Double-gene-labeled cell conditional knockout mouse model and construction method thereof

Abstract

The invention discloses a double-gene-labeled cell conditional knockout mouse model and a construction method thereof, and belongs to the technical field of animal model construction. The construction method comprises the following steps: respectively constructing an F1-generation PDGFRa-Cre mouse, an F1-generation CD34-Dre mouse and an F1-generation CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mouse, carrying out mutual breeding to obtain an F2-generation mouse, and screening the mice which express DTR in cells which are co-expressed by a CD34 gene and a PDGFRa gene. The double-gene marker cell conditional knockout mouse model is constructed through CD34 + PDGFR alpha + teterocyte ablation, specific gene knockout of double-gene positive expression cells of a target tissue is achieved, and an experimental tool can be provided for verifying feasibility of teterocyte targeted therapy when the mouse model is used for an acute lung injury disease related animal model.

Description

Technical Field

[0001] This invention belongs to the field of animal model construction technology, specifically relating to a conditional knockout mouse model of dual-gene marker cells and its construction method. Background Technology

[0002] In recent years, the incidence and mortality rates of acute and chronic lung injury in my country have remained high, not only affecting patients' quality of life but also imposing a huge burden on the national economy. Acute lung injury is mostly caused by direct or indirect external forces acting on the body, while chronic lung injury is mostly caused by long-term smoking, infection, tumors, and other factors. Common acute lung injuries include acute respiratory distress syndrome (ARDS), an acute onset of hypoxic respiratory failure induced by factors such as sepsis, pneumonia, inhalation of harmful substances, burns, severe trauma with shock, and massive blood transfusions. It is caused by acute inflammatory edema of the lungs due to non-left heart failure, accompanied by bilateral lung infiltration. Despite significant advancements in anti-infective drugs and respiratory support techniques, the incidence and mortality rates of ARDS in the elderly remain high. Some patients with acute respiratory distress syndrome later develop chronic lung injury such as interstitial fibrosis, leading to varying degrees of persistent lung function impairment. Another common chronic lung injury is chronic obstructive pulmonary disease (COPD), which has a high incidence rate worldwide and is one of the leading causes of disability and death, with its incidence continuously increasing. Therefore, there is an urgent need to explore new intervention methods for acute and chronic lung injury. Timely protection and initiation of lung tissue cell repair are key factors in lung tissue repair after acute and chronic lung injury. Intercellular communication and interactions within the lung tissue microenvironment are related to prognosis. Therefore, in-depth research into the molecular regulatory mechanisms of intercellular communication and interactions in lung tissue during acute and chronic lung injury, and targeting the dominant role of signal transduction, is crucial for mitigating or preventing tissue cell damage, accelerating alveolar membrane integrity repair, and improving patient prognosis and survival.

[0003] Teratoblastic cells (TCs) are a novel type of mesenchymal cell, primarily composed of CD34. + Vimentin + or CD34 + ckit + or CD34 + PDGFRα + Double-positive labeled cells, CD34 + PDGFRα +It is also recognized by scientists in the field of Terois cell research. Studies have found that Terois cells are widely distributed in the smooth muscle layer of alveolar interstitium, small blood vessels, and small airways in the lungs, and are closely related to type I and II alveolar epochs (EpCs). They have the function of promoting damage repair, and their protective role in acute lung injury (ALI) and myocardial ischemia-reperfusion injury has been confirmed. They also participate in the development of COPD. Fibrosis after tissue injury may be related to tissue cell senescence after inflammatory stimulation. Theoretically, reducing tissue inflammation and injury can alleviate subsequent fibrosis or tissue cell senescence to some extent. However, the mechanism of action of Terois cells in acute and chronic lung injury is still unclear, and there is no research on fibrosis and senescence after tissue injury. Previous studies have reported the isolation and identification of lung Terois cells from mouse and human lung tissue, the establishment of immortalized cell lines, and the elucidation of their mechanism of reducing pneumonia edema and other ALI symptoms through experiments, laying the cell line foundation for their clinical treatment.

[0004] However, traditional in vitro cell experiments cannot simulate the in vivo microenvironment, necessitating the construction of a dual-gene marker cell conditional knockout mouse model. This model can be applied to fundamental research and animal experiments on the pathogenesis analysis and intervention strategy development of major diseases such as acute and chronic diseases and tumors, while also providing experimental support for cell-to-cell communication between Terois cells and other cell types. A dual-gene marker cell conditional knockout mouse model with two LoxP sites was created by inserting two LoxP sites at both ends of one or more important exons of the target gene. Before hybridization with mice expressing Cre recombinase, gene expression was normal; when flopped mice were hybridized with mice expressing tissue-specific Cre enzyme, the gene was knocked out.

[0005] Commonly used gene recombination systems include Cre-loxP, Frt-Flp, and Dre-Rox. Cre protein is a recombinase belonging to the Int supergene family. The LoxP site, an abbreviation for locusofX-overP1, is a 34bp sequence located in P1 phage, composed of two 13bp inverted palindromic sequences and an 8bp spacer sequence. The spacer sequence determines the orientation of the loxP. Cre recombinase not only has catalytic activity but also, similar to restriction enzymes, can recognize specific DNA sequences, i.e., loxP sites, inducing gene recombination between the two loxP sites. Cre recombinase does not require any auxiliary factors and can act on DNA substrates of various structures, such as linear, circular, and even supercoiled DNA. Cre-loxP induces gene recombination mainly through the following mechanisms: When two loxP sites exist in the cell genome, the presence of Cre recombinase will induce recombination between the two loxP sites. First, Cre recombinase binds to two 13bp palindromic sequences to form a dimer, which then binds to a dimer at another LoxP site to form a tetramer. Subsequently, the double-stranded DNA between these two LoxP sites is cleaved by Cre recombinase, and the cleavage is rejoined by DNA ligase. The outcome of recombination depends on the orientation of the two LoxP sites, and there are several possibilities (…). Figure 22 ① Two loxP sites are located on the same DNA strand and are oriented in the same direction. Cre recombinase can effectively knock out the sequence between the two loxP sites. Figure 22 A); ② The two loxP sites are located on the same DNA strand, but in opposite directions. Cre recombinase can induce sequence flipping between the two loxP sites ( Figure 22 B); ③ The two loxP sites are located on two different DNA strands or chromosomes, and Cre enzymes can induce the exchange of the two DNA strands or chromosomal translocation ( Figure 22 C). The Cre-loxP system boasts advantages such as high efficiency, strong specificity, and the ability to be expressed by type II promoters, ensuring that Cre recombinases are expressed in different cells, tissues, and organs of an organism, or at different developmental stages or under different physiological conditions, thus achieving high tissue and cell specificity. The Dre-rox recombination system, discovered in P1-likephages in 2004, is similar to the Cre / loxP system, consisting of a recombinase and a specific DNA sequence. The efficiency and optimal temperature of the Dre recombinase are comparable to those of the Cre recombinase. Researchers have verified in E. coli, mammalian cells, and mice that the deletion efficiency of the Dre-rox recombination system is very high.

[0006] DTR mice, or diphtheria toxin receptor (DTR) mice, are mice sensitized to diphtheria toxin (DT) by introducing the heparin-binding EGF-like growth factor precursor receptor (proHB-EGF, or DTR) gene into specific cells of the mouse through gene editing. Injecting these mice with DT specifically eliminates DTR-expressing cells, while other cells remain unaffected. By combining DTR-expressing flux mice with Cre mice through the Cre-loxP system, DTR-expressing flux mice can be bred, and DT can be injected into the flux mice at the desired time to achieve specific cell elimination. Summary of the Invention

[0007] The main objective of this invention is to provide a method for constructing a conditional knockout mouse model using dual-gene marker cells, through CD34. + PDGFRα + A conditional knockout mouse model of CD34 and PDGFRα dual-gene marker cells was constructed by Teroblast ablation, which can achieve specific gene knockout of cells with positive expression of the two genes in the target tissue and accurately analyze their tissue-specific functions.

[0008] Another objective of this invention is to provide the application of the conditional knockout mouse model of the dual-gene marker cells in animal models of acute lung injury, avoiding embryonic lethality or developmental defects caused by systemic knockout, focusing on the pathological role of adult teratocytic cells in acute lung injury, and providing experimental tools to verify the feasibility of teratocytic cell targeted therapy, helping to reveal the mechanisms of cell-cell interactions and tissue repair, and promoting the mechanistic research and drug development of acute lung injury.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] In a first aspect, the present invention provides a method for constructing a conditional knockout mouse model of dual-gene marker cells, comprising the following steps:

[0011] (1) Construction of PDGFRa-Cre mice: The “Cre-rBGpA” expression box was inserted into the N-terminus of the PDGFRa in situ gene. Under the control of the PDGFRa promoter, Cre was expressed in PDGFRa positive cells. The target sequence was knocked out by the Cre-loxP system to obtain F1 generation PDGFRa-Cre mice. The Cre-loxP system process includes: designing and synthesizing gRNA with the sequence shown in SEQ ID NO: 13, constructing Donor plasmid, mixing gRNA and Donor plasmid to obtain RNP complex; injecting RNP complex and plasmid DNA together into mouse zygotes via pronuclear microinjection, culturing zygotes and performing embryo transfer, passage culture and identification to obtain F1 generation PDGFRa-Cre mice; the lengths of the inserted fragments are 10.28kb (5') and 8.08kb (3'), respectively, and the sequences of the primers for the inserted fragments are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0012] (2) Construction of CD34-Dre mice: The “Dre-rBGpA” expression box was inserted into the N-terminus of the CD34 in situ gene. Under the control of the CD34 promoter, Dre was expressed in CD34 positive cells. The target sequence was knocked out by the Dre-rox system to obtain F1 generation CD34-Dre mice. The lengths of the inserted fragments were 8.85kb (5') and 9.84kb (3'), respectively. The sequences of the primers for the inserted fragments are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0013] (3) Construct CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mice; connect the “CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-Kozak-DTR” element with the upstream and downstream homologous arms of the target site to assemble it into a Donor plasmid; use 3xSV40 pA as a transcription terminator to block the control of DTR by the CAG promoter; and use the gene recombination system to form loxP-3xSV40 pA-loxP and Rox-3xSV40 pA-Rox elements; realize 3xSV40 through the Cre-loxP system and the Dre-rox system. The knockout of pA resulted in F1 generation CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mice. The inserted fragments and their lengths were 5'Probe-Bsu36I: 4.48 kb-WT and 7.77 kb-MT, and 3'Probe-BstEII: 4.77 kb-WT and 3.78 kb-MT, respectively. The sequences of the 5' probe primers are shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively; the sequences of the 3' probe primers are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

[0014] (4) Construct CD34 + PDGFRa + Terro cell mice: F1 generation PDGFRa-Cre mice, F1 generation CD34-Dre mice and F1 generation CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mice obtained in steps (1) to (3) are crossbred to obtain F2 generation mice. Tri-gene positive mice are selected, that is, mice that express DTR in cells where CD34 gene and PDGFRa gene are co-expressed.

[0015] Preferably, in step (1), the sequences of identification primer F1 are shown in SEQ ID NO.9 and SEQ ID NO.10, respectively, and the sequences of identification primer F2 are shown in SEQ ID NO.11 and SEQ ID NO.12, respectively.

[0016] Preferably, in step (1), the Donor plasmid is constructed sequentially through fragment amplification, gel recovery, ligation (backbone + fragment) / transformation, bacterial detection, plasmid extraction from positive clones, enzyme digestion identification, and sequencing. The process includes: preparing a 50 μL system with P515 high-fidelity enzyme for PCR amplification, 30 cycles; electrophoresis of the PCR product and recovery of the gel at the target product position; ligation of the recovered fragment with C115 ligase, transformation of the ligated DNA fragment into E. coli using Stellar competent cells, and overnight culture at 37°C; selection of morphologically good plaques, preparation of a 25 μL system with P222 Taq enzyme for PCR amplification; selection of plaques with correct bands, inoculation into broth medium for small-scale shaking culture; extraction of plasmid by alkaline lysis; selection of NEB restriction enzyme, preparation of a 20 μL enzyme digestion system with the plasmid for enzyme digestion, sequencing of the correctly digested plasmid; inoculation of plasmid clones with correct sequencing results into broth medium for overnight culture, recovery of the plasmid, and thus the Donor plasmid.

[0017] Preferably, in step (1), the process of preparing the RNP complex includes: adding 0.8 μL of 100 pmol / μL CrRNA to 5.2 μL of RNase-free water, then adding 0.6 μL of 100 pmol / μL TracRNA, mixing and incubating for 5 min, then adding 0.2 μL of Cas9 protein, mixing and incubating for 10 min to obtain solution 1; using Donor plasmid with a final concentration of 15 ng / μL as solution 2; mixing solution 1 and solution 2 to obtain the RNP complex.

[0018] Preferably, in step (2), the sequences of the identification primer F3 are shown in SEQ ID NO.14 and SEQ ID NO.15, respectively, and the sequences of the identification primer F4 are shown in SEQ ID NO.16 and SEQ ID NO.17, respectively.

[0019] Preferably, in step (3), the sequences of the identification primer F5 are shown in SEQ ID NO.18 and SEQ ID NO.19, respectively, and the sequences of the identification primer F6 are shown in SEQ ID NO.20 and SEQ ID NO.21, respectively.

[0020] In a second aspect, the present invention provides a conditional knockout mouse model of dual-gene marker cells, namely the CD34-Dre*PDGFRα-Cre*ROSA26DTR mouse, which is constructed by the above-described method for constructing a conditional knockout mouse model of dual-gene marker cells.

[0021] In the above technical solution, diphtheria toxin (DT) is administered to CD34-Dre*PDGFRα-Cre*ROSA26DTR mice to ablate their teratocytic cells, thereby obtaining a mouse model with the CD34PDGFRα teratocytic cell knockout phenotype. Based on this model, acute and chronic lung disease models, or other acute and chronic diseases, tumors, and other major disease models, can be constructed for basic research and animal experiments on the pathogenesis analysis and intervention strategies of teratocytic cells in acute and chronic diseases, tumors, and other major diseases.

[0022] A third aspect of the present invention provides the application of the dual-gene marker cell conditional knockout mouse model in the construction of animal models associated with acute lung injury disease.

[0023] Compared with existing technologies, this invention inserts the "Cre-rBGpA" expression cassette into the N-terminus of the PDGFRa in situ gene. Under the control of the PDGFRa promoter, Cre is expressed in PDGFRa-positive cells. Through the action of the Cre-loxP system and diphtheria toxin A-diphtheria toxin receptor (DTR-DTA), three mouse models are constructed: CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mice, PDGFRa-Cre mice, and CD34-Dre mice. After breeding, CD34-Dre*PDGFRα-Cre*ROSA26DTR triple-positive mice are obtained. Mice with diphtheria toxin-induced, specifically ablated PDGFRα and CD34 double-positive teratocytic cells are then induced. CD34-Dre*PDGFRα-Cre*ROSA26DTR mice are treated with diphtheria toxin (DT) to ablate their teratocytic cells, thus constructing CD34PDGFRα teratocytic cell knockout mice as a model of LPS acute lung injury. The beneficial effects are:

[0024] I. This invention constructs CD34PDGFRα Teroblastic cell knockout mice through Teroblastic cell ablation as an LPS acute lung injury model. Single-cell sequencing is used to detect intercellular communication and interactions during acute lung injury, providing a disease model for the treatment and prevention of acute lung injury diseases such as acute lung injury in the elderly, pulmonary fibrosis after acute lung injury rehabilitation, and age-related lung diseases, and providing theoretical support for the development of clinical drugs and treatment of acute lung injury.

[0025] Second, the dual-gene marker cell conditional knockout mice of this invention can accurately verify the core role and molecular mechanism of Teratocytic cells in acute lung injury by specifically targeting and removing TCs or their key functional molecules, providing key experimental evidence for clinical translation and being used for the functional and drug intervention research of Teratocytic cells in disease models, which has important biomedical value. Attached Figure Description

[0026] Figure 1 The sequencing results in this example show the results of identifying the site-specific insertion of the “Cre-rBGpA” expression cassette into the N-terminus of the PDGFRa in situ gene.

[0027] Figure 2 The Southern identification in the example confirmed that 6 mice were correctly inserted.

[0028] Figure 3 The results of site-positive F1 generation mice identified by large-fragment primers in the examples are shown.

[0029] Figure 4 The sequencing results in this example show the results of identifying the "Dre-rBGpA" expression cassette inserted at the N-terminus of the CD34 in situ gene.

[0030] Figure 5 The Southern identification in the example confirmed that 6 mice were correctly inserted.

[0031] Figure 6 The results of identifying and screening CD34 site-positive F1 generation mice using large-fragment primers in the examples are shown.

[0032] Figure 7 The sequencing results in this example confirm that the genotype is correct.

[0033] Figure 8 The Southern identification in the example confirmed that 6 mice were correctly inserted.

[0034] Figure 9 The results of site-positive F1 generation mice identified by large-fragment primers in the examples are shown.

[0035] Figure 10 The results of genotyping identification for mice No. 5 and No. 7 in the examples are shown.

[0036] Figure 11 The results of PCR identification of the tails of conditionally knocked-out mice in the examples are shown.

[0037] Figure 12 CD34 in the example + PDGFRa + Evaluation results of the acute lung injury model in Tròrò cell-specific knockout mice.

[0038] Figure 13 The results of UMAP dimensionality reduction analysis are shown in the example.

[0039] Figure 14 The example shows the gene expression distribution of the annotated subgroups.

[0040] Figure 15 CD34 in the example + PDGFRa+ Mesenchymal cell subsets in LPS-induced CD34 + PDGFRa + The proportion of CKO cells decreased significantly; A: The dimensionality reduction distribution of the merged subpopulations in the WT+vehicle, WT+LPS, and CKO+LPS groups; B: Bubble diagrams annotating the gene expression of cell subpopulations; C: Changes in the proportion of each subpopulation in the three groups.

[0041] Figure 16 The following are the Cellphone DB intercellular communication analysis results from the examples: A: The ring diagram shows that, compared to the control group, the intercellular communication between telogen effluvium cells and epithelial cells, endothelial cells, monocytes, macrophages, and cDCs in the lung tissue of aged mice is more active in terms of the types of cells communicating with them and their scores; B: Cell Chat shows the heatmap corresponding to the inter-cell communication between different cell types in the lung tissue of aged mice and the control group; C: The ring diagram shows that, compared to the ALI model lung tissue, the inter-cell communication between telogen effluvium cells and epithelial cells, macrophages, monocytes, pDCs, and neutrophils is more active in aged mice; D: Cell Chat shows the heatmap corresponding to the inter-cell communication between different cell types in the lung tissue of aged mice and the ALI model; E: The ring diagram shows that, compared to the ALI model lung tissue, the inter-cell communication between telogen effluvium cells and epithelial cells, macrophages, endothelial cells, and cDCs in CKO mice is more active; F: Cell Chat shows the heatmap corresponding to the inter-cell communication between different cell types in the lung tissue of CKO mice and the ALI model.

[0042] Figure 17 The results of Cellphone DB intercellular communication analysis in the examples are shown below; G: Analysis of expression signals among various cell types in the lung tissues of aged mice and control mice using bubble diagrams; H: Analysis of expression signals among various cell types in the lung tissues of aged mice and ALI model mice using bubble diagrams; I: Analysis of expression signals among various cell types in the lung tissues of CKO mice and ALI model mice using bubble diagrams.

[0043] Figure 18 The following are the results of cell-to-cell communication analysis dominated by Terois cells in the examples; A: The bubble chart shows that Terois cells may regulate different cell types through different signals, and the effects and degrees of regulation on different cell types are inconsistent; B: The bubble chart shows that Terois cells have extensive activation of EGFR receptors under LPS stimulation, BMP signals from endothelial cells and epithelial cells disappear, and only BMP signals are provided by Terois cells themselves; C: The bubble chart shows the results of CD34 knockout. + PDGFRa +After teratoblastoma cells are induced, endothelial cells and epithelial cells target the teratoblastoma cell proliferation signal EPHB4-EFNB1 / EFNA5 for activation, and epithelial cells increase the BMP5 signal acting on teratoblastoma cells.

[0044] Figure 19 The following are examples of epithelial cell dimensionality reduction analysis clustering and characteristic gene expression profiles: A: Annotation and merging based on manual checks of known marker gene expression yielded 7 epithelial cell subpopulations; B: Gene expression profiles of each subpopulation are displayed; C: Gene enrichment analysis (GSEA) yielded the main functions of the 7 subpopulations; D: Transcription factor expression analysis of lung epithelial cell subpopulations in aged mice, LPS-induced acute lung injury model in aged mice, and LPS-induced model group in aged mice after Terois cell ablation is presented using heatmaps.

[0045] Figure 20 The examples show epithelial cell dimensionality reduction clustering and characteristic gene expression profiles; FK: Cellphone DB analysis shows that TCs in senescent lung tissue have the function of regulating downstream cells and regulating intercellular communication between downstream cells and other cells through intercellular communication.

[0046] Figure 21 The following are examples of epithelial cell dimensionality reduction clustering and characteristic gene expression profiles; L: Bubble diagram showing that Terois cells are the sole source of WNT5A signaling in AT2 cells.

[0047] Figure 22 The Cre-loxP-induced gene recombination modes are knockout (A), flipping (B), and translocation (C). Detailed Implementation

[0048] To more fully understand and demonstrate the technical solutions, objectives, and advantages of the present invention, the technical effects produced by the present invention will be further described in detail and completely below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. It should be noted that other embodiments obtained by those skilled in the art without departing from the concept of the present invention are all within the protection scope of the present invention.

[0049] Example 1

[0050] I. Construction of PDGFRα and CD34 double-positive teratophore cell mice

[0051] 1.1 Materials

[0052] Unless otherwise specified, all materials and reagents used in this embodiment are commercially available.

[0053] 1.2 Methods

[0054] (1) gRNA design

[0055] The gRNA was designed at http: / / crispor.tefor.net / , and a high-resolution gRNA was selected with the sequence CTCCAGTCTTTCTAGAAGATGGG (SEQ ID NO.13).

[0056] (2) Construction of Donor plasmid

[0057] Fragment amplification (5'arm, cKI, 3'arm): Novizan P515 high-fidelity enzyme was used to prepare a 50μL system for PCR amplification, with 30 cycles.

[0058] Gel recovery: Perform electrophoresis on the PCR products and recover the gel at the location of the target product using the Qiagen Gel Recovery Kit (catalog number: 28706);

[0059] Ligation (backbone + fragment) / transformation: The recovered fragments were ligated using Novizan C115 ligase, and the ligated DNA fragments were transformed into E. coli using Takara Stellar competent cells and cultured overnight at 37°C.

[0060] Microbial testing: Sixteen well-formed plaques were selected and PCR amplified using a 25 μL system prepared with Novizan P222Taq enzyme; plaques with the correct bands were selected and incubated in 4 mL of broth medium with gentle shaking.

[0061] Plasmid extraction from positive clones: Plasmids were extracted using the alkaline lysis method (self-prepared reagents);

[0062] Enzyme digestion identification and sequencing: Select a suitable NEB restriction enzyme, prepare a 20 μL enzyme digestion system with 600 ng plasmid, and sequence the correctly digested plasmid.

[0063] Preparation of plasmids for injection: For clones with correct sequencing results, inoculate with 22.5 mL of broth and culture overnight. Recover the plasmids using Qiagen's 27106 plasmid recovery kit for injection.

[0064] (3) gRNA synthesis

[0065] Artificially synthesized CrRNA (CRISPR RNA) sequences (IDT) and tracrRNA (trans-activating crRNA) sequences (GenScript Biotech Inc.) CrRNA will bind with tracrRNA to form gRNA sequences.

[0066] (4) Preparation of RNP complex

[0067] Tube 1 solution: Add 0.8 μL of 100 pmol / μL CrRNA to 5.2 μL of RNase-free water, then add 0.6 μL of 100 pmol / μL TracRNA, mix well and incubate for 5 min. Then add 0.2 μL of Cas9 protein (NEB, catalog number: M0646M), mix well and incubate for 10 min to obtain tube 1 solution; Tube 2 solution: Donor plasmid with a final concentration of 15 ng / μL; Mix tube 1 solution and tube 2 solution to obtain RNP complex.

[0068] (5) Preparation of fertilized eggs

[0069] Female C57BL / 6 mice aged 3-4 weeks were selected and injected with pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (HCG) at an interval of 46-48 hours. After HCG injection, the female mice were mated with adult fertile male mice to achieve fertilization. The female mice were euthanized the next day, and the fertilized eggs were collected from the oviducts and placed in a 37°C constant temperature 5% CO2 incubator for later use.

[0070] (6) Pronuclear microinjection

[0071] Prepare microinjection needles and fixation needles; dilute and mix the prepared RNP complex and plasmid DNA to form an injection solution, and then add the injection solution into the microinjection needle; screen morphologically normal fertilized eggs and place them in an injection dish, and inject the exogenous gene injection solution into the nucleus of the fertilized egg cells by microinjection under a 200-400x inverted microscope; transfer the injected fertilized eggs to M16 medium and place them in a 37℃ constant temperature 5% CO2 incubator for 0.5-1h before transplantation, or culture until 2 cells are reached and transplantation is performed the next day.

[0072] (7) Preparation of surrogate mice and embryo transfer

[0073] Selected fertile female mice of suitable age were mated with sterilized male mice that had undergone vasectomy to stimulate a series of pregnancy changes in the female mice, resulting in pseudopregnant female mice, which were then used as surrogate mice for transgenic fertilized eggs. The fertilized eggs, which had been injected with exogenous genes, were transferred into the oviducts of the surrogate female mice on the day of oviduct implantation. After the transfer, the surrogate female mice were placed in a clean cage and kept warm until they regained consciousness before being returned to their original cages. After successful oviduct transplantation, the female mice would generally give birth 19-20 days after the operation. One week after birth, the mice could be clawed and numbered, and PCR identification could be performed. Three weeks after birth, the mice could be separated into individual cages for independent rearing.

[0074] (8) Identification of newborn F0 mice

[0075] Collect tissues (tail or toe tissues) from 1-2 week old mice; lyse the tissues and extract the genome; perform PCR amplification and electrophoresis using specific primers for the target gene to screen offspring with integrated exogenous genes; mice with integration are called founder mice, which can be passaged and used to establish lines, while protein expression levels are identified.

[0076] (9) Passage and establishment of transgenic mice

[0077] Mice carrying the exogenous gene were mated with untransgenic mice and passaged. Each first-generation mouse was passaged independently. The F1 mice were identified, and the offspring of F0 mice that could be normally transmitted through the germline had a 50% chance of carrying the integrated target gene. The obtained F1 positive mice were used for experiments and continued passage (they could also be bred with Cre mice). If homozygotes were required, positive F1 mice from the same source were mated with siblings, and the resulting F2 generation mice had a 25% probability of being homozygous. Mice that expressed the target gene were selected and established for stable passage, while the passage details and pedigree were recorded.

[0078] (10) Identification of the tail of transgenic mice

[0079] Cut off the mouse tail, mince it, add lysis buffer, heat at 95℃ for 10 minutes to release DNA, then neutralize the pH with Tris-HCl, centrifuge and collect the supernatant for PCR amplification. Prepare a 20μL system per tube: 1 μL each of forward and reverse primers, 10μL of 1×Taq Mix, 1μL of template DNA, and DEPC water to a final volume of 20μL. After centrifugation, anneal and amplify for 40 cycles.

[0080] (11) ELISA enzyme-linked immunosorbent assay

[0081] Prepare the working solution. Add 100 μL of sample and standard to each well and incubate at 37°C for 90 minutes. Wash the plate 4 times with washing buffer, then remove excess liquid and add 100 μL of biotinylated antibody working solution to each well. Incubate at 37°C for 60 minutes. Wash the plate 4 times, then remove excess liquid and add 100 μL of enzyme conjugation working solution to each well. Incubate at 37°C for 30 minutes. Wash the plate 4 times, remove excess liquid, add 100 μL of chromogenic reagent to each well, and incubate in the dark at 37°C for 20 minutes. Add 100 μL of stop solution to each well and read the value at 450 nm using a microplate reader.

[0082] 1.3 Mouse Construction

[0083] (1) Construction of PDGFRa-Cre mice

[0084] The “Cre-rBGpA” expression cassette was site-directedly inserted into the N-terminus of the PDGFRa in situ gene, resulting in Cre expression only in PDGFRa-positive cells under the control of the PDGFRa promoter. Knockout of the specific sequence was achieved using the Cre-loxP system; the insert lengths were 10.28 kb (5') and 8.08 kb (3'), respectively, and the primers for the inserts were 5'-TGCCCTGGCTCACAAATACCACT-3' (SEQ ID NO.1) and 5'-TAGCCAACCTTTGTTCATGGCAGC-3' (SEQ ID NO.2). Sequencing and Southern blotting confirmed that the “Cre-rBGpA” expression cassette was site-directedly inserted into the N-terminus of the PDGFRa in situ gene (…). Figure 1 and 2 ).

[0085] To ensure the integrity of the inserted sequence, primers for F1 generation mice were designed with a large coverage area. For rigor, two pairs of primers were designed to identify positive results, covering the full length of the inserted sequence. Site-positive F1 generation mice were selected through Southern blotting, sequencing, and large-fragment primer identification. The F1 identification primer sequences are: 5'-GATGTTCCGAGCTGTGAGCAACT-3' (SEQ ID NO. 9), 5'-GACCTCTTTATAGCCAACCTTTGTTCA-3' (SEQ ID NO. 10); the F2 identification primer sequences are: 5'-CGGCATGGTGCAAGTTGAATAA-3' (SEQ ID NO. 11), 5'-TGCTGGTCATAATGTGGGTAGTC-3' (SEQ ID NO. 12). Figure 3 ).

[0086] (2) Constructing CD34-Dre mice

[0087] The "Dre-rBGpA" expression cassette was site-directedly inserted into the N-terminus of the CD34 orthotopic gene. Under the control of the CD34 promoter, this model only expresses Dre in CD34-positive cells. Knockout of a specific sequence was achieved using the Dre-rox system. The insert lengths were 8.85 kb (5') and 9.84 kb (3'), and the primers for the inserts were: 5'-TGCCCTGGCTCACAAATACCACT-3' (SEQ ID NO.3) and 5'-TAGCCAACCTTTGTTCATGGCAGC-3 (SEQ ID NO.4). Sequencing and Southern blotting confirmed that the "Dre-rBGpA" expression cassette was site-directedly inserted into the N-terminus of the CD34 orthotopic gene (…). Figure 4 and 5 ).

[0088] To ensure the integrity of the inserted sequence, primers for F1 generation mice were designed with a large coverage area. Additionally, for rigorous testing, two pairs of primers were designed to identify positive results, covering the full length of the inserted sequence. Site-positive F1 generation mice were selected through Southern blotting, sequencing, and large-fragment primer identification. The F3 identification primer sequences are 5'-TTCCTTCCCTGGTGCTGAACACT-3' (SEQ ID NO.14) and 5'-CTTTATTAGCCAGAAGTCAGATGC-3' (SEQ ID NO.15); the F4 identification primer sequences are 5'-GTACGCTCCTAACACTTTGAGGG-3' (SEQ ID NO.16) and 5'-ACACCTCCCTCCTTACCATGTAGCAG-3' (SEQ ID NO.17). Figure 6 After confirming the inserted sequence is correct, positive mice are selected by using specific primers for small fragments during subsequent breeding.

[0089] (3) Constructing CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mice

[0090] The “CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-Kozak-DTR” element was linked to the homologous arms upstream and downstream of the target site and assembled into the Donor plasmid. 3xSV40 pA was used as a transcription terminator to block the control of DTR by the CAG promoter. The loxP-3xSV40 pA-loxP and Rox-3xSV40 pA-Rox elements were formed using the gene recombination system. 3xSV40 pA was knocked out through the Cre-loxP system and the Dre-rox system. The inserted fragments and their lengths were 5'Probe-Bsu36I: 4.48kb-WT, 7.77kb-MT and 3'Probe-BstEII: 4.77kb-WT, 3.78kb-MT, respectively. The 5' probe primers for the inserted fragments were: 5'-AAACGTGGAGTAGGCAATACCCAGG-3' (SEQ ID NO. 5), 5'-AAAGAAGGGTCACCTCAGTCTCCCT-3' (SEQ ID NO. 6); the 3' probe primers were: 5'-TTCTGGGCAGGCTTAAAGGCTAAC-3' (SEQ ID NO. 7), 5'-AGGAGCGGGAGAAATGGATATGAAG-3' (SEQ ID NO. 8). Sequencing and Southern genotyping confirmed that the genotypes were correct. Figure 7 and 8 ).

[0091] To ensure the integrity of the inserted sequence, primers for F1 generation mice were designed with a large coverage area. For rigor, two pairs of positive primers were designed, covering the full length of the inserted sequence. Site-positive F1 generation mice were selected through Southern blotting, sequencing, and large-fragment primer identification. The F5 primer sequences were 5'-GCATCTGACTTCTGGCTAATAAAG-3' (SEQ ID NO.18) and 5'-ATGGGAAGTTAGTAGCAAACAAGAG-3' (SEQ ID NO.19), and the F6 primer sequences were 5'-AAAGATCGCTCTCCACGCCCTAG-3' (SEQ ID NO.20) and 5'-GATGGGGAGAGTGAAGCAGAACG-3' (SEQ ID NO.21). Figure 9 After confirming the inserted sequence is correct, positive mice are selected by using specific primers for small fragments during subsequent breeding.

[0092] (4) Construct DTR-ROSA26-KI*CD34-Dre*PDGFRa-Cre (CD34 + PDGFRa + Terocaryocytes (Trocin) mice

[0093] After successfully obtaining CAG promoter-loxP-stop-loxP-Rox-stop-Rox-DTR, PDGFRa-Cre, and CD34-Dre mice, primers for the three genes were identified through crossbreeding, and mice positive for all three genes were finally selected. DTR expression in cells co-expressing CD34 and PDGFRa genes was achieved through crossbreeding of the three mouse types. Subsequently, CD34 expression in these mice was specifically eliminated by drug administration. + PDGFRa + Localized cells. For example... Figure 10 As shown, the genotypes of mice 5 and 7 were identified. For CD34 identification primers, mouse 5 showed both positive and negative bands, indicating it was heterozygous for the CD34-Dre genotype. Mouse 7 showed only negative bands, indicating it was wild-type for the CD34-Dre genotype. For the PDGFRa and ROSA26_DTR genes, both showed both positive and negative bands. Therefore, both mice 5 and 7 were heterozygous for both PDGFRa-Cre and ROSA26_DTR genes. Mouse 5 was selected as a triple-gene positive target mouse, while mouse 7 was only a double-gene positive mouse for PDGFRa-Cre and ROSA26_DTR.

[0094] II. Establishing CD34 + PDGFRα+ A Teroblastic cell knockout acute lung injury model was used to analyze the molecular mechanisms of intercellular communication through single-cell sequencing.

[0095] 2.1 Materials

[0096] 2.1.1 Laboratory Animals

[0097] Animal experiments were conducted with the consent of the Animal Protection Committee of Zhongshan Hospital Affiliated to Fudan University. The use and handling of animals followed the "Guidelines for the Care and Use of Laboratory Animals" issued by the U.S. Department of Health. The experiments used SPF-grade male DTR-ROSA26-KI*CD34-Dre*PDGFRa-Cre C57BL / 6 mice, which were bred by the researchers and housed at the Experimental Research Center of Zhongshan Hospital Affiliated to Fudan University.

[0098] 2.2 Experimental Methods

[0099] 2.2.1 Animal Experiment Grouping and Modeling

[0100] In this experiment, animals were divided into three groups: control group, LPS group, and CD34 group. + PDGFRa + TCsCKO+LPS group.

[0101] (1) Control group (vehicle group, n=6-8): 40 μL of PBS was instilled into mice via trachea after anesthesia.

[0102] (2) LPS group (LPS group, n=6-8): 20 μL of LPS solution (5 mg / mL) was instilled into the mice via the trachea after anesthesia.

[0103] (3) CD34 + PDGFRa + TCsCKO+LPS group (CKO+LPS group, n=6-8): 20 μL LPS solution (5 mg / mL) was instilled into mice via trachea after anesthesia.

[0104] 2.2.2 Modeling Method

[0105] (1) Anesthesia and preparation before modeling: 20 minutes before modeling, mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (10 mL / kg). After the mice were completely anesthetized, they were fixed on the experimental surgical platform. Prepare one 1 mL sterile syringe, draw 0.2 mL of water, so that the water droplets form a ring in the tube wall, and remove the needle and piston.

[0106] (2) Modeling: Use tweezers to pull out the mouse's tongue, exposing the oral cavity. Under light, the mouse's glottis can be seen opening and closing with respiration. Insert the cannula needle into the glottis until the tip of the needle is level with the mouse's incisors. Be careful not to let the needle tip extend beyond the cannula to avoid scratching the mouse's oral cavity and airway. Use a pre-prepared syringe to check the intubation effect. If the water droplets in the syringe bounce up and down with respiration, the intubation is successful. Use a micropipette to draw PBS or LPS solution and inject it into the cannula. The mouse can be seen to quickly aspirate the liquid. Remove the cannula, mark each group of mice, and put them back in their cages to allow them to wake up naturally.

[0107] 2.2.3 Animal Sample Collection

[0108] (1) 24 hours after the animal model was established, the mice were anesthetized by intraperitoneal injection of 0.2 mL of 1% sodium pentobarbital and then euthanized by cervical dislocation.

[0109] (2) Collection of bronchoalveolar lavage fluid: Place the mouse in a supine position on the operating table, fix its limbs, and prepare the skin around its neck. Cut the skin of the neck layer by layer, bluntly dissect the neck muscles, taking care to avoid the thyroid gland to prevent massive bleeding from affecting the surgical field, and expose the trachea. Prepare a 1 mL syringe to draw 1 mL of PBS, and remove the needle for later use. Make a small incision near the incisors of the trachea, insert the cannula, ensuring the needle does not extend beyond the cannula, and insert it to the same depth as during modeling, avoiding insertion too deep into one bronchus. Remove the needle core, insert the syringe, slowly inject PBS and then aspirate, repeating the lavage three times. This will yield 0.6-0.8 mL of bronchoalveolar lavage fluid containing a large amount of foam. Inject the lavage fluid into a 1.5 mL EP tube, centrifuge at 1200 g for 10 minutes at 4°C, collect the supernatant, and freeze it at -80°C for subsequent protein concentration measurement.

[0110] (3) Collect mouse lung tissue: Cut the mouse skin along the right clavicle midline from the lower edge of the ribs to the right clavicle, cut the right ribs and diaphragm to expose the lungs. Cut the right lower lobe and right middle lobe, place them in 1.5 mL EP tubes, and freeze at -80℃ for subsequent RT-PCR or Western Blot detection. Soak in formalin, fix overnight at 4℃, embed in paraffin, and section for subsequent staining.

[0111] (4) Collect mouse lung tissue for single-cell sequencing, put it into 10 mL of tissue preservation solution, seal it and store it at 4°C for transport, and send it to Proton Health Technology Co., Ltd. as soon as possible for testing.

[0112] 2.2.4 Single-cell sample detection and analysis

[0113] (1) Single-cell sample detection

[0114] Different cell resuscitation methods are selected according to the customer's sample delivery method. The sample is made into a single-cell suspension. Then, cell count and cell viability are measured using CellCounter. Mobi Nova single-cell transcriptome sequencing has high requirements for cell viability. Generally, the number of viable cells should be above 85%. The cell concentration is adjusted to the ideal concentration: 1000 cells / μL.

[0115] (2) Experimental procedure

[0116] The prepared single-cell suspension, microspheres carrying tens of millions of unique molecular tags and UMIs, and reagents are combined using droplet-based microfluidic chip technology to ensure that one cell binds to one microsphere. Cell lysis and reverse transcription reactions are performed within the GEMs. During this process, the barcode in the microsphere will link with the cDNA product of the corresponding cell. The GEMs are then broken up, and cDNA from different cell sources will be mixed together. PCR amplification is then performed on this mixture, followed by quality control (amplified fragment size and amplified product yield).

[0117] After the amplified product passed quality control, sequencing library construction was performed. First, the cDNA was broken into fragments of about 200-300 bp using chemical methods. The cDNA was then fragmented, end-repaired, and an A base was added. A P7 adapter was added, and the fragments were introduced into the sample index via PCR amplification. Fragment selection was then performed to obtain the cDNA library.

[0118] After the library is completed, a library check is performed. Once the library passes the check, sequencing is performed using the HiSeq sequencing platform to obtain sequencing data for subsequent data analysis.

[0119] (3) Sequencing

[0120] Each cell is sequenced with 50,000-100,000 reads using the HiSeq PE150 sequencing strategy, yielding 15-30M of data per cell. Sequencing has a certain saturation point; appropriately increasing the amount of sequencing data can improve the gene detection rate.

[0121] (4) Bioinformatics analysis

[0122] Data quality control: The raw sequencing data contains low-quality reads, adapter contamination, and reads with excessive unknown base N content. This information may disrupt the subsequent genome re-attachment and transcript quantification process. These reads need to be removed before data analysis to ensure the reliability of the results. The quality control steps mainly include removing reads containing adapter and other primer sequences, while also considering removing reads containing low-quality bases and reads with excessive position bases (N).

[0123] Mobivision was used to perform alignment with the reference genome, demultiplexing, assessment of effective cell count, and construction of gene-barcode expression profile matrix. Meanwhile, the information collected during the above analysis was statistically analyzed and presented using clear and concise tables and graphs.

[0124] Based on the gene-barcode expression profile, the expression profile preprocessing and cluster analysis were performed using the Seurat[9]R package. The preprocessing process mainly included: deleting abnormal cells and genes, normalizing the expression profile, and handling interference factors such as batch effect. Based on Seurat[9], the gene-barcode expression profile obtained after the above preprocessing was clustered. The obtained subgroups were dimensionality reduced and graphically displayed using t-SNE. At the same time, the subgroups were analyzed for characteristic Marker Genes.

[0125] III. Results

[0126] 3.1 DTR-ROSA26-KI*CD34-Dre*PDGFRa-Cre (CD34 + PDGFRa + Identification of Terois cells in mice

[0127] CD34 was finally obtained by breeding mice No. 5. + PDGFRa + Conditional knockout mice were generated from Terois cells and identified accordingly. DNA was extracted from the mouse tails, and positive bands were determined by electrophoresis after PCR, resulting in 5 conditional gene knockout mice. Figure 11 ).

[0128] 3.2 An LPS-induced acute lung injury model was constructed by specifically removing CD34+PDGFRα+ Trident cells from the lungs of mice through drug administration.

[0129] DTR-ROSA26-KI*CD34-Dre*PDGFRa-Cre mice were treated with DT to remove CD34. + PDGFRa + Terato cells (CD34) + PDGFRa + TCsCKO), 2mg / kg LPS intranasal drops to induce CD34 + PDGFRa +Acute lung injury (CKO+LPS) was induced in TCsCKO mice, with PBS intranasal instillation serving as the control group (WT+vehicle). Acute lung injury (WT+LPS) was induced in WT mice with 2 mg / kg LPS intranasal instillation. HE staining showed inflammatory cell infiltration in the interstitial lung tissue and alveolar spaces of LPS-treated mice, along with alveolar wall widening, vascular destruction, and pulmonary hemorrhage. In the CKO group, LPS-treated lung tissue exhibited more pronounced interstitial cell infiltration, alveolar wall widening, vascular wall thickening, and alveolar fusion. Lung tissue PCR results showed that LPS significantly increased the levels of inflammatory factors interleukin-6 (IL-6) and interferon-γ (IFNγ) in mouse lung tissue (*P<0.05); IL-6 and IFNγ levels in the CKO group were not increased compared to the control group. Figure 12 LPS treatment significantly increased IL6 and IL8 levels in the bronchoalveolar lavage fluid and plasma of CKO mice, and combined with HE staining results, confirmed the successful establishment of the acute lung injury model.

[0130] Single-cell sequencing was performed on lung tissues from WT+vehicle, WT+LPS, and CKO+LPS mice. A total of 120,897 cells from 8 lung tissue samples were sequenced. Figure 13 Cells were clustered unsupervised and annotated based on manual checks of known marker gene expression (Table 1). Figure 14 The study identified three epithelial cell subsets, endothelial cell subsets, two mesenchymal cell subsets, four neutrophil subsets, three monocyte subsets, three macrophage subsets, four T cell subsets, four B cell subsets, one NK cell subset, one cDC cell subset, and one pDC cell subset.

[0131] Table 1: Gene marker combinations for annotated subgroups

[0132]

[0133] Subgroups of the same type were merged into epithelial cell subgroups, endothelial cell subgroups, and CD34 subgroups. + PDGFRa + The figure shows the dimensionality-reduced distribution of the merged subsets of Troid cells, fibroblasts, neutrophils, monocytes / macrophages, T cells, B cells, NK cells, cDC cells, and pDC cells in the WT+vehicle, WT+LPS, and CKO+LPS groups. Figure 15 A) Expression status of subgroup marker genes ( Figure 15 B) and the changes in the cell proportions of each subpopulation in the three groups ( Figure 15 C). The results showed that CD34 + PDGFRa +The proportion of interstitial cell subsets was significantly increased in the LPS-induced acute lung injury group, and in the LPS-induced CD34 subgroup. + PDGFRa + The proportion of the CKO group decreased significantly, further confirming the presence of CD34 at the gene expression level. + PDGFRa + The Teroblast cell knockout model was successfully established.

[0134] 3.3 Constructing gene maps and regulatory networks for intercellular communication among lung epithelial cell subsets in aged mice and aged mice with acute lung injury.

[0135] Cell communication analysis was performed on the acquired single-cell data using CellphoneDB, a database containing ligands, receptors, and their interactions. This allowed for a comprehensive and systematic analysis of intercellular communication molecules, enabling the study of inter-cell communication networks among different cell types. Results showed that teratocellular cells and macrophages were the dominant cell types for intercellular communication in the lung tissue of aged mice. Intercellular communication between teratocellular cells and epithelial cells, endothelial cells, monocytes, macrophages, and cDCs was more active based on the cell types and scores involved in the communication. Figure 16 A, B). Intercellular communication between teratocysts and epithelial cells, macrophages, cDCs, and monocytes is relatively active. In the lung tissue of an aged mouse ALI model, intercellular communication between teratocysts is even more active, particularly with epithelial cells, macrophages, monocytes, pDCs, and neutrophils. Figure 16 (C, D) This is consistent with the known role of activated alveolar macrophages in the development of ALI / ARDS by secreting inflammatory cytokines, chemokines, damage mediators, and anti-inflammatory factors. In the lung tissue of the CKO mouse ALI model, intercellular communication between teratocysts and epithelial cells, macrophages, endothelial cells, and cDCs is more active. Figure 16 E, F). The results highlight the important role of tropocytocyte-dominated intercellular communication in the lung tissues of aged mice and aged ALI model mice, particularly the interaction between tropocytocytes and epithelial cells or macrophages, and suggest the role of CD34. + PDGFRa + Teroblast knockout plays a key regulatory role in cell-lung tissue interactions in aged mice with ALI.

[0136] Further analysis of the receptor-ligand genome of epithelial cells interacting with other cell types revealed that aged rat lung epithelial cells provide receptors and inhibitors for inflammatory factors such as IL-6 and IL-1β released from macrophages, monocytes, cDCs, and pDCs, suggesting the inflammatory regulatory function of epithelial cells. Notably, epithelial cells provide WNT4 signals to NAT cells while simultaneously receiving signals such as WNT5A and VEGFA from NAT cells. The ALI model significantly impacts WNT signaling communication between epithelial cells and NAT cells; however, after NAT cell ablation, the WNT4 signaling from epithelial cells to NAT cells was restored, and the corresponding receptor on NAT cells increased (FZD8). Figure 17 GI), suggesting that ALI lung tissue epithelial cells may require the support of teratocellular cells.

[0137] Analysis showed that teratocellular carcinoma cells (TCCs) may receive VEGFa signals from epithelial cells via the EPHB2 receptor. TCCs also receive TGFB1 and FGF1 signals from epithelial cells and release IL6, GRN, and COPN signals to activate IL6 receptors and EGFR, potentially regulating epithelial cell inflammation and proliferation through this mechanism. The results also suggest that aged mouse lung epithelial cells may exert chemotaxis towards TCCs through CCR2-CCL11 and CCR1-CCL8. The significant enhancement of CCR1-CCL7 in the ALI model indicates chemotaxis of lung epithelial cells towards TCCs during acute inflammation; this signal was significantly weakened in the TCC knockout group. Figure 17 The above results provide a basis for a deeper understanding of the chemotactic mechanism of exogenous teratoblastic cells in damaged lung tissue and for further exploration of the function of teratoblastic cells.

[0138] 3.4 Cellphone DB analysis of the regulatory effect of Terois cells on lung tissue cells

[0139] The results showed that Terois cells primarily provide cell renewal signals such as WNT5A to various cell types, including epithelial and endothelial cells; cell proliferation signals such as VEGFRα, IGF1, FGF2 / 7, and FGF10; inflammatory regulatory signals such as TNFSF9, TGFB1 / 2 / 3, and IL15; adhesion molecule signals such as PECAM1 and ICAM1; intercellular linker F11R; apoptosis signals such as FAS and FAM3C; and chemokine signals such as CXCL12 and CXCL10. The VEGFRα signal provided by Terois cells was specifically received by endothelial cells, while the VEGFRα signal had a broader effect, being received by epithelial cells, endothelial cells, macrophages, and monocytes. The TGFB3 signal provided by Terois cells binds to different receptors in various cell types, suggesting that it may have a not entirely consistent regulatory effect on different cell types. Trogue cells receive inflammatory regulatory signals, such as IL-6 signals from Trogue cells, cDCs, macrophages, and monocytes via IL-6 receptors; regulation of their own FGF7 signals via FGFR1; activation of their own EGFR receptors by receiving signals from MIF and GRN; and reception of multiple chemokine signals from macrophages, monocytes, neutrophils, and pDCs via CCR1 / 2, such as CCL11 / 15 / 18 / 23. They also receive differentiation signals from epithelial and endothelial cells, such as BMP4 / 5 / 6. The Notch or SPP1 signaling pathways shown in the results may be involved in the regulation of cell renewal, proliferation, differentiation, inflammation, and chemotaxis. Figure 18 A).

[0140] LPS stimulation of senescent lung tissue increased the release of IL-6 from teratocellular and epithelial cells, enhancing its effect on IL-6 receptors on teratocellular cells. LPS stimulation reduced the intensity of WNT5A signaling but increased the number of target cells. Simultaneously, TIMP1-FGFR2 showed significant activation. Tissue metalloproteinase inhibitors (TIMPs) regulate the physiological degradation and remodeling of the extracellular matrix by forming a dynamic equilibrium with matrix metalloproteinases (MMPs). Their family members (such as TIMP-1) specifically inhibit the activity of enzymes such as MMP-2 / MMP-9 through covalent bonding, playing a crucial role in maintaining fetal membrane stability during pregnancy, regulating tumor invasion and metastasis, and airway remodeling. The widespread activation of EGFR receptors on teratocellular cells suggests enhanced cell proliferation and other functions in LPS-induced senescent lung tissue, which is related to the enhanced proliferation of teratocellular cells under inflammatory stimulation in previous studies, indicating that teratocellular cells have strong resistance to external environmental stimuli. The activation of adhesion molecule ICAM1 signaling was more widespread, while the activation of chemokine CCR1 signaling was more likely to be triggered by CCL family molecules from immune cells such as macrophages. However, its reception of BMP signals is significantly narrowed, with BMP signals from endothelial cells and epithelial cells disappearing, and only BMP signals provided by Teroi cells to themselves remaining. Figure 18 B).

[0141] In summary, LPS stimulation of aging lung tissue leads to the release of IL-6 from teratocellular and epithelial cells, triggering tissue inflammation and activating macrophages. Macrophages, in turn, activate teratocellular CCR1 by releasing CCL23 and CCL15, chemotactically attracting teratocellular cells to migrate to damaged lung tissue. Simultaneously, various cell types in lung tissue enhance EGFR activation in teratocellular cells through enhanced MIF, GRN, and COPA signaling, promoting their proliferation and motility, resulting in a rapid increase in the number of teratocellular cells in damaged lung tissue. Teratocellular cells promote the renewal of various lung tissue cells through WNT5A signaling, promote endothelial cell proliferation and angiogenesis through VEGFA and VEGFD signaling, and regulate extracellular matrix degradation and tissue remodeling by activating TIMP1-FGFR2.

[0142] Feeding DTR knockout CD34 + PDGFRa +The most significant change after teratocystoblastic cell (TCC) intervention was the disappearance of WNT5A signaling in TCC cells. Endothelial and epithelial cells activated the EPHB4-EFNB1 / EFNA5 signal targeting TCC cell proliferation. Epithelial cells increased BMP5 signaling acting on TCC cells. Additionally, cDC-TCC CXCL12-CXCR4 and B cell-mediated CXCL13-CXCR5 signals were enhanced. The annexin A1 (ANXA1)-formyl peptide receptor 1 (FPR1) signaling axis was widely enhanced in TCC cells and multiple cell lines including endothelial cells, epithelial cells, monocytes / macrophages, neutrophils, and T cells. This signal, acting as a negative feedback pathway between myeloid and lymphocytes, can inhibit inflammation. Figure 18 (C) Therefore, a certain number of Terois cells are required to provide WNT5A signaling normally. The activation of signaling pathways promoting chemotaxis, proliferation, and differentiation after knocking out Terois cells indicates their importance in the inflamed lung tissue of aging mice.

[0143] 3.5 Terois cells provide support for type II alveolar epithelial cell subsets

[0144] First, epithelial cells were further clustered, and subpopulations were annotated and merged based on manual checks of known marker gene expression (Table 2), resulting in 7 epithelial cell subpopulations (AT1, AT2, Ciliated, Club, DifBasal, IfnEpi, NEC) and gene expression profiles for each subpopulation. Figure 19 A and B). Gene enrichment analysis (GSEA) was performed to obtain the main functions of 7 subgroups (A and B). Figure 19 C). Transcription factor expression analysis was performed on lung epithelial cell subsets in aged mice, an LPS-induced acute lung injury model in aged mice, and an LPS-induced model group in aged mice after Terois cell ablation. The results showed that Terois cell ablation had different regulatory effects on the proliferation and differentiation of epithelial cell subsets. LPS-induced expression of Pa2g4, the gene encoding the AT2 proliferation-associated protein, increased, with further increases in the Terois cell ablation group. MAX dimerization protein 1 (Mxd1), a nuclear transcription factor / transcriptional co-repressor involved in regulating transcription, development, and cell proliferation, showed increased expression in AT2 cells in the LPS group and slightly decreased expression in the Terois cell ablation group. Glycosylated lysosomal membrane protein (Glmp), a member of the nuclear receptor subfamily 1H (NR1H3) gene, showed decreased expression in the LPS group and increased expression in the Terois cell ablation ALI group. This gene encodes a protein belonging to the NR1 subfamily of the nuclear receptor superfamily. Members of the NR1 family are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The CerbB-2 gene is a proto-oncogene, and its gene expression product is a glycoprotein with tyrosine kinase activity. This suggests the complexity of AT2 function regulation in Ternopil cells. Figure 19D). GO analysis of AT2 highlights its role in fatty acid biometabolism, lung development, and kidney development, and reveals its activity in regulating cell adhesion. Figure 19 E). CellphoneDB analysis showed that both AT2 and TCs in senescent lung tissue exhibited abundant intercellular communication (E). Figure 20 In the FK and LPS-induced group, communication between AT2 cells and differentiated stromal cells (DifBasal) was weakened, while communication with inflammatory fibroblast subset 3 (Ifnfibro3) was enhanced. In the Ternet cell ablation group, the weakened intercellular communication between AT2 cells and stromal cells was reversed, indicating that Ternet cells not only regulate downstream cell function through intercellular communication but also regulate intercellular communication between downstream cells and other cells. In the LPS group, Ternet cells showed enhanced intercellular communication with AT2, which was significantly weakened in the Ternet cell ablation group. Ligand receptor analysis showed that ASM, bronchial epithelial cells, inflammatory fibroblasts, and Ternet darts can provide WNT signaling, but Ternet cells are the sole source of WNT5A signaling in AT2 cells. Figure 21 L).

[0145] Table 2: Annotation and subpopulation merging based on manual checks of known marker gene expression

[0146]

[0147] 3.6 CD34 + PDGFRa + Construction of a conditional knockout mouse model of Troloblast cells

[0148] The "Cre-rBGpA" expression cassette was inserted site-specifically into the N-terminus of the PDGFRa orthotopic gene. Under the control of the PDGFRa promoter, this model only expresses Cre in PDGFRa-positive cells. This allows for the knockout of a specific sequence through the Cre-loxP system. Similarly, the "Dre-rBGpA" expression cassette was inserted site-specifically into the N-terminus of the CD34 orthotopic gene. Under the control of the CD34 promoter, this model only expresses Dre in CD34-positive cells. This allows for the knockout of a specific sequence through the Dre-rox system. After successfully obtaining CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR, PDGFRa-Cre, and CD34-Dre mice, crossbreeding was conducted, and primers for each gene were identified. Finally, mice positive for all three genes were selected. Crossbreeding these three mouse types enabled the expression of DTR (diphtheria toxin receptor) in cells co-expressing both the CD34 and PDGFRa genes, thus constructing a CD34-positive mouse model. + PDGFRa +Conditional knockout model mice of diphtheria toxin (DT) were developed. Diphtheria toxin (DT) is a bacterial exotoxin produced by Corynebacterium diphtheriae, causing severe poisoning. Diphtheria toxin A (DTA) induces apoptosis by inhibiting EF-2 synthesis. Cells expressing the simian diphtheria toxin receptor (DTR) are sensitive to diphtheria toxin (DT), inducing cell death in target cells expressing DTR. Model mice were raised to 18-22 weeks of age (aged mice) and treated with DT (diphtheria toxin) in CD34-Dre*PDGFRα-Cre*ROSA26DTR mice. Mice with PDGFRα and CD34-positive terotropic cells were specifically ablated. An acute lung injury model of CD34PDGFRα terotropic cell knockout aged mice was established by intratracheal administration of LPS.

[0149] The above are merely preferred embodiments of the present invