Construction method and application of DNAJB6a gene specific knockout mouse model

Abstract

The invention discloses a construction method and application of a DNAJB6a gene specific knockout mouse model, and belongs to the technical field of gene engineering. Comprising the following steps: S1, designing gRNA sequences aiming at ninth to tenth exon regions of the mouse DNAJB6 gene; s2, in vitro transcription is carried out to prepare Cas9mRNA and gRNA; s3, carrying out microinjection on Cas9mRNA and gRNA (guide Ribonucleic Acid) into a fertilized egg of the mouse; s4, transplanting the fertilized ovum after injection into the body of a pseudo-pregnant female mouse to obtain an F0-generation mouse; s5, screening positive F0-generation mice through genotype identification, and mating the positive F0-generation mice with the wild type mice to obtain F1-generation heterozygote mice; s6, the F1-generation heterozygote mice are matched to obtain F2-generation homozygote mice, and the DNAJB6a gene specific knockout mouse model is established. The construction method for constructing the DNAJB6a gene knockout mouse model, provided by the invention, is simple and convenient to operate, short in construction process time and stable in genotype, and a DNAJB6a gene knockout mouse can be effectively obtained.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a construction method and application of a DNAJB6a gene-specific knockout mouse model. BACKGROUND

[0002] In 2012, DnaJ heat shock protein 40 family member B6 (DNAJB6) was first reported to be a pathogenic gene of myofibrillar myopathies (MFMs).

[0003] MFMs are a group of genetic skeletal muscle diseases with abnormal deposition of myofibrillar-related proteins as the core pathological feature, and are highly heterogeneous in clinical manifestations. The global incidence of MFMs is about 1 / 50,000-1 / 100,000, which belongs to the category of rare diseases. However, the onset age of MFMs ranges widely, from adolescence to middle age. The lesions mainly involve distal muscles or proximal muscles of the limbs, often combined with cardiomyopathy and / or respiratory dysfunction, and have a high rate of disability, which brings a heavy burden to families and society. Therefore, it is of great value to identify the pathogenic genes or mutations of MFMs and elucidate the underlying pathogenic mechanisms for guiding precise clinical diagnosis and treatment.

[0004] DNAJB6 is located on human chromosome 7q36.3, containing 10 exons, with a full length of about 13.5 kb. Due to the difference in selective splicing of mRNA, there are two subtypes of DNAJB6 protein encoded, among which DNAJB6a is located in the nucleus and is encoded by exons 1-10, while DNAJB6b is located in the cytoplasm and is encoded by exons 1-8. They are both important molecular chaperones, widely expressed in tissues and organs such as skeletal muscle, brain and testis of mammals, and their amino-terminal have the same J domain, glycine / phenylalanine (G / F) region and serine / threonine (S / T) region, but their carboxy-terminal are different. So far, 18 DNAJB6 gene mutations reported to be associated with MFMs are all located in the 1-8 exon region, which encode amino acids all located in the J domain and G / F domain of DNAJB6 protein. These mutations eventually mediate the abnormal activation of heat shock protein 70 and cause its excessive consumption, thereby hindering the normal clearance of downstream misfolded proteins, leading to MFMs through Gain of function (GOF) mechanism; while the amino acids in the S / T region can mediate interaction with aggregation-prone proteins to exert anti-aggregation function and maintain cellular homeostasis, and their functional imbalance can mediate abnormal deposition of aggregation-prone proteins such as huntingtin, alpha-synuclein, Aβ42 protein and transactive response DNA-binding protein-43 (TARDNA binding protein-43, TDP-43). With the in-depth research, people gradually revealed the core pathological role of DNAJB6b in the occurrence and development of neurogenetic and neurodegenerative diseases.

[0005] There are defects in the prior art. 1. In the existing mouse model, DNAJB6 completely knockout mice have the defect of embryonic lethality. 2. In the existing adult DNAJB6 double mutant zebrafish model, due to the double knockout, it is difficult to distinguish the pathological contribution of each gene. 3. In the cell line model of DNAJB6a subtype knockdown, the use of morpholino (MO) for subtype-specific knockdown will bring dose-dependent toxicity, and high-dose E8i8 morpholino will cause abnormal morphology of myotubes and cause non-specific cell damage.

