Expression vector based on bovine-derived K5 gene and application thereof

Abstract

The invention relates to the technical field of animal breeding, in particular to an expression vector based on a bovine-derived K5 gene and application of the expression vector. The expression vector comprises an expression cassette, wherein the expression cassette comprises a 5'end regulation region of a bovine-derived K5 gene, an intron of a beta-globin gene, a target gene and a 3 'end regulation region of the bovine-derived K5 gene. An expression vector based on a bovine-derived K5 gene regulatory region and a beta-globin gene intron is obtained through research and used for specific expression in pig skin cells, and then a pig variety with specific characters is obtained through cultivation. Based on the expression vector, the pig with the black skin character is successfully prepared.

Description

Technical Field

[0001] This invention relates to the field of animal breeding technology, and in particular to an expression vector based on the bovine K5 gene and its application. Background Technology

[0002] Skin and hair pigmentation is an important biological trait in mammals. This trait is determined by the synthesis and distribution of melanin, which participates in regulating various interactions between the organism and its environment, such as ultraviolet protection, thermoregulation, and the recognition of visual signals within and outside the species. In certain species or breeds, skin pigmentation also has economic value. For example, some bird or mammal breeds possess special economic or cultural attributes due to their specific skin color (such as black).

[0003] In many major economic animals, such as pigs, cattle, and sheep, the skin phenotype is typically white without pigment. Currently, no major livestock breeds, such as pigs and cattle, have been reported to have naturally occurring black skin. Therefore, for specific applications where a black skin phenotype is desired, how to induce and maintain stable skin pigmentation in these animals through technological means is a technical problem that needs to be solved.

[0004] The development, migration, differentiation, and survival of melanocytes are precisely regulated by multiple signaling pathways and transcription factors. Existing research has identified some signaling pathways (such as WNT, MC1R, KIT, and EDN) and core transcription factors (such as MITF, SOX10, and PAX3) involved in this process. However, the key regulatory factors and molecular mechanisms for maintaining the long-term survival and functional activity of epidermal melanocytes in adult animals are not yet fully understood. This gap in understanding constitutes a major obstacle to the technological realization of stable and targeted genetic modification of mammalian skin color. Therefore, there is an urgent need in this field to elucidate and utilize relevant regulatory mechanisms to provide technical solutions for creating novel animal strains with stable dark skin phenotypes. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention provides an expression vector based on the bovine K5 gene and its application.

[0006] In a first aspect, the present invention provides an expression cassette comprising: a 5' regulatory region of a bovine K5 gene, an intron of a β-globin gene, a target gene, and a 3' regulatory region of the bovine K5 gene.

[0007] This invention hypothesizes that key regulatory genes for the proliferation and differentiation of primary melanocytes are specifically highly expressed in the keratinocytes of the epidermis, suggesting the presence of melanocytes in the epidermal layer of an individual animal that secrete melanin, thus allowing the skin at the individual animal level to change from white to black. Therefore, this invention designs a vector capable of efficiently expressing the target gene in skin cells. Currently, traditional tissue-specific expression vectors mainly consist of tissue-specific regulatory elements, primarily promoters and 3' end regulatory regions. However, these elements alone are insufficient to guarantee high expression of the exogenous target gene. This invention utilizes the 5' and 3' end regulatory regions of the bovine K5 gene and adds intron elements from the β-globin gene, ultimately resulting in an expression cassette that achieves efficient expression of the target gene in the skin.

[0008] Furthermore, the 5' regulatory region of the bovine K5 gene includes any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.1; ii) Nucleotide sequences with more than 40% homology as shown in i) that perform the same regulatory function; The 3' regulatory region of the bovine K5 gene includes any of the following nucleotide sequences: iii) The nucleotide sequence shown in SEQ ID NO.2; iv) Nucleotide sequences with more than 40% homology as shown in iii) that perform the same regulatory function.

[0009] The nucleotide sequence shown in SEQ ID NO.1:

[0010] The nucleotide sequence as described in SEQ ID NO.2: .

[0011] Furthermore, the target gene is a melanin synthesis regulatory gene; Preferably, the melanin synthesis regulatory gene is selected from one of EDN3, KIT, α-MSH, HGF, Wnt, or FGF; More preferably, the melanin synthesis regulatory gene is EDN3; More preferably, the EDN3 is a swine-derived END3; More preferably, the EDN3 comprises any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.3; ii) Nucleotide sequences with more than 40% homology as shown in i) that encode the same functional protein.

