Construction method and application of Kcnk4 gene A245P point mutation mouse model

Abstract

The invention belongs to the field of gene engineering, particularly relates to a construction method of a Kcnk4 gene A245P point mutation mouse model, and designs the construction method of the Kcnk4 gene A245P point mutation mouse model. The cutting specificity is improved by systematically optimizing a gRNA design algorithm, an efficient oligo donor DNA synthesis strategy is developed to improve the recombination efficiency, and a multi-level genotype identification system is established to ensure the mutation accuracy. The method comprises the following specific steps: designing gRNA of targeted Kcnk4 gene exon6, synthesizing oligo donor DNA containing A245P mutation, carrying out microinjection to Balb / c mouse fertilized eggs, transplanting, screening positive F0-generation mice through PCR amplification and sequencing peak map analysis, and mating with a wild type to obtain an F1-generation heterozygote with stable heredity. The mutation efficiency reaches 90% or above, the genotype identification method is simplified, heterozygotes and homozygotes can be distinguished through a sequencing peak graph, and false positive of a traditional enzyme digestion method is avoided. The model provides a reliable tool for nervous system disease research and drug screening.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a construction method of a Kcnk4 gene A245P point mutation mouse model and application thereof. BACKGROUND

[0002] Gene editing technology, as a leading tool in the field of modern life sciences, plays an irreplaceable role in analyzing gene function, constructing disease models and developing treatment strategies. Among them, the CRISPR / Cas9 system has become a core means for studying gene function and disease mechanism due to its efficient and precise gene editing capability. In the field of neurobiology, the KCNK4 gene (OMIM* 605720) located at the 11q13.1 locus has attracted attention because of its encoding of the potassium two-pore domain channel subfamily K member 4 (K2P4.1). The gene is highly expressed in brain regions such as the cerebral cortex and hippocampus, and the K2P4.1 channel encoded by it is composed of 393 amino acids, which is a K+ ion channel with lipid sensitivity, mechanical sensitivity and heat sensitivity, mainly distributed in the cell membrane of neurons, and plays a key role in maintaining the resting membrane potential and regulating cell excitability.

[0003] Previous studies have shown that KCNK4 gene variations are closely related to various human neurodevelopmental and functional disorders. Two previously reported KCNK4 mutants are directly related to the facial deformity-hypertrichosis-epilepsy-mental retardation / developmental delay-gingival hyperplasia (FHEIG) syndrome, suggesting the importance of the gene in neural development and physiological function maintenance. To further reveal the pathogenic mechanism of specific mutation sites, constructing an animal model that accurately simulates the pathological state of humans has become a key requirement.

[0004] However, traditional gene editing techniques such as homologous recombination have inherent defects such as low editing efficiency, long experimental period and high cost, making it difficult to meet the needs of complex disease model construction. Although the CRISPR / Cas9 technology has been widely used in the field of gene editing, it still faces technical challenges in targeted editing of specific point mutations (such as A245P), chimeric body screening and establishment of stable genetic lines. Specifically, the existing methods often have low success rate of point mutation model construction and poor phenotype stability due to suboptimal gRNA design, low synthesis efficiency of homologous repair templates (donor DNA) and imperfect genotyping strategies. SUMMARY

[0005] To solve the above technical problems, the present application designs a construction method of a Kcnk4 gene A245P point mutation mouse model and application thereof, which optimizes the gRNA design algorithm to improve the targeting cutting specificity, develops an efficient oligo donor DNA synthesis strategy to improve the homologous recombination efficiency, and establishes a multi-level genotype identification system to ensure the accuracy of the mutation.

[0006] The method for constructing the Kcnk4 gene A245P point mutation mouse model of the application comprises the following steps:

[0007] S1, design a gRNA targeting the Kcnk4 gene exon6, and the sequence is SEQ ID NO. 1;

[0008] S2, synthesize an oligo donor DNA containing the A245P point mutation, and the sequence is SEQ ID NO. 2;

[0009] S3, microinject Cas9 mRNA, gRNA and oligo donor DNA into zygotes of Balb / c mice, and transplant the injected zygotes into the uterus of a pseudopregnant female mouse for further development;

[0010] S4, screen positive F0 generation mice by PCR amplification and sequencing peak graph analysis, cross the F0 generation positive mice with wild type mice to obtain F1 generation heterozygote mice.