[0006] In 2020, the team first found a homozygous new mutation of c.695_699del (p.V232Gfs 7) in a patient with MFMs. This mutation is located in exon 9, which specifically encodes the carboxy-terminal region of DNAJB6a, causing truncation of DNAJB6a and leading to a significant decrease in the expression of DNAJB6a. However, there is currently no related research on DNAJB6a in skeletal muscle diseases.

[0007] Therefore, in order to better explore the physiological and pathological effects of DNAJB6a in the skeletal muscle of mammalian small animals, and study the specific mechanism of DNAJB6a deletion mediated MFMs, it is necessary to develop a method for constructing a DNAJB6a gene specific knockout mouse model. SUMMARY

[0008] In view of the deficiencies of the prior art, the purpose of the present application is to provide a method for constructing a DNAJB6a gene specific knockout mouse model and application thereof.

[0009] The purpose of the present application is achieved by the following technical solutions. A method for constructing a DNAJB6a gene specific knockout mouse model, comprising the following steps: S1: designing a gRNA sequence for the 9-10 exon region of the mouse DNAJB6 gene; S2: preparing Cas9 mRNA and gRNA by in vitro transcription; S3: mixing Cas9 mRNA and gRNA and then microinjecting into mouse zygotes; S4: transplanting the injected zygotes into pseudopregnant female mice to obtain F0 generation mice; S5: screening positive F0 generation mice through genotyping and mating with wild type mice to obtain F1 generation heterozygous mice; S6: mating F1 generation heterozygous mice to obtain F2 generation homozygous mice, and establishing a DNAJB6a gene specific knockout mouse model.

[0010] Further, the target sequence of the gRNA comprises: gRNA-1: 5'-TGTGAGCCTCAGCCCTCCCTTGG-3' (SEQ ID NO: 1); gRNA-2: 5'-ATGACAACTGACCTCTATATGGG-3' (SEQ ID NO: 2).

[0011] Further, the genotyping adopts a double PCR reaction system, including outer primer pair P1 / P2 and inner primer pair P3 / P4, wherein: P1: 5'-TTCTGGGAGAGTACCTGGGG-3' (SEQ ID NO: 3); P2: 5'-AGAGTGGGGTCTGAGTGTCC-3' (SEQ ID NO: 4); P3: 5'-TGATGCTTCCTTGGTTGCTGG-3' (SEQ ID NO: 5); P4: 5'-TTCTGTGGGCGGGTGCTG-3' (SEQ ID NO: 6).

[0012] Further, the determination criteria of the genotype identification are: Wild type mice: P1 / P2 primers amplify a single 6272bp fragment, P3 / P4 primers amplify a 574bp fragment; Heterozygous mice: P1 / P2 primers amplify both 6272bp and 643bp fragments, P3 / P4 primers amplify a 574bp fragment; Homozygous mice: P1 / P2 primers amplify a single 643bp fragment, P3 / P4 primers have no amplification product.

[0013] Further, the DNAJB6a gene knockout is achieved by the CRISPR / Cas9 system mediated non-homologous end joining repair mechanism, and the knockout region is specific to the DNAJB6a subtype without affecting the expression of the DNAJB6b subtype, and the knockout region size is 5629bp or 5634bp.

[0014] The DNAJB6a gene specific knockout mouse model constructed by the above method.

[0015] Further, the mouse model at 4 months of age shows the following characteristics compared with the wild type mice of the same age: Motor dysfunction: the double upper limb suspension time is significantly shortened; Skeletal muscle atrophy: the volume of the tibialis anterior muscle, the long toe extensor muscle, the gastrocnemius muscle and the fish muscle is reduced, the gastrocnemius muscle fiber is obviously thinned, and the mitochondrial morphology is abnormal; Mitochondrial dysfunction: succinate dehydrogenase and epoxidase activity is reduced; Abnormal deposition of myofibril related proteins: including deposition of desmin (DES), myotilin (MYOT) and TDP-43 in the cytoplasm.

[0016] The application of the DNAJB6a gene specific knockout mouse model in the study of MFMs in mammalian small animal models.

[0017] The application of the DNAJB6a gene specific knockout mouse model in the study of the physiological function of the DNAJB6a gene in skeletal muscle and in the pathogenesis of MFMs.

[0018] A reagent for DNAJB6a gene specific knockout, comprising Cas9 mRNA and gRNA, the target sequence of the gRNA comprising: gRNA-1: 5'-TGTGAGCCTCAGCCCTCCCTTGG-3'. gRNA-2: 5'-ATGACAACTGACCTCTATATGGG-3'.