[0012] The nucleotide sequence shown in SEQ ID NO.3: .

[0013] Furthermore, the β-globin gene is a mammalian β-globin gene; Preferably, the β-globin gene is a porcine β-globin gene; More preferably, the β-globin gene comprises any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.4; ii) Nucleotide sequences that have more than 40% homology as shown in i) and have the same regulatory function.

[0014] The nucleotide sequence shown in SEQ ID NO.4: .

[0015] Secondly, the present invention provides an expression carrier, including the aforementioned expression cassette.

[0016] Furthermore, it also includes: pB vector elements and OCT4-NEO selection marker gene self-splicing elements; Preferably, the pB vector element comprises any of the following nucleotide sequences: i) Nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6; ii) Nucleotide sequences with more than 40% homology to the nucleotide sequences shown in i) that perform the same regulatory function; and / or, The self-splicing element of the OCT4-NEO selection marker gene includes any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.7; ii) Nucleotide sequences that have more than 40% homology as shown in i) and have the same regulatory function.

[0017] The expression vector provided by the present invention also includes an OCT4 self-cleaving selection marker gene deletion element. This element can perform G418 screening in the porcine cell stage to efficiently obtain positive clones with integrated target genes. At the same time, this element can self-delete in the embryonic stage when cells are cloned, and the final positive pigs are free of selection marker genes.

[0018] The nucleotide sequence shown in SEQ ID NO.5: TTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTC ACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTCTTGTTATAGATATCA.

[0019] The nucleotide sequence shown in SEQ ID NO.6: TAAAAGTTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTAGTATGTAAGTGTAAATAATAAAAACTTAATATCTATTCAAATTAATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGGTTAA.

[0020] The nucleotide sequence shown in SEQ ID NO.7:

[0021] Thirdly, the present invention provides a transgenic cell, comprising: the aforementioned expression cassette, or the aforementioned expression vector.

[0022] Fourthly, the present invention provides the use of the aforementioned expression cassette, or the aforementioned expression vector, or the aforementioned transgenic cells in any of the following: (1) Expressing the target gene in animal skin cells; (2) Regulating animal skin color; (3) Preparation of transgenic animals with a black skin phenotype; (4) Animal breed improvement related to skin color phenotype; (5) Construction of medical animal models related to skin color phenotype; (6) Improvement of animal germplasm resources.

[0023] Furthermore, the animal in question is a mammal; Preferably, the animal is a human, rat, cow, sheep, dog, or pig; More preferably, the animal is a pig or a sheep; More preferably, the animal is a miniature pig.

[0024] Fifthly, the present invention provides a method for preparing black-skinned pigs, comprising: transforming porcine fetal fibroblasts with the aforementioned expression cassette or the aforementioned expression vector, using positive cells as donor cells, and preparing cloned pigs through somatic cell nuclear transfer technology.

[0025] Based on this method, the present invention constructs a highly efficient eukaryotic expression vector bK5-OCT4-NEO-plus-pEDN3 for breeding black-skinned pigs of all porcine origin, which specifically expresses skin. By nuclear transfection of fetal fibroblasts of white-skinned black-haired miniature pigs, positive cell clones were screened and subjected to nuclear transfer. The born positive pigs were found to have completely black skin and hair. The present invention is named Tc-Black-skinned Pig.

[0026] The present invention has the following beneficial effects: This invention provides an expression vector for the specific expression of a target gene in animal skin, and based on this, a eukaryotic expression vector bK5-OCT4-NEO-plus-pEDN3 was constructed. This expression vector was transformed into porcine fetal fibroblasts, and then used as donor cells to prepare pigs with black skin through somatic cell cloning nuclear transfer technology.

[0027] This invention establishes for the first time a method for preparing black-skinned pigs mediated by a fully porcine vector, successfully producing the first high-quality black-skinned pig. This method can also be applied to the breeding of other black-skinned mammals (such as cattle and sheep), providing an important theoretical foundation and technical support for the breeding of new black-skinned animal breeds. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0029] Figure 1 This is a schematic diagram of the preparation of black-skinned pigs using pPB-bK5-OCT4-NEO-plus-pEDN3 provided in Embodiment 1 of the present invention.

