Application of broad-spectrum sexual disease-resistant gene Atbis6

Abstract

The invention discloses an application of a broad-spectrum sexual disease resistance gene Atbisr6. The knockout arabidopsis Atbisr6 gene is applied to improvement of the resistance of plants to pathogenic bacteria. A homozygous mutant plant of the gene is obtained by screening and identifying a mutant of the gene constructed by a T-DNA insertion method, the growth phenotype of the mutant plant is observed, and inoculation experiments are performed on the mutant plant by using sclerotinia sclerotiorum, botrytis cinerea, pseudomonas syringae tomato pathogenic variants and plasmodiophora brassicae. The result shows that the growth of the Atbisr6 mutant is not influenced, the Atbisr6 mutant has obvious resistance to sclerotinia sclerotiorum, botrytis cinerea, pseudomonas syringae and plasmodiophora brassicae, and the scab area and the pathogenic bacterium biomass of the Atbisr6 mutant are obviously lower than those of a wild plant. Therefore, the S gene Atbis6 of arabidopsis thaliana can be used as a potential gene resource, and is applied to a green prevention and control strategy of sclerotinia rot of colza by knocking out the modified gene or inhibiting the expression of the modified gene.

Description

Technical Field

[0001] This invention belongs to the field of bio-agricultural technology and relates to the application of the broad-spectrum resistant viral gene Atbir6. Background Technology

[0002] Rapeseed (Brassica napus L. AACC, 2n=38), originating from the Mediterranean region, is one of the world's major oilseed crops. Due to its high oil content, stable yield, and potential for increased production, it has been widely cultivated. Currently, rapeseed is one of my country's major oilseed crops, an important honey source and traditional ornamental plant, and a pioneer crop for vegetables, green manure, and saline-alkali land management. However, throughout its growth period, rapeseed is affected not only by drought, low temperatures, and soil salinization, but also by various pathogens, insects, and weeds, severely impacting the quality of the rapeseed.

[0003] Sclerotinia stem rot, caused by *Sclerotinia sclerotiorum*, is a common disease affecting rapeseed. It can occur at any stage of growth and in any part of the plant, reducing survival rates and yield. In severe cases, economic losses can exceed 80%. Clubroot disease, caused by *Cladosporium brassicum*, primarily damages the roots of rapeseed. Clubroot infection impairs the plant's absorption of water and nutrients, leading to slower growth and a significant reduction in yield. On average, yield losses can reach 50%, and in severely affected fields, complete crop failure is possible.

[0004] Currently, using molecular techniques to breed disease-resistant varieties has become an economical and effective control strategy. Plants contain some susceptibility genes (S), which may facilitate the invasion of pathogens.

[0005] Currently, the disease resistance-related functions of some plant susceptibility genes have been publicly reported. Researchers have, to some extent, enhanced the disease resistance of specific plants by regulating these known susceptibility genes, providing valuable insights and directions for plant disease resistance breeding. However, plant gene families are diverse and their functions are highly specific. The mechanisms of action of different genes vary significantly across different plant species or under different disease stresses. For the Atbir6 gene, its specific function, its relationship to the disease resistance process, and how it affects plant responses to pathogens remain unclear, and there are currently no research conclusions to draw upon. Therefore, it is impossible to predict its function based on existing research findings on susceptibility genes.

[0006] As a model plant, Arabidopsis thaliana's gene function studies are often used to infer the functions of homologous genes in other Brassicaceae plants. Arabidopsis thaliana and rapeseed both belong to the Brassicaceae family and share high genome homology. Studying Arabidopsis gene function can provide important references for the functional study of rapeseed homologous genes. For example, the Arabidopsis AtZntB1 gene has been shown to participate in magnesium ion transport, and the cloning and functional verification of its rapeseed homologous gene also showed a similar mechanism. When the Arabidopsis miR395d precursor gene was introduced into rapeseed through Agrobacterium-mediated transformation, the transgenic plants exhibited sulfur metabolism regulation characteristics similar to those of Arabidopsis thaliana. Arabidopsis glucosinolate metabolism-related genes (such as AOP3 and BZO1) and rapeseed homologous genes (BnMAM1 and BnCYP83A1) show functional similarity, both participating in glucosinolate synthesis pathways. Summary of the Invention

[0007] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing an application of the broad-spectrum anti-sex disease gene Atbir6.

