector, the nucleic acid sequence of which is shown as SEQ ID NO: 3; iv) a pAO815α-3agkihpin vector, the nucleic acid sequence of which is shown as SEQ ID NO:

4.

2. The carrier of snake venom thrombin as described in claim 1, characterized in that, The enzyme cutting site of the pPIC9K-agkihpin vector is Avr I and Not I.

3. The carrier of snake venom thrombin as described in claim 1, characterized in that, The pAO815α-agkihpin vector is obtained by modifying the secretion signal peptide α-factor of the yeast expression vector pAO815 by homologous recombination, and the vector contains a screening marker HIS4.

4. A combination of vectors, characterized in that: The combination of the vector of claim 1 and pPICZαA-Bmh2; the sequence of the pPICZαA-Bmh2 vector is shown as SEQ ID NO:

5.

5. A yeast engineering bacterium, characterized in that, The expression vector of claim 1 or the combination of vectors of claim 4.

6. The engineered yeast strain as described in claim 5, characterized in that, The engineering bacteria were preserved in the Guangdong Microbial Culture Collection Center on September 25, 2025, and the preservation number is GDMCC No: 67025.

7. The engineered yeast strain as described in claim 6, characterized in that, The yeast engineering bacteria host is Pichia pastoris GS115.

8. The engineered yeast strain as described in claim 6, characterized in that, The yeast engineering bacteria also include engineering bacteria with 3-9 copies of the agkihpin gene and 1-2 copies of the Bmh2 gene.

9. A method for expressing a heterologous protein by using the engineered yeast strain of claim 5 or 6, wherein the method comprises the steps of: a) cultivating the engineered yeast strain of claim 5 or 6 in a culture medium; and b) recovering the heterologous protein expressed by the engineered yeast strain. During bacterial culture, the initial pH of BMMY medium was 5.0, which initiated OD induction. 600 =2, the amount of methanol added as an inducer was 1.5% (v / v), the amount of casein added was 2% (w / v), the induction time was 96h, and the induction temperature was 25℃.

10. The method of claim 9, wherein, The following steps are included: (1) introducing the expression vector of claim 1 into Pichia pastoris competent cells by electroporation to obtain yeast recombinant genetically engineered bacteria containing the above expression vector; (2) inoculating the yeast recombinant genetically engineered bacteria obtained in step (1) into YPD liquid medium and culturing for a certain period of time; (3) inoculating an appropriate amount of recombinant genetically engineered bacteria into YPG medium with initial pH = 5.0, setting appropriate rotation speed and temperature, and culturing for a certain period of time; (4) Centrifuge to collect the cells and re-suspend in BMMY medium to a final OD 600 of 2, add anhydrous methanol to a final methanol concentration of 1.5% (v / v) at regular intervals, set the appropriate rotation speed in a shaker, and induce expression for the appropriate time at the appropriate temperature.

Images