[0030] Figure 2 This is an identification diagram of positive pPB-bK5-OCT4-NEO-plus-pEDN3 cell clones provided in Example 2 of the present invention.

[0031] Figure 3 This is a PCR identification image of a black-skinned pig with positive pPB-bK5-OCT4-NEO-plus-pEDN3 transgenic strain provided in Example 4 of the present invention.

[0032] Figure 4 This is the phenotypic identification diagram of the positive pPB-bK5-OCT4-NEO-plus-pEDN3 black-skinned pig provided in Example 4 of the present invention. Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0034] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0035] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0036] In the following examples, DMEM culture medium, trypsin, PBS buffer, and FBS are all commercially available, for example, from Gibco or Life Technologies.

[0037] In the following examples, the shock buffer and shock cup are commercially available, for example, from LOZA.

[0038] Example 1: Construction of the pPB-bK5-OCT4-NEO-plus-pEDN3 vector 1. Construction of pPB-bK5-OCT4-NEO-plus vector The main process of the construction method involves synthesizing four genes, namely G-P5-1, G-P5-2, G-P5-3, and G-P5-4, using gene synthesis methods. These four genes were then amplified into a vector using a GIBSON assembly kit and fused into the pUC57 vector.

[0039] The specific procedure is as follows: digest the pUC57 vector with Afl III and AatII enzymes, recover the 1.8kb backbone vector, and then assemble it with the above 4 PCR fragments in one step using GIBOSIN to construct pPB-bK5-OCT4-NEO-plus.

[0040] Where 1-314bp is the 5PB end; 315-5377bp is the bK5-5 end; 5378-6023bp is the pig β-globinintron; 6024-6568bp is the bK5-3 end; 6569-11801bp is the self-shearing element; and 11802-12043bp is the 3PB end. According to the sequence numbering, it is: SEQ ID NO.5-SEQ ID NO.1-SEQ ID NO.4-SEQ ID NO.2-SEQ ID NO.7-SEQ ID NO.6.

[0041] (2) Construction of pPB-bK5-OCT4-NEO-plus-pEDN3 vector The main construction process involves synthesizing a single gene, pEDN3 (SEQ ID NO.3), and then constructing it into the pPB-bK5-OCT4-NEO-plus vector via enzyme digestion and ligation. Specifically, the pPB-bK5-OCT4-NEO-plus vector is digested with NotI, dephosphorylated, and the 13kb backbone vector is recovered. Then, the pEDN3 gene is digested with NotI to synthesize the vector, the 600bp fragment is recovered, and a one-step ligation is performed to construct pPB-bK5-OCT4-NEO-plus-pEDN3. This vector contains key elements including the PB element, the 5' and 3' regulatory regions of bK5, a porcine β-globin intron element, the OCT4-NEO element, and pEDN3 (see [link to documentation]). Figure 1 ).

[0042] Example 2: Obtaining transgenic positive cell clones In this embodiment, a method for preparing a transgenic positive cell clone includes: 1. Establishment of porcine fetal fibroblasts.

[0043] (1) Take a miniature pig that is 30 days pregnant, kill it, remove the fallopian tubes and uterus, bandage the opening, and transport it back to the laboratory within 2 hours.

[0044] The fetus is removed from the uterus, cleaned with antibiotic-containing DPBS, transferred to a laminar flow hood, and the fetal head, limbs, and internal organs are removed with ophthalmic scissors and rinsed with DPBS.

[0045] (2) Use ophthalmic scissors to cut the remaining part into small pieces in a 100mm diameter cell culture dish.

[0046] (3) Add a little serum, cut off the tip of the 1mL pipette with scissors, leaving a part with a diameter of about 40mm or more, attach the 1mL pipette, transfer the tissue block to the bottom wall of 3 T25 cell culture flasks, and spread the tissue block evenly with a bent pipette.

[0047] (4) Place the tissue block side up, add 5 mL of cell culture medium to each side, and place in a CO2 incubator for incubation at 39°C, 5% CO2, and 100% humidity.

[0048] (5) After culturing for 6-8 hours, flip the side with the tissue block so that the cell culture medium can immerse the tissue block.

[0049] (6) After culturing for about 5 days, observe whether cells crawl out from around the tissue block.