[0008] The objective of this invention can be achieved through the following technical solutions:

[0009] The application of knocking out the Arabidopsis thaliana Atbir6 gene in improving plant resistance to pathogens, wherein the CDS sequence of the Arabidopsis thaliana Atbir6 gene is shown in SEQ ID NO.1, the cDNA sequence is shown in SEQ ID NO.2, and the encoded protein amino acid sequence is shown in SEQ ID NO.3.

[0010] Preferably, the plant is selected from Arabidopsis thaliana, rapeseed, or tomato.

[0011] Preferably, the pathogen is selected from pathogenic fungi or bacteria, with the pathogenic fungi preferably being *Sclerotinia sclerotiorum*, *Botrytis cinerea*, or *Plasmodiophora brassicae*, and the pathogenic bacteria being *Pseudomonas syringae*, a pathogenic species of tomato.

[0012] Preferably, the knockout of the Arabidopsis thaliana Atbir6 gene is achieved through T-DNA insertion or gene editing.

[0013] The application of knocking out the Arabidopsis thaliana Atbir6 gene in the prevention and control of plant diseases caused by pathogenic fungi or bacteria, wherein the CDS sequence of the Arabidopsis thaliana Atbir6 gene is shown in SEQ ID NO.1.

[0014] Preferably, the plant is selected from Arabidopsis thaliana, rapeseed, or tomato.

[0015] Preferably, the pathogen is selected from pathogenic fungi or bacteria, with the pathogenic fungi preferably being *Sclerotinia sclerotiorum*, *Botrytis cinerea*, or *Plasmodiophora brassicae*, and the pathogenic bacteria being *Pseudomonas syringae*, a pathogenic species of tomato.

[0016] Preferably, the knockout of the Arabidopsis thaliana Atbir6 gene is achieved through T-DNA insertion or gene editing.

[0017] The application of substances that knock out the Arabidopsis thaliana Atbir6 gene in the construction of transgenic plants resistant to pathogenic fungi or bacteria, wherein the CDS sequence of the Arabidopsis thaliana Atbir6 gene is shown in SEQ ID NO.1.

[0018] Preferably, the pathogen is selected from pathogenic fungi or bacteria, with the pathogenic fungi preferably being *Sclerotinia sclerotiorum*, *Botrytis cinerea*, or *Plasmodiophora brassicae*, and the pathogenic bacteria being *Pseudomonas syringae* tomato pathogenic species; the plant is selected from *Arabidopsis thaliana*, rapeseed, or tomato.

[0019] Beneficial effects:

[0020] This invention selected the Atbir6 S gene of Arabidopsis thaliana as the research object. Mutants of this gene constructed using the T-DNA insertion method were screened and identified, resulting in homozygous mutant plants. The study showed that the Atbir6 S gene encodes a pentapeptide repeat (PPR) protein related to intron 1 splicing of the mitochondrial nad7 transcript. Knockout of the Atbir6 gene mutants showed enhanced resistance to *Phytophthora parasitica*, *Botrytis cinerea*, *Rhizoctonia solani*, and *Phytophthora capsici* (Yang et al. 2022). The growth phenotype of the mutant plants was observed, and inoculation experiments were conducted using *Sclerotinia sclerotiorum* 1980, *Botrytis cinerea* B05.10, *Pseudomonas syringae* pv. *tomato* DC3000, and *Plasmodiophora brassica*. The results showed that the growth of the Atbir6 mutant was not affected, and it exhibited significant resistance to *Sclerotinia sclerotiorum*, *Botrytis cinerea*, *Pseudomonas syringae*, and *Plasmodium*. The lesion area and pathogen biomass of the Atbir6 mutant were significantly lower than those of the wild-type plant. This indicates that the *Arabidopsis thaliana* S gene Atbir6 can serve as a potential gene resource, and its knockout or inhibition could be used in a green control strategy for *Sclerotinia sclerotiorum* in rapeseed. Attached Figure Description