[0019] Advantages of the present application: (1) The method for constructing a DNAJB6a gene knockout mouse model provided by the present application is simple to operate, has a short construction process, and has stable genotypes. By precisely knocking out the 9th-10th exon specific to DNAJB6a, the specific deletion of the DNAJB6a protein is realized, and the normal expression of DNAJB6b is not interfered. The problem of embryonic lethality caused by complete knockout is solved, and DNAJB6a gene knockout mice can be effectively obtained.

[0020] (2) The DNAJB6a gene specific knockout mouse is obtained by the CRISPR / Cas9 technology, and the DNAJB6a gene knockout mouse constructed in the present application starts to show the MFM phenotype of decreased motor function, skeletal muscle cell atrophy, decreased mitochondrial related enzyme activity, rimmed vacuoles, myofibril rupture, swollen and damaged mitochondria, and abnormal deposition of myofibril related proteins in the cytoplasm at 4 months of age. The DNAJB6a gene knockout mouse has great significance for the research of MFMs disease, and has the advantages of short construction cycle, low cost, and stable genetic inheritance of genotypes.

[0021] (3) The mouse model constructed in the present application can be used for studying the function of DNAJB6a in skeletal muscle disease, exploring the pathogenesis of MFMs, and establishing a related drug screening platform. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, for those skilled in the art, other drawings can also be obtained without creative labor based on these drawings.

[0023] Figure 1 : DNAJB6 protein molecular model diagram; Figure 2 : Principle diagram of obtaining DNAJB6a knockout by CRISPR / Cas9 technology; Figure 3 : Sequencing result alignment of F1 generation mouse knockout type 1; Figure 4 : Sequencing result alignment of F1 generation mouse knockout type 2; Figure 5 : F2 generation PCR product size diagram and electrophoresis product of PCR amplification of F2 generation mouse gene fragment; Figure 6Motor function and skeletal muscle histopathological features of DNAJB6aKO mice; Figure 7 Molecular pathological features of skeletal muscle tissue in DNAJB6aKO mice. Detailed Implementation

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Design and synthesis of gRNA and Cas9 mRNA targeting the DNA JB6 gene. like Figure 1 As shown, Figure 1 The DNAJB6a and DNAJB6b subtypes share a common sequence in their molecular structure: an N-terminal J region, a G / F region, and a C-terminal S / T region. The amino acid sequences at the C-terminal tail differ between the two subtypes: the a region and the b region. The DNAJB6 gene (Ensembl:ENSMUSG00000029131) contains 10 exons and is approximately 13.5 kb in length. Due to differences in alternative splicing of the mRNA, the encoded DNAJB6 protein exists in two subtypes: DNAJB6a, located in the nucleus and encoded by exons 1-10, and DNAJB6b, located in the cytoplasm and encoded by exons 1-8.

[0026] like Figure 2 As shown, exons 9-10 of the DNAJB6-201 transcript (ENSMUST00000008733.15) were selected as the knockout region to completely terminate the coding of exons 9-10 of DNAJB6, thus completely eliminating the effect of DNAJB6a on the mouse model. Using CRISPR / Cas9 gene editing technology, a mutation was introduced via non-homologous end-joining (NHEJ) to knock out the exon 9-10 region of the DNAJB6 gene. This operation resulted in the degradation of DNAJB6a mRNA, leading to the loss of DNAJB6a protein expression, but did not affect the expression of DNAJB6b, successfully constructing a DNAJB6a gene-specific knockout mouse model.

[0027] Based on the above target selection, we continue to design gRNA for the 3'downstream sequence of the 8th intron and the 10th exon of the DNAJB6 gene using the website (http: / / crispor.tefor.net / ), and select the results with higher scores.

[0028] We finally screened and synthesized two efficient and specific gRNAs, and their target sequences are as follows: gRNA-1: 5'-TGTGAGCCTCAGCCCTCCCTTGG 3' (SEQ ID NO: 1) gRNA-2: 5'-ATGACAACTGACCTCTATATGGG-3' (SEQ ID NO: 2) Through in vitro transcription, gRNA and Cas9 mRNA were obtained for subsequent microinjection.

[0029] Example 2 Fertilized egg injection After mixing gRNA and Cas9 mRNA, they were microinjected into the fertilized eggs of C57BL / 6J mice, and the injected fertilized eggs were transplanted into pseudopregnant female mice. The mice born about 20 days later were F0 mice.