[0050] (7) When the cells have grown to 80% confluence, they should be passaged or cryopreserved.

[0051] 2. Electroporation of porcine fetal fibroblasts and screening of cell clonal sites.

[0052] (1) Two days before electroporation, 2×10 5 The porcine fibroblast cell line obtained in step 1 above was revived in a 6-well plate and 4 mL of DMEM medium containing 10% (v / v) fetal bovine serum (FBS) was added. The plates were then incubated at 37°C in a 5% CO2 incubator.

[0053] (2) After the cells in the 6-well plate have grown to a confluence, approximately 1×10 6 Digest cells with 1 mL of 0.25% trypsin solution. Centrifuge at 1000g for 5 min to pellet the cells. Wash the cell pellet once with PBS buffer. Resuspend the cells in 100 μL of electroporation buffer to obtain a cell suspension.

[0054] (3) Add 3 μg of expression vector pPB-bK5-OCT4-NEO-plus-pEDN3 and 1 μg of pCAG-PB enzyme vector prepared in Example 1 to 100 μL of the cell suspension obtained in (2) above, mix and transfer into an electroporation cuvette.

[0055] (4) Electrolyze the cells with an electric field strength of 1.2KV / cm and a pulse time of 1ms.

[0056] (5) Transfer the electrolyzed cells into a 60 mm cell culture dish; add 4 mL of DMEM culture medium containing 10% (volume percentage) fetal bovine serum, and culture in a CO2 incubator. Once the cells have recovered their growth status, they are selected by G418.

[0057] (6) When the cell clones in the culture dish grow to a diameter of more than 2 mm, remove the culture medium, rinse with DPBS, cover the clone cluster with a cloning loop, add about 100 μL of 0.1% trypsin at 37°C, digest for about 3 min, add DMEM medium containing 20% ​​(v / v) FBS to stop digestion, gently pipette and transfer to a 48-well plate for expansion culture.

[0058] (7) When the cell fusion rate in the 48-well plate reaches 90%, half of the cells are digested and used for cell clone genotype identification, while the remaining half are cultured in the well plate.

[0059] (8) After centrifuging the cells used for genotyping at 1000g for 5min, discard the supernatant and add 10-20μL of cell lysis buffer (50mM KCl, 2.5mM MgCl2, 10mM Tris-HCl, 0.45% NP40, 0.45% Tween 20 and 0.2mg / mL proteinase K) according to the amount of cell precipitate.

[0060] 3. Identification of positive cell clonal sites (1) Use 3 μL of cell lysate as a template for PCR identification. Use primer pairs consisting of 5PB-F / R, 3PB-F / R, and bK5-EDN-F / R (see primer design location). Figure 2 PCR amplification was performed.

[0061] 5PB-F: 5'-GGTAAGTGTCACTGATTTTG-3', 5PB-R: 5'-CTGTAAAGTGGGAGTGAAG-3'.

[0062] 3PB-F: 5'-CTCTGGTCAGAGATAACCTGG-3', 3PB-R: 5'-CGGTCTGTATATCGAGGTTTA-3'.

[0063] bK5-EDN-F: 5'-TACTCCTGGGTCTAAGCTGG-3', bK5-EDN-R: 5'-ATGGGATGGAGGGAGACAAA-3'.

[0064] The reaction system consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTP, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O.

[0065] Reaction program: 94℃ for 5 min; 94℃ for 30 s, 52℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min, store at 4℃.

[0066] The amplified sizes were 1386bp, 2226bp, and 1379bp, respectively.

[0067] After purifying and sequencing the amplification products obtained from the above PCR amplification, cloned pigs were prepared.