[0021] Figure 1 Schematic diagram of T-DNA primer design principle

[0022] Figure 2 Validation of homozygosity and phenotype of the Arabidopsis mutant Atbir6

[0023] (A) Lane 1: Mark; Lanes 2 & 3: Wild-type Arabidopsis thaliana Col-0; Lanes 4 & 5: Mutant Arabidopsis thaliana Atbir6; LP & RP: Primers flanking the T-DNA insertion site on the plant genome; BP: Primers on the T-DNA segment. (B) Phenotypes of Arabidopsis thaliana at different growth stages. Top: Root length phenotype 7 days after germination on 1 / 2 MS medium; Middle: Arabidopsis thaliana phenotype at approximately 4 weeks; Bottom: Phenotype of Arabidopsis thaliana during bolting and flowering; Scale bar: 3 cm. (C) Statistical data on Arabidopsis thaliana phenotypes. Top: Root length statistics 7 days after germination on 1 / 2 MS medium (n=6); Bottom: Thousand-seed weight statistics of Arabidopsis thaliana (n=6).

[0024] Figure 3 Resistance analysis of mutant Atbir6 to Sclerotinia sclerotiorum 1980

[0025] (A) Phenotypic leaves of Arabidopsis thaliana after live inoculation with Sclerotinia sclerotiorum 1980 (36 h). (B) Statistics on the area of ​​lesions in Arabidopsis thaliana after inoculation with Sclerotinia sclerotiorum 1980 (36 h) (n=20).

[0026] Figure 4 Resistance analysis of mutant Atbir6 to Botrytis cinerea B05.10

[0027] (A) Phenotypic leaves of Arabidopsis thaliana after inoculation with Botrytis cinerea B05.10 (36 h). (B) Statistics on the area of ​​lesions in Arabidopsis thaliana after inoculation with B05.10 (36 h) (n=20)

[0028] Figure 5 Resistance analysis of mutant Atbir6 to Pst DC3000

[0029] (A) Disease phenotype 5 days after inoculation of Arabidopsis thaliana with bacteria Pst DC3000. (B) Statistical analysis of bacterial count in Arabidopsis thaliana leaves 72 h after inoculation.

[0030] Figure 6 Resistance analysis of mutant Atbir6 to clubroot bacteria

[0031] (A) Disease phenotype 23 days after inoculation with *Plasmodiophora stylosa* in *Arabidopsis thaliana*. (B) Disease index of wild-type Col-0 and mutant Atbir6 23 days after inoculation with *Plasmodiophora stylosa*. (C) Statistical analysis of relative biomass expression in *Arabidopsis thaliana* roots 23 days after inoculation with *Plasmodiophora stylosa*. Detailed Implementation

[0032] Test plants and culture conditions

[0033] The tested pathogenic microorganisms, including *Sclerotinia sclerotiorum* 1980, *Botrytiscinerea* B05.10, *Pseudomonas syringae* pv. tomato DC3000 (Pst DC3000), and *Plasmodiophora brassica*, were all preserved in the laboratory.

[0034] Test plants: Arabidopsis thaliana: Col-0 (preserved in the laboratory), mutant Atbir6 (AT3g48250) (purchased from https: / / www.arashare.cn / index / Product / index.html), constructed using the T-DNA insertion method.

[0035] Culture conditions for pathogenic microorganisms: Sclerotinia sclerotiorum 1980 was activated and cultured on PDA medium at 20℃; Botrytis cinerea B05.10 was activated and cultured on PDA medium at 20℃; Pst DC3000 was activated and cultured on King'SB (Kana, Rif) medium at 28℃; clubroot spores were extracted from the diseased parts of rapeseed with clubroot disease.

[0036] Plant culture conditions: Arabidopsis thaliana was cultured in a plant culture room under the following conditions: 22℃, 12 h light, 12 h dark, and 75% relative humidity.