[0030] Example 3 F0 mice were obtained and genotyped Design primers The specific primer sequences are as follows: I: TTCTGGGAGAGTACCTGGGG; II: AGAGTGGGGTCTGAGTGTCC PCR reaction system and reaction conditions (1) Prepare 20 μL reaction system: ddH2O 8.05 μL, 2 × PCR Buffer 10 μL, KOD-Multi&Epi- 0.35 μL, upstream amplification primer (20 pmol / µl) 0.3 μL, downstream amplification primer (20 pmol / µl) 0.3 μL, template 1 μL. Mix gently, centrifuge briefly, and place in a PCR instrument for reaction.

[0031] (2) The reaction conditions are as follows: 94℃, 3min (1 Cycle); 98℃ 15s, 63℃ 15s, 68℃ 5min (35 Cycles); 68℃ 5min (1 Cycle); 12℃ ∞ (1 Cycle).

[0032] The wild-type mouse genome sequence information in the genotype identification results of the F0 generation is GGCTCTAGAGATGGAGCCATCTTTTGGGAATGAAGGTGTGTGAAGCCTCTTGCTCCCAAGGGAGGGCTGAGGCTCACAGC...AAAGTGACACTTTAGGGGGTGGGGGAAATGTGTTGGTGTCCCATATAGAGGTCAGTTGTCATCC (SEQ ID NO: 7).

[0033] The positive mice in the genotype identification results of the F0 generation are No. 14 and No. 16, and the sequencing results show that the main mutation types carried by each of them are as follows: No. 14 mouse is a deletion of 5629 bp, GGCTCTAGAGATGGAGCCATCTTTTGGGAA...(-5629 bp)...GGTGGGGGAAATGTGTTGGTGTCCCATATAGAGGTCAGTTGTCATCC (SEQ ID NO: 8); and No. 16 mouse is a deletion of 5634 bp + insertion of 1 bp, GGCTCTAGAGATGGAGCCATCTTTTGGG...(-5634+1 bp)...GGGGGGAAATGTGTTGGTGTCCCATATAGAGGTCAGTTGTCATCC (SEQ ID NO: 9).

[0034] Example 4: Obtaining of F1 generation mice and genotype identification and comparative analysis The sequencing-verified positive F0 generation mice were mated with wild-type C57BL / 6J mice, and the offspring were screened by PCR amplification and sequencing, and the identification method was the same as that for the F0 generation mice. The results showed that F1 generation heterozygous mice that can stably inherit were successfully obtained, and the F1 generation heterozygous mice had two knockout types, respectively carrying different mutant alleles 1 or allele 2: allele 1 was a deletion of 5629 bp; and allele 2 was a deletion of 5634 bp and insertion of 1 bp.

[0035] The information of the finally obtained F1 generation heterozygous mice is as follows: (1) Genotype analysis of knockout type 1 (-5629 bp) mice (2) Genotype analysis of knockout type 2 (-5634+1 bp) mice Comparative analysis of genotype of knockout type 1 mice ① Sequence alignment before and after knockout WT: GGCTCTAGAGATGGAGCCATCTTTGGGAATGAAGGTGTGTGAAGCCTCTTGCTCCCAAGGGAGGGCTGAGGCTCACAGC...AAAGTGACACTTTAGGGGGTGGGGGAAATGTGTTGGTGTCCCATATAGAGGTCAGTTGTCATCC (SEQ ID NO: 7).

[0036] MT: GGCTCTAGAGATGGAGCCATCTTTTGGGAA...(-5629bp)...GGTGGGGGAAATGTGTTGGTGTCCCATATAGAGGTCAGTTGTCATCC (SEQ ID NO: 8).

[0037] ② Comparison of sequencing results before and after knockout, as follows Figure 3 As shown, Figure 3 In this text, Query represents the wild-type genome sequence, and Subject represents the actual sequencing results. ③ Gene function analysis before and after knockout: In this strain of mice, the target gene sequence is missing before and after gene knockout, resulting in the degradation of the target gene mRNA and thus loss of gene function.

[0038] Genotypic Comparison Analysis of Knockout Type 2 Mice ① Sequence alignment before and after knockout WT: GGCTCTAGAGATGGAGCCATCTTTGGGAATGAAGGTGTGTGAAGCCTCTTGCTCCCAAGGGAGGGCTGAGGCTCACAGC...AAAGTGACACTTTAGGGGGTGGGGGAAATGTGTTGGTGTCCCATATAGAGGTCAGTTGTCATCC (SEQ ID NO: 7).