[0068] Example 3: Preparation of embryos and cloned pigs via nuclear transfer 1. In vitro maturation of porcine oocytes Ovaries were retrieved from the slaughterhouse and placed in physiological saline containing penicillin and streptomycin sulfate at 28℃-35℃. Within 2 hours, the ovaries were transported back to the laboratory. Follicles measuring 3-6 mm in diameter were aspirated using a 20 mL syringe equipped with an 18-gauge needle. The aspirate was transferred to a 50 mL centrifuge tube, incubated at 37℃ for 15 minutes, and the supernatant was discarded. The precipitate was resuspended in PVA-TL-HEPES and incubated for another 15 minutes. This process was repeated once. The resuspended follicles were placed in 60 mm diameter plastic culture dishes. Under a stereomicroscope, cumulus-oocyte complexes (COCs) with at least two layers of dense, homogeneous cytoplasm were selected using a pipette. These COCs were washed three times with maturation culture medium and transferred into culture droplets (25 COCs per 100 μL droplet) that had been equilibrated in an incubator for at least 4 hours. Four droplets were prepared in each 35 mm diameter plastic culture dish and covered with embryo-grade mineral oil. COCs were first cultured in a maturation medium for 20±2h, and then transferred to a maturation medium without hCG and eCG for another 20±2h.

[0069] 2. Somatic cell preparation Using the serum starvation method, when the cells (the transgenic positive cell clone containing pPB-bK5-OCT4-NEO-plus-pEDN3 constructed in Example 2) reached 80% confluence, they were subjected to serum starvation treatment, that is, the FBS concentration in the culture medium was reduced from 20% to 0.5% and cultured for 2-5 days. The cells were digested, centrifuged and washed according to the conventional method, and finally the cell pellet was resuspended in 1 mL of micromanipulation solution for use as donor cells.

[0070] 3. Enucleation of recipient oocytes and nuclear transfer of donor cells Enucleation of mature oocytes was performed using the blind aspiration method. Specifically, oocytes matured at 40-44 hours were selected, and after cumulus detachment, oocytes with homogeneous cytoplasm, a clear perivitelline space, and intact cell membranes were placed in a calcium-free environment. 2+ Mg 2+1. Transfer HEPES buffered NCSU-23 to the micromanipulation droplet: Prepare 1 hour before nuclear transfer. Place a 50-80 μL droplet (2-3 mm wide, 8-10 mm long) in the center of a 60 mm diameter cell culture dish lid, covered with paraffin oil, and incubate for 15-30 minutes. Simultaneously transfer the donor cells and mature oocytes into the droplet and equilibrate at 39%, 5% CO2, and 100% humidity for 15 minutes. Attach the micromanipulation tube and enucleation / injection needle, adjust the operating system position, and under an inverted microscope equipped with a micromanipulator and a temperature-controlled stage, at 40× magnification, use the fixation tube (25-35 μm inner diameter, 100-120 μm outer diameter) to hold the oocytes and use a 15-25 μm inner diameter enucleation / injection needle to manipulate them. For oocytes, position the first polar body at the 1 o'clock position on a clock face at 200×. Insert the enucleation / injection needle through the zona pellucida from the 3 o'clock position, aspirate the first polar body and a small amount of cytoplasm nearby, and withdraw the needle. Expel the first polar body and a small amount of cytoplasm. Select somatic cells that are 15-20 μm in diameter, highly refractive, round, and smooth. At 200×, use the enucleation / injection needle to aspirate one donor cell. Inject the somatic cell into the perivitelline space below the zona pellucida from the enucleation needle insertion point. Press the zona pellucida with the injection needle to ensure close contact between the cell membranes of the donor cell and the recipient oocyte cytoplasm. Use 25-30 oocytes per batch. After construction, transfer the donor cell-oocyte cytoplasm pair (reconstructed oocyte) to NCSU-23 + 4 mg / mL BSA and incubate at 39℃, 5% CO2, and 100% humidity for 1-2 hours.

[0071] 4. Fusion and Activation The reconstructed oocytes were transferred in batches to the fusion medium and equilibrated for 3 minutes. After washing three times with the fusion / activation solution, five oocytes per batch were placed in a fusion tank filled with fusion medium. The reconstructed oocytes were moved with a drawn, fine-tipped solid glass needle to make the donor cell-recipient oocyte membrane contact surface parallel to the electrode. A 30 μs, 2.0 kV / cm DC pulse was applied using an ECM2001 fusion instrument to induce fusion and activate the cells. The cells were washed five times with NCSU-23% + 4 mg / mL BSA and immediately transferred to a mineral oil-covered embryo culture medium. The cells were then cultured at 39°C, 5% CO2, and 100% humidity for 0.5 to 1 hour. The cells were then removed and the fusion was assessed under a stereomicroscope.