[0037] Example 1: Verification of homozygosity and phenotype of Arabidopsis mutants

[0038] To determine whether the obtained Arabidopsis seeds were homozygous mutants, this embodiment analyzes the impact of gene deletion on the agronomic traits of the plant itself.

[0039] Validation of homozygosity of Arabidopsis mutants: Using Arabidopsis mutant genomic DNA as a template, the conventional CTAB method was employed for extraction. Specifically: 100 mg of fresh leaf samples were placed in a clean 2.0 mL centrifuge tube, sterile steel beads were added, and the samples were rapidly ground into a dry powder using liquid nitrogen. 700 μL of 2% CTAB extraction buffer was added and inverted to mix. The sample was then placed in a 65℃ water bath for 30 min (inverting every 10 min). Centrifugation was performed at 12000 r / min for 10 min. 500 μL of the supernatant was transferred to a new 2.0 mL centrifuge tube, and 500 μL of DNA extraction phenol and chloroform were added respectively. The mixture was thoroughly mixed and centrifuged at 12000 r / min for 10 min. 400 μL of the supernatant was transferred to a new 1.5 mL centrifuge tube, and an equal volume of isopropanol was added and mixed. The mixture was incubated at -20℃ for 20-30 min, centrifuged at 12000 r / min for 10 min, and the supernatant was discarded. Add 700 μL of 75% ethanol to wash the precipitate, centrifuge at 12000 r / min for 1 min, discard the supernatant, repeat once, let the precipitate air dry at room temperature, add 30 μL of dd H2O to dissolve, and take 1 μL as a template for PCR positive detection.

[0040] Homozygous genotypes of Arabidopsis mutants were detected using the three-primer method (LP, BP, RP).

[0041] Atbir6-LP:AGCTAGCCTCGTCCTCTCAC

[0042] Atbir6-RP:TTGCAGTCTCGTGTGTCAAAG

[0043] General-BP: ATTTTGCCGATTTCGGAAC

[0044] The principle of the three-primer method is to design an upstream primer LP and a downstream primer RP at positions 200 bp-400 bp on either side of the insertion site, and a specific primer BP on the T-DNA insert. Two pairs of reactions are set up: one using primers LP and RP, and the other using primers BP and RP. In the former reaction, wild-type (WT) and heterozygous mutant plants (HZ) can both amplify bands; in the latter reaction, homozygous mutant plants (HM) and heterozygous mutant plants (HZ) can amplify bands. Because no T-DNA insertion occurred on either chromosome of the WT target gene, only the LP to RP PCR product could be amplified; T-DNA insertion occurred on both chromosomes of the HM target gene, so products amplified using BP and RP as primers could be obtained, but because the inserted T-DNA fragment was too long, it inhibited the formation of the target gene-specific amplification product, so the LP to RP PCR product could not be amplified; the HZ target gene had T-DNA insertion on only one chromosome, so products from both reactions could be obtained. The results showed that the identified plant was a homozygous mutant plant. Figure 2 A).

[0045] Phenotypic observation of the Arabidopsis mutant Atbir6: Seeds of Arabidopsis thaliana that were verified to be homozygous were collected. A portion of the seeds were disinfected with 75% alcohol for 15 min, washed more than 3 times with sterile dd H2O in a laminar flow hood, and vernalized for 3 days at 4℃ with a portion of dd H2O remaining. The seeds were then sown on 1 / 2 MS plates in a laminar flow hood and sealed. The seeds were placed in a plant culture room for 7 days to observe the differences in root length among different mutants. The seedlings were transplanted to small cups with nutrient soil (imported soil: domestic soil: vermiculite = 8:4:1), marked, and continued to be cultured. The differences in leaf phenotype and plant differences among mutants were observed in the third and fourth weeks. The differences in bolting period among mutants were observed in the fifth and sixth weeks. After bolting, the plants were managed in a 25℃ culture room and the seeds were collected to test whether the mutation of the target gene affected the plant's own growth phenotype. The results showed that: the root length of the mutant Ataf1 was not significantly different from that of the wild-type Col-0 during the seedling stage; the growth status of the mutant plants was not significantly different from that of the wild-type Col-0 at about 4 weeks; and the phenotype of the mutant was not significantly different from that of the wild-type Col-0 at the bolting and flowering stage. Figure 2 (B and C). The results showed that mutations in the Ataf1 gene had no significant effect on agronomic traits in Arabidopsis thaliana.