[0039] MT: GGCTCTAGAGATGGAGCCATCTTTTGGG...(-5634+1bp)...GGGGGGAAATGTGTTGGTGTCCCATATAGAGGTCAGTTGTCATCC (SEQ ID NO: 9).

[0040] ② Comparison of sequencing results before and after knockout, as follows Figure 4 As shown, Figure 4 In this text, Query represents the wild-type genome sequence, and Subject represents the actual sequencing results. 3. Gene function analysis before and after knockout: In this mouse strain, the target gene sequence is deleted before and after gene knockout, causing the degradation of target gene mRNA and the loss of gene function.

[0041] Example 5: Subsequent breeding and identification The obtained gene knockout heterozygous mice were divided into two parts: one part of the heterozygous mice were mated with wild type mice to breed more heterozygous mice; the other part of the heterozygous mice were self-crossed to breed F2 generation mice, and DNAJB6a gene knockout homozygous mice were screened from the F2 generation mice for gene knockout effect verification and subsequent phenotype analysis.

[0042] Genotype identification method (1) Genomic DNA extraction: F2 generation mice were sampled by tail cutting, and appropriate amount of tissue digestion solution was prepared. The volume ratio of DNA Extraction Solution and Enzyme Mix in the mouse tail PCR kit (from Biyun Tian) was 24:1. About 100 μL of digestion solution was added to each mouse tail, 55°C water bath for 15 minutes, then 95°C water bath for 5 minutes. After adding 100 μL of Stop Solution, vortex mixing, and taking the supernatant for subsequent experiments.

[0043] (2) Design of PCR identification primers: double PCR reaction system was used, and two pairs of primers were used to amplify the same genomic DNA sample at the same time, so as to accurately distinguish wild type, heterozygous and homozygous genotypes.

[0044] Outer primers (P1 / P2): designed outside the knockout fragment, the purpose is to amplify the knockout fragment. In wild type genome, the distance between the upstream and downstream primers is far, which can amplify a 6272 bp fragment; in mutant genome, the middle 5.6 kb sequence is deleted, the distance between the upstream and downstream primers is close, which can amplify a 643 bp fragment.

[0045] Inner primers (P3 / P4): designed inside the knockout fragment, which is used as an internal control primer. Only in wild type or heterozygous genome, a 574 bp fragment can be amplified; in homozygous genome, no fragment can be amplified.

[0046] The specific primer sequences are as follows: (3) PCR reaction system and reaction conditions: two independent PCR reaction tubes (reaction system A and reaction system B) were set for each sample.

[0047] ① Reaction system A: prepare 20 μL reaction system: ddH2O 7.4 μL, 2xRapidTaqMasterMix 10 μL, Primer I (10 pmol / μΐ) 0.8 μL, Primer II (10 pmol / μΐ) 0.8 μL, template 1 μL.

[0048] B: 20 μL reaction system was prepared: ddH2O 7.4 μL, 2x Rapid Taq Master Mix 10 μL, Primer III (10 pmol / μΐ) 0.8 μL, Primer IV (10 pmol / μΐ) 0.8 μL, template 1 μL. Mix gently, centrifuge briefly, and place in PCR instrument for reaction.

[0049] III. Reaction conditions: 95°C, 3 min (1 Cycle); 95°C 15 s, 60°C 15 s, 72°C 1 min (35 Cycles); 72°C 5 min (1 Cycle); 12°C ∞ (1 Cycle).

[0050] (4) Prepare 1.2% agarose gel, heat in microwave oven, after dissolving, add 8 μL nucleic acid dye, mix evenly, then pour into the gel tank for 30 min. Transfer the gel block to the electrophoresis tank, adjust the voltage to 100 V, take out the gel block after 35 min, and develop.

[0051] (5) The size of the PCR product obtained: wild-type mice: P1 / P2 primer amplification obtained a single 6272 bp fragment, P3 / P4 primer amplification obtained a 574 bp fragment; heterozygous mice: P1 / P2 primer amplification obtained two fragments of 6272 bp and 643 bp, P3 / P4 primer amplification obtained a 574 bp fragment; homozygous mice: P1 / P2 primer amplification obtained a single 643 bp fragment, P3 / P4 primer amplification could not obtain a fragment. Genotype identification electrophoresis map is shown in Figure 5 .