[0072] 5. Embryo culture Prepare culture droplets at least 4 hours before starting micromanipulation. Take a 35mm bacterial culture dish in a clean bench and make 6-8 30μL droplets. Carefully add 2.5-3mL of mineral oil to cover the droplets, label them, and place them in a CO2 incubator for equilibration. Wash the fused reconstructed embryos 5 times with embryo culture medium and then transfer them into the incubator. Culture 8-10 reconstructed embryos in each 30μL droplet. Record the cleavage and blastocyst formation results at 48h and 168h.

[0073] 6. Embryo transfer Using boars to test for estrus or observing the back pressure response, select sows that come into estrus naturally. Generally, on the day of embryo cloning, 1-2 cell clones cultured in a CO2 incubator for 12-30 hours are removed and placed into 2.5mL capillary tubes. These tubes are then packaged in sterile aluminum foil, labeled, and transported to the transplant site in a temperature-controlled transport box. 1-1.5mg of thiopental sodium and diazepam are dissolved in 40-60mL (1mg / 100kg body weight) of physiological saline, and 20mL is injected via the ear vein. After the recipient sow is initially anesthetized, she is placed on a surgical frame in a supine position (for young gilts) or a lateral position (for multiparous sows). For gilts, restraint is performed at a 15×10cm point on the midline of the abdomen, between the first and second pairs of teats. 2 After cleaning and shaving the area, disinfect with iodine first, then remove the iodine with alcohol swabs (for multiparous sows: apply to the flank area of ​​the abdomen, 15×10cm). 2 Clean the area thoroughly, shave the hair, disinfect with iodine, and then remove the iodine with alcohol. Before making the incision along the midline of the abdomen, inject another 20-30 mL of the remaining anesthetic as needed. Make an incision about 8-10 cm long along the midline of the abdomen, open the abdominal cavity, insert a hand, remove the ovary, and cover it with moistened sterile gauze (for multiparous sows: make an incision about 10 cm long perpendicular to the midline of the abdomen along the side of the abdomen). Just as the surgeon is about to remove the ovary and adjust the fimbriae of the fallopian tube, remove the embryo from the suction tube and place it on a heated table. Under a stereomicroscope, place the embryo into the transfer tube. The surgeon and the embryo transfer personnel coordinate with each other, inserting the transfer tube into the fallopian tube from the fimbriae at least 5 cm, roughly to the ampulla-isthmus junction, while pushing the syringe to withdraw the transfer tube. After transfer, observe under a stereomicroscope whether the embryo is still stuck in the transfer tube. After confirming that it is not, begin ovarian repositioning and suture the incision. On the 10th day after embryo transfer, administer 800 IU intramuscularly. hCG, 500 IU MSG injected on day 13.

[0074] Example 4: Identification of F0 Positive Pigs 1. F0 generation pig DNA molecular identification Mince the tissue or cell pellet and place it in a 1.5 mL centrifuge tube. Add 700 μL of DNA extraction buffer and 20 μL of proteinase K (20 mg / mL). Mix well and digest in a 56°C water bath for at least 18 hours, until the tissue or cell pellet completely disappears. Shake intermittently for better results. Add 700 μL of Tris-saturated phenol, gently shake for 12 min, and centrifuge at 12000 rpm for 12 min. Transfer the supernatant to another new centrifuge tube. Repeat the above steps: transfer the supernatant to another new centrifuge tube, add 700 μL of phenol:form (1:1), gently shake for 12 min, and centrifuge at 12000 rpm for 12 min. Transfer the supernatant to another new centrifuge tube, add 700 μL of chloroform, gently shake for 12 min, and centrifuge at 12000 rpm for 12 min. Transfer the supernatant to another new centrifuge tube, add 2 volumes of anhydrous ethanol, invert to mix, and centrifuge at 12000 rpm for 10 min. Discard the supernatant, wash the precipitate and tube walls with 70% ethanol, discard the ethanol, drain the residual liquid, and leave the tube open at room temperature for 20-30 minutes to allow the ethanol to evaporate completely. Add an appropriate amount (approximately 100 μL) of TE buffer and dissolve the DNA in a 56°C water bath. Detect the genomic DNA concentration using 0.7% agarose gel electrophoresis, measuring the concentration and purity of the genomic DNA at 260 / 280 nm wavelengths. Adjust the concentration to an appropriate level and store at -20°C. Simultaneously, use primers consisting of the 3PB-F1 / R1 primer pair (primer design location see...). Figure 3 PCR amplification was performed using the following primer pairs: 3PB-F1: 5'-GGGAACAGAGCGACTCGTTT-3', 3PB-R1: 5'-ACAAAACTTTTAGCTAGCga-3'.

[0075] The reaction system consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTP, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O.

[0076] Reaction program: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 6 min, 35 cycles; 72℃ for 5 min, store at 4℃.

[0077] Figure 3 P1-P3 were positive cells, with an amplification size of 6708bp; H1-H3 were small black-skinned pigs, which amplified to 1101bp after successful self-cleavage.

[0078] 2. Observation of the black skin trait in F0 positive pigs There are two main methods: First, the hair of WT control pigs and transgenic positive pigs is shaved off, and then the pigs are observed and photographed to determine whether their skin is black; second, WT control pigs and transgenic positive pigs are slaughtered normally, and then the pigs are observed and photographed to determine whether their skin is black.

[0079] The results are as follows Figure 4 As shown, the skin of wild-type WT pigs was not black, but the skin of transgenic positive pigs was black, as observed by two methods.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An expression box, characterized in that, include: The 5' regulatory region of the bovine K5 gene, the intron of the β-globin gene, the target gene, and the 3' regulatory region of the bovine K5 gene.

2. The expression box according to claim 1, characterized in that, The 5' regulatory region of the bovine K5 gene includes any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.1; ii) Nucleotide sequences with more than 40% homology as shown in i) that perform the same regulatory function; The 3' regulatory region of the bovine K5 gene includes any of the following nucleotide sequences: iii) The nucleotide sequence shown in SEQ ID NO.2; iv) Nucleotide sequences with more than 40% homology as shown in iii) that have the same regulatory function.

3. The expression box according to any one of claims 1-2, characterized in that, The target gene is a melanin synthesis regulatory gene; Preferably, the melanin synthesis regulatory gene is selected from one of EDN3, KIT, α-MSH, HGF, Wnt, or FGF; More preferably, the melanin synthesis regulatory gene is EDN3; More preferably, the EDN3 is a swine-derived END3; More preferably, the EDN3 comprises any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.3; ii) Nucleotide sequences with more than 40% homology as shown in i) that encode the same functional protein.

4. The expression box according to any one of claims 1-3, characterized in that, The β-globin gene is a mammalian β-globin gene; Preferably, the β-globin gene is a porcine β-globin gene; More preferably, the β-globin gene comprises any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.4; ii) Nucleotide sequences that have more than 40% homology as shown in i) and have the same regulatory function.

5. An expression carrier, characterized in that, Includes the expression box as described in any one of claims 1-4.

6. The expression vector according to claim 5, characterized in that, It also includes: pB vector elements and OCT4-NEO selection marker gene self-splicing elements; Preferably, the pB vector element comprises any of the following nucleotide sequences: i) Nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6; ii) Nucleotide sequences with more than 40% homology to the nucleotide sequences shown in i) that perform the same regulatory function; and / or, The self-splicing element of the OCT4-NEO selection marker gene includes any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.7; ii) Nucleotide sequences that have more than 40% homology as shown in i) and have the same regulatory function.

7. A transgenic cell, characterized in that, include: The expression box according to any one of claims 1-4, or the expression carrier according to claim 5 or 6.

8. The use of the expression cassette according to any one of claims 1-4, or the expression vector according to any one of claims 5-6, or the transgenic cell according to claim 7, in any of the following: (1) Expressing the target gene in animal skin cells; (2) Regulating animal skin color; (3) Preparation of transgenic animals with a black skin phenotype; (4) Animal breed improvement related to skin color phenotype; (5) Construction of medical animal models related to skin color phenotype; (6) Improvement of animal germplasm resources.

9. The application according to claim 8, characterized in that, The animal in question is a mammal; Preferably, the animal is a human, rat, rabbit, cow, sheep, dog, or pig; More preferably, the animal is a pig or a sheep.

10. A method for preparing black-skinned pigs, characterized in that, include: Using the expression cassette described in any one of claims 2-4, or the expression vector described in claim 5 or 6, porcine fetal fibroblasts are transformed, and positive cells are used as donor cells to prepare cloned pigs through somatic cell nuclear transfer technology.

Images