[0046] Example 2

[0047] 2.1 Analysis of the resistance of Arabidopsis mutant Atbir6 to Sclerotinia sclerotiorum and Botrytis cinerea

[0048] Culture of Sclerotinia sclerotiorum and Botrytis cinerea: Using an inoculation needle, take wild-type Sclerotinia sclerotiorum 1980 or wild-type Botrytis cinerea B05.10 hyphal blocks and inoculate them onto 90 mm diameter PDA medium with the hyphal side down. Incubate in a fungal culture room at 20°C for three consecutive generations of activation. Using a punch, take fresh hyphal blocks from the edge and place them onto 17.5 mL of 2×SY medium with a diameter of 90 mm. Incubate in a fungal culture room at 20°C for 36 h.

[0049] Inoculation and disease detection of *Sclerotinia sclerotiorum* and *Botrytis cinerea*: Homozygous *Arabidopsis thaliana* mutants were cultured in small cups containing nutrient soil and kept in a plant culture room for about four weeks. Mycelial blocks from 2×SY medium were taken using a 3 mm punch and inoculated onto the right side of the leaves of the homozygous *Arabidopsis thaliana* mutants near the veins, ensuring moisture retention. After 36 h of inoculation with 1980 medium and 48 h after inoculation with B05.10 medium, the diameter of the lesions was measured using the cross-sectional method, and the lesion area was calculated. The experiment was repeated three times.

[0050] The results showed that the lesion area of ​​wild-type Col-0 was 116.61 mm. 2 The lesion area of ​​the Atbir6 mutant was approximately 68.81 mm. 2 about( Figure 3 (A and B). The above results indicate that the lesion area of ​​the mutant Atbir6 is significantly smaller than that of the wild-type Col-0, proving that the mutant Atbir6 has strong resistance to Sclerotinia sclerotiorum 1980.

[0051] Statistical analysis was performed on Botrytis cinerea B05.10 mycelial blocks 48 h after inoculation. The results showed that the lesion area of ​​wild-type Col-0 was 101.65 mm. 2 The lesion area of ​​the Atbir6 mutant was approximately 49.01 mm. 2 about( Figure 4 (A and B). The above results show that the resistance results of inoculation with Botrytis cinerea B05.10 are similar to those of inoculation with 1980. The lesion area of ​​mutant Atbir6 is significantly smaller than that of wild-type Col-0, indicating that mutant Atbir6 also has strong resistance to Botrytis cinerea B05.10.

[0052] 2.2 Detection of resistance of Arabidopsis thaliana mutant Atbir6 to Pseudomonas syringae Pst DC3000

[0053] Culture of *Pseudomonas syringae* Pst. DC3000: Pst. DC3000 culture was streaked onto King's B (Kana, Rif) solid medium and incubated at 28°C for two days until single colonies appeared. Single colonies were then incubated in 500 μL King's B (Kana, Rif) liquid medium until turbidity was reached. The medium was then diluted 1:1000 and incubated overnight until OD600 = 1.0. The cells were collected by centrifugation at 4000 r / min for 10 min, washed twice with 10 mM MgCl2, and resuspended in 10 mM MgCl2 until OD600 was approximately 0.1. The concentration was then diluted to 1×10⁻⁶. 5。

[0054] Inoculation and disease incidence assay of Pseudomonas syringae Pst DC3000: The lower epidermis of Arabidopsis thaliana was injected with 1 mL syringe, the injection area of ​​the leaf was marked, and samples were taken at 0 h and 72 h after injection to detect the number of bacteria in the leaf. The experiment was repeated three times.