[0011] Preferably, the PCR amplification primers are SEQ ID NO. 3 and SEQ ID NO. 4.

[0012] Preferably, the sequencing peak graph analysis determines the heterozygote by detecting the double peak signal of the mutation site.

[0013] The application also provides the application of the mouse model constructed by the above method in the research of nervous system diseases or drug screening.

[0014] Compared with the prior art, the application has the following beneficial effects:

[0015] The application improves the targeted cutting specificity by systematically optimizing the gRNA design algorithm, improves the homologous recombination efficiency by developing an efficient oligo donor DNA synthesis strategy, and ensures the mutation accuracy by establishing a multi-level genotype identification system, and the mutation efficiency is more than 90%. At the same time, the genotype identification method is simplified, and the heterozygote and homozygote are directly distinguished by sequencing peak graph, avoiding the false positive problem of traditional enzyme digestion method. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed for the embodiment description are briefly introduced as follows.

[0017] Figure 1 is a Kcnk4 gene A245P point mutation mouse model construction flowchart;

[0018] Figure 2 is an F0 generation mouse genotype identification schematic diagram;

[0019] Figure 3 is a sequencing alignment result map of positive mouse point mutation before and after;

[0020] Figure 4 is a mouse model verification map;

[0021] Figure 5 is a PCR identification schematic diagram;

[0022] Figure 6 is a PCR identification result map;

[0023] Figure 7 is a peak shape map near the mutation site of wild type mouse;

[0024] Figure 8 is a peak shape map near the mutation site of heterozygote mouse. DETAILED DESCRIPTION

[0025] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all.

[0026] Embodiment 1

[0027] As shown in the following table, the construction method of the Kcnk4 gene A245P point mutation mouse model includes the following steps: Figure 1 S1, select the Kcnk4 gene (Ensembl number: ENSMSUSG00000024957) of the mouse as the target gene, and introduce A245P point mutation in the 6th exon thereof, design gRNA targeting Kcnk4 gene exon6, the sequence is SEQ ID NO. 1 (sequence information: GCACTGAGGCGAAGTAGGCT);

[0028] S2, synthesize oligo donor DNA containing A245P point mutation, the sequence is SEQ ID NO. 2 (sequence information: GCGATGGCACCGGGCAGAACTCTCCAGCCTACCAGCCGCTGGTGTGGTTCTGGATCTTGTTTGGCCTACCCTACTTCGCCTCAGTGCTCACCACCATCGGCAACTGGTTGCGAGCAGTGTCCCGCCGAACTCGGGCAGAG);

[0029]

[0030] ​S3, obtain Cas9 mRNA by in vitro transcription, obtain gRNA by in vitro transcription as well, purify the synthesized oligo donor DNA to ensure that its quality and concentration meet the requirements of microinjection, microinjection of Cas9 mRNA, gRNA and oligo donor DNA into zygotes of Balb / c mice, and transplant the injected zygotes into the uterus of a pseudopregnant female mouse to continue development;

[0031] S4, screen positive F0 generation mice by PCR amplification and sequencing peak graph analysis, cross the F0 generation positive mice with wild type mice to obtain F1 generation heterozygous mice, and number 1-15 for 15 F1 generation mice.

[0032] Genotype identification of F0 generation mice:

[0033] Transplant the injected zygotes into a pseudopregnant female mouse, and the mice born about 20 days later are F0 generation mice. Genotype identification is performed by PCR amplification and sequencing. Because the early cleavage speed of zygotes is very fast, the obtained F0 generation mice are chimeras and do not necessarily have the ability of stable inheritance, and need to be passed to obtain F1 generation mice which can be stably inherited. The genotype identification of F0 generation mice is shown in Figure 2 .

[0034] PCR identification method of positive F0 generation mice:

[0035] The PCR amplification primers are SEQ ID NO. 3 (sequence information: AGGTGCAGAAACAGGCAGTG) and SEQ ID NO. 4 (sequence information: CGTCCGGGTCTCAATGTCAG); the reaction system is shown in Table 1.

[0036] Table 1 PCR identification reaction system of positive F0 generation mice

[0037]

[0038] The reaction conditions are shown in Table 2.

[0039] Table 2 PCR identification reaction conditions of positive F0 generation mice

[0040]

[0041] F1 generation mice are obtained and genotype identification is performed:

[0042] Cross the F0 generation positive mice with wild type Balb / c mice to breed F1 generation mice, and genotype identification is performed by PCR identification and sequencing.

[0043] Genotype identification of F1 generation mice:

[0044] F1 generation mice genotype detection strategy and method as shown in Figure 2 PCR product connection T-vector sequencing confirmation, positive mice 1, 2, 5, 6, 7, 11, 12, 14, 15. Positive mouse sequencing before and after the point mutation comparison results as shown in Figure 3 .

[0045] F1 generation positive mouse number and basic information as shown in Table 3.

[0046] Table 3 F1 generation positive mouse basic information

[0047]

[0048] Mouse verification:

[0049] Mouse number principle as shown in Figure 4 The obtained gene point mutation heterozygous mice are divided into two parts: one part of the heterozygous mice are mated with wild type mice, and the more heterozygous mice are bred; a part of the heterozygous mice are self-crossed to obtain gene point mutation homozygous mice, and the subsequent phenotype analysis is carried out.

[0050] As shown in Figure 5 PCR product sequencing is used for mouse genotype identification, and the identification conditions are shown in Table 4.

[0051] Table 4 PCR identification strip

[0052] The identification results are shown in Figure 6 .

[0053] The genotype is determined by direct sequencing of PCR product, which needs to be noted: the basis for interpretation is the "peak shape" of the sequencing result, not the sequence information of the sequencing result (because the PCR product of the heterozygous mouse contains two different DNA molecules, resulting in unreliable sequence information of the sequencing result).

[0054] The "peak shape" of the sequencing result of the heterozygous mouse is: the peak shape of the mutated base site is double peak; the PCR product of the wild type and homozygous mouse is a single DNA molecule, and the sequencing results of the two genotypes are shown in Figure 7 , and the peak shape of the heterozygous mouse near the mutation site is shown in Figure 8 , which is a normal single peak at the mutation site, but the peak shape of the two genotypes is different. Therefore, at the mutation base site, the double peak is the heterozygous mouse; the normal single peak may be wild type or homozygous, which needs to be judged according to the sequence information of the mutation site.

[0055] The preferred embodiments of the application disclosed above are only to facilitate the elucidation of the application. The preferred embodiments do not describe all the details of the application, nor limit the application to the specific embodiments described. Obviously, many modifications and variations can be made according to the content of the specification.

Claims

1. A method for constructing a mouse model of the Kcnk4 gene A245P point mutation, characterized in that, Includes the following steps: S1. Design a gRNA targeting exon6 of the Kcnk4 gene, the sequence of which is SEQ ID NO.1; S2. Synthesize oligo donor DNA containing the A245P point mutation, the sequence of which is SEQ ID NO.2; S3. Cas9 mRNA, gRNA and oligo donor DNA were microinjected into the fertilized eggs of Balb / c mice, and the injected fertilized eggs were transplanted into the uterus of pseudopregnant female mice to allow them to continue to develop. S4. Positive F0 generation mice were screened by PCR amplification and sequencing peak diagram analysis. The F0 generation positive mice were mated with wild-type mice to obtain stable F1 generation heterozygous mice.

2. The method for constructing the Kcnk4 gene A245P point mutation mouse model according to claim 1, characterized in that, The PCR amplification primers are SEQ ID NO.3 and SEQ ID NO.

4.

3. The method for constructing the Kcnk4 gene A245P point mutation mouse model according to claim 1, characterized in that, The sequencing peak diagram analysis identifies heterozygotes by detecting the bimodal signal at the mutation site.

4. The application of the Kcnk4 gene A245P point mutation mouse model constructed according to any one of claims 1-3 in the study of nervous system diseases or drug screening.

Images