[0052] Example 6 DNAJB6a-specific knockout mice develop motor dysfunction and muscle pathological changes As shown in Figure 6 , Figure 6 a. Upper limb suspension test results (n = 9-15), b. pull test results (n = 9-15), c. muscle tissue volume at different parts, TA: tibialis anterior; EDL: extensor digitorum longus; GA: gastrocnemius; SOL: soleus. d. Gastrocnemius cytochemical staining, Bar = 100 pm, e. Gastrocnemius ultramicroscopy. P value <0.05, <0.01. WT: wild type; HOM: DNAJB6a KO homozygote. Black arrow: rimmed vacuoles. Blue arrow: autophagic bodies in mitochondria. Red arrow: swollen mitochondria.

[0053] Compared with wild-type mice from the same littermate, 4-month-old DNAJB6aKO homozygous mice began to show a significantly shorter suspension time of both forelimbs. Figure 6 a) There was no significant difference in the pulling force of the four limbs. Figure 6 b) Muscle atrophy occurs in skeletal muscle ( Figure 6 Decreased activity of mitochondrial-related enzymes [succinate dehydrogenase (SDH) and cyclooxygenase (CCO)] Figure 6 d).

[0054] Example 7: Myofibril-associated protein deposition occurred in the skeletal muscle of mice with specific knockout of DNA JB6a. like Figure 7 As shown, Figure 7 a. Immunofluorescence staining of Desmin and Myotilin proteins in mouse extensor digitorum longus muscle cells, Bar=100µm. b. Western blot images of Desmin and Myotilin proteins in mouse extensor digitorum longus muscle. cd. Semi-quantitative statistical plots of figures b (n=3 per group). Pvalue= <0.05, <0.01.WT: Wild type; HOM: DNAJB6a knockout homozygous. Arrow indicates: Abnormally deposited protein. Compared with wild-type mice of the same age, 4-month-old DNAJB6aKO homozygous mice showed typical pathological features of myofibril-related proteins (Desmin, Myotilin, and TDP-43) in skeletal muscle cells. Figure 7 a), and the expression level was significantly increased ( Figure 7 (bd). That is, the constructed DNAJB6a gene knockout mice began to show MMFM-like phenotypes at 4 months of age, including decreased motor function, skeletal muscle cell atrophy, decreased mitochondrial-related enzyme activity, the appearance of rimmed vacuoles, myofibril breakage, mitochondrial swelling and destruction, and abnormal deposition of myofibril-related proteins in the cytoplasm. This is of great significance for the study of MMFs diseases.

[0055] In summary The present application can construct gene knockout mice with typical MFMs phenotype. The cell and animal models constructed in the past have significant shortcomings in simulating the typical pathological characteristics of MFMs, and it is difficult to fully and accurately present the characteristics of the disease. This makes the research on the pathogenesis of MFMs lack of ideal mammalian small animal models, which seriously restricts the in-depth understanding of the disease and the research and development of related treatment methods. The DNAJB6a gene-specific knockout mice successfully constructed by the present application have a series of MFMs phenotypes. These mice have significantly decreased motor function, skeletal muscle cell atrophy, significantly reduced activity of mitochondrial-related enzymes such as succinate dehydrogenase and epoxidase, intracellular rimmed vacuoles, myofibril fragmentation, swollen and damaged mitochondria, and abnormal deposition of myofibril-related proteins Desmin, Myotilin and TDP-43 in the cytoplasm. These rich and typical pathological characteristics provide an extremely effective animal model for exploring the physiological and pathological role of DNAJB6a in the skeletal muscle of mammalian small animals, and help researchers to deeply analyze the pathogenesis of DNAJB6a deficiency-mediated MFMs, and lay a solid foundation for the development of targeted treatment methods.

[0056] The construction method of the present application has a short technical cycle and high efficiency. Traditional gene mouse model construction methods, such as homologous recombination technology, are extremely tedious to operate. It needs to go through many complex steps such as constructing a targeted vector and screening embryonic stem cells, resulting in a long construction cycle, low efficiency, greatly increasing research and time costs, and seriously limiting the rapid progress of related research. The method for constructing DNAJB6a gene-specific knockout mice provided by the present application uses CRISPR / Cas9 technology, has the significant advantage of simple operation, and reduces a large number of complex intermediate links. Moreover, the construction time is greatly shortened, and DNAJB6a gene-specific knockout mice can be efficiently obtained in a short time, which significantly improves the construction efficiency of gene knockout mouse models, reduces research costs, and enables researchers to more efficiently carry out subsequent research work related to DNAJB6a gene and MFMs.

[0057] The basic principles, main features and advantages of the present application are shown and described above. Those skilled in the art should understand that the present application is not limited by the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application.

Claims

1. A method for constructing a DNAJB6a gene-specific knockout mouse model, characterized by, Comprising the following steps: S1: design gRNA sequence targeting exon 9-10 region of mouse DNAJB6 gene; S2: prepare Cas9 mRNA and gRNA by in vitro transcription; S3: mix Cas9 mRNA and gRNA and then microinject into mouse zygotes; S4: transplant the injected zygotes into pseudopregnant female mice to obtain F0 generation mice; S5: screen positive F0 generation mice by genotyping and cross them with wild-type mice to obtain F1 generation heterozygous mice; S6: cross F1 generation heterozygous mice to obtain F2 generation homozygous mice and establish DNAJB6a gene-specific knockout mouse model.

2. The method for constructing a mouse model with specific knockout of the DNA JB6a gene according to claim 1, characterized in that, The target sequence of the gRNA comprises: gRNA-1: 5'-TGTGAGCCTCAGCCCTCCCTTGG-3'; gRNA-2: 5'-ATGACAACTGACCTCTATATGGG-3'.

3. The method of constructing a DNAJB6a gene-specific knockout mouse model according to claim 1, wherein, The genotyping uses a double-PCR reaction system comprising outer primer pair P1 / P2 and inner primer pair P3 / P4, wherein: P1: 5'-TTCTGGGAGAGTACCTGGGG-3'; P2: 5'-AGAGTGGGGTCTGAGTGTCC-3'; P3: 5'-TGATGCTTCCTTGGTTGCTGG-3'; P4: 5'-TTCTGTGGGCGGGTGCTG-3'.

4. The method of claim 3, wherein the DNAJB6a gene-specific knockout mouse model is constructed by the following steps: (1) obtaining a DNAJB6a gene-specific knockout mouse model by the method of claim 1 or 2; (2) obtaining a DNAJB6a gene-specific knockout mouse model by the method of claim 1 or 2. The determination criteria for genotyping are as follows: Wild-type mice: P1 / P2 primers amplify a single 6272bp fragment, and P3 / P4 primers amplify a 574bp fragment; Heterozygous mice: P1 / P2 primers amplify both 6272bp and 643bp fragments, and P3 / P4 primers amplify a 574bp fragment; Homozygous mice: P1 / P2 primers amplify a single 643bp fragment, and P3 / P4 primers have no amplification product.

5. The method for constructing a mouse model with specific knockout of the DNA JB6a gene according to claim 1, characterized in that, The DNAJB6a gene knockout is achieved by the non-homologous end joining repair mechanism mediated by the CRISPR / Cas9 system, and the knockout region is specific to DNAJB6a subtype without affecting the expression of DNAJB6b subtype, with a size of 5629bp or 5634bp.

6. The DNAJB6a gene-specific knockout mouse model constructed by the method of any one of claims 1-5.

7. The mouse model of claim 6, wherein the mouse model is a mouse model of Alzheimer's disease. Compared with wild-type mice of the same age, the mouse model at 4 months of age exhibits the following characteristics: Motor dysfunction: significantly shortened double upper limb suspension time; Skeletal muscle atrophy: reduced volume of tibialis anterior muscle, extensor digitorum longus muscle, gastrocnemius muscle and soleus muscle, and significantly thinned gastrocnemius muscle fibers and abnormal mitochondrial morphology; Mitochondrial dysfunction: decreased succinate dehydrogenase and epoxidase activities; Abnormal deposition of myofibril-related proteins: including deposition of Desmin, Myotilin and TDP-43 in the cytoplasm.

8. Use of the DNAJB6a gene-specific knockout mouse model of any one of claims 6 or 7 in the study of mammalian small animal models of MFMs.

9. Use of the DNAJB6a gene-specific knockout mouse model of any one of claims 6 or 7 in screening drug targets for treating MFMs.

10. A reagent for DNAJB6a gene-specific knockout, characterized by, comprising a Cas9 mRNA and a gRNA, the target sequence of the gRNA comprising: gRNA-1: 5'-TGTGAGCCTCAGCCCTCCCTTGG-3'; gRNA-2: 5'-ATGACAACTGACCTCTATATGGG-3'.

Images