[0055] Leaves of wild-type Col-0 and mutant Atbir6 were inoculated with Pst DC3000 for about 4 weeks. After 5 days, phenotypic observation showed that Col-0 leaves had more yellow spots, and the leaves turned pale and yellow. In contrast, the leaves of mutant Atbir6 showed less yellowing, and no obvious yellowing was observed at the midrib. The disease was milder than that of wild-type Col-0. Figure 5 A). Simultaneously, the number of bacteria in leaves 72 h after Pst DC3000 inoculation was counted, and it was found that the number of bacteria in the mutant leaves 72 h was significantly reduced compared to the wild-type Col-0. Figure 5 B). The above results indicate that the Atbir6 mutant has a strong resistance to Pst DC3000.

[0056] 2.3 Resistance analysis of Arabidopsis mutant Atbir6 to clubroot bacteria

[0057] Extraction of dormant spores of *Plasmodiophora stylosa*: Chop 10 g of clubroot tissue, add 50 mL of sterile water, and grind finely in a mortar or juicer; filter through four layers of gauze, transfer the filtrate to a clean 50 mL centrifuge tube, centrifuge at 3100 r / min for 15 min, and discard the supernatant; redissolve the precipitate in 50 mL of sterile water, centrifuge at 3100 r / min for 10 min, this step can be repeated 2-3 times. Discard the supernatant; add 5 mL of 50% sucrose solution to the precipitate, mix well, and centrifuge at 3100 r / min for 10 min; carefully transfer the supernatant to a clean centrifuge tube using a pipette, add 30 mL of sterile water, centrifuge at 3100 r / min for 10 min, and discard the supernatant; redissolve the precipitate in 30 mL of sterile water, centrifuge at 3100 r / min for 10 min, this step can be repeated 2-3 times. The precipitate is dissolved in 5 mL of sterile water for later use; it can be stored at 4℃ protected from light.

[0058] Inoculation with *Plasmodiophora stylosa*: After culturing *Arabidopsis thaliana* or *Brassica napus* for approximately 2 weeks (14 days), use a pipette to take 1 mL of a 1×10⁻⁶ solution. 6 Or 1×10 7 / mL of dormant spores of *Plasmodiophora* were applied to the roots of the plants for inoculation, and the disease index was recorded 21 days after inoculation.

[0059] Clubroot disease severity index statistical standards: According to the five-level grading standard, level 0 is no disease; level 1 is mainly a very small number of tumors on lateral roots, and the damage to the main root is negligible; level 2 is full of small tumors on the main root and a few lateral roots; level 3 is medium to large spherical tumors on the main root; level 4 is severe tumors on lateral roots and main root, the main root is completely swollen, and the fine roots on the lateral roots are completely damaged; level 5 is complete swelling and rot of the root.

[0060] Total DNA extraction from clubroot: Clean the diseased roots of clubroot, cut them into small pieces, place them in a clean mortar, flash-freeze with liquid nitrogen, grind thoroughly, and transfer to a 2 mL centrifuge tube. Add 800 μL of 2% CTAB extraction buffer preheated to 65 °C, quickly invert to mix, and incubate at 65 °C for 15-30 min, gently inverting to mix every 5 min. Add 400 μL of chloroform and Tris-saturated phenol solution to the mixture, and centrifuge at 12000 r / min for 15 min. Transfer 500 μL of the supernatant to another 2 mL centrifuge tube, add an equal volume of chloroform for extraction again, centrifuge at 12000 r / min for 15 min, take 450 μL of the supernatant, add an equal volume of isopropanol, mix, and precipitate at -20 °C for 10-15 min. Centrifuge at 12000 r / min for 15 min, discard the supernatant and keep the precipitate, wash the precipitate twice with 1 mL of 75% ethanol, and place at 37 °C. The DNA was dried in an oven at -20 °C, dissolved in 30 μL of deionized water (containing 25 µg / mL RNase A), and the DNA concentration was measured. The DNA was then stored at -20 °C (Allen et al 2006).

[0061] Detection of relative biomass of *Plasmodiophora* in diseased roots: *Arabidopsis* was inoculated according to the *Plasmodiophora* inoculation experimental method. Roots of diseased *Arabidopsis* were collected 23 days after inoculation as experimental material. Three diseased roots from each family were collected as one sample. Total DNA was extracted from the diseased roots of *Arabidopsis* with clubroot infection using the CTAB method. The DNA concentration was determined using Nanodrop, and the total DNA concentration was diluted to 100-200 ng / μL. Using the diluted DNA as a template, the content of the *Plasmodiophora* internal reference gene relative to the *Arabidopsis* internal reference gene was detected by qPCR. The relative biomass of *Plasmodiophora* was expressed as the content of the *Plasmodiophora* ACTIN gene (AY452179.1, primers: Pbactin-qF: CACCGACTACCTGATGAA, Pbactin-qR: CAGCTTCTCCTTGATGTC) relative to the *Arabidopsis* ACTIN2 gene (AT3G18780, primers: ACTIN2-qF: GCACCCTGTTCTTCTTACGGA, ACTIN2-qR: GTGAGACACACCATCACCAGA).

[0062] Statistical analysis was performed on live wild-type Col-0 and mutant Atbir6 inoculated with *Cladophora stylosa* for 23 days. The results showed that the disease index of wild-type Col-0 was 68.5, while that of mutant Atbir6 was 42.5. Figure 6A and B). The above results show that the disease index of the Atbir6 mutant was significantly lower than that of the wild-type Col-0, and the control efficacy against clubroot was 26%. By detecting the clubroot biomass in the diseased roots, we found that the clubroot biomass in the diseased roots of Atbir6 was significantly lower than that in Col-0. Figure 6 C). This indicates that the Atbir6 mutant enhances Arabidopsis thaliana's resistance to pathogens.

Claims

1. Application of knocking out the Arabidopsis thaliana Atbir6 gene in improving plant resistance to pathogens, wherein the CDS sequence of the Arabidopsis thaliana Atbir6 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The plants mentioned are selected from Arabidopsis thaliana, rapeseed, or tomato.

3. The application according to claim 1, characterized in that, The pathogens are selected from pathogenic fungi or bacteria. The preferred pathogenic fungi are *Sclerotinia sclerotiorum*, *Botrytis cinerea*, and *Plasmodiophora brassicae*. The pathogenic bacteria are *Pseudomonas syringae*, a pathogenic species of tomato.

4. The application according to claim 1, characterized in that, Knocking out the Atbir6 gene in Arabidopsis thaliana is achieved through T-DNA insertion or gene editing.

5. Application of knocking out the Arabidopsis thaliana Atbir6 gene in the prevention and control of plant diseases caused by pathogenic fungi or bacteria, wherein the CDS sequence of the Arabidopsis thaliana Atbir6 gene is shown in SEQ ID NO.

1.

6. The application according to claim 5, characterized in that, The plants mentioned are selected from Arabidopsis thaliana, rapeseed, or tomato.

7. The application according to claim 5, characterized in that, The pathogens are selected from pathogenic fungi or bacteria. The preferred pathogenic fungi are *Sclerotinia sclerotiorum*, *Botrytis cinerea*, and *Plasmodiophora brassicae*. The pathogenic bacteria are *Pseudomonas syringae*, a pathogenic species of tomato.

8. The application according to claim 5, characterized in that, Knocking out the Atbir6 gene in Arabidopsis thaliana is achieved through T-DNA insertion or gene editing.

9. Application of substances that knock out the Arabidopsis thaliana Atbir6 gene in the construction of transgenic plants resistant to pathogenic fungi or bacteria, wherein the CDS sequence of the Arabidopsis thaliana Atbir6 gene is shown in SEQ ID NO.

1.

10. The application according to claim 9, characterized in that, The pathogens are selected from pathogenic fungi or bacteria, with preferred pathogenic fungi being *Sclerotinia sclerotiorum*, *Botrytis cinerea*, or *Plasmodiophora brassicae*, and the pathogenic bacteria being *Pseudomonas syringae* tomato pathogenic species; the plants are selected from *Arabidopsis thaliana*, rapeseed, or tomato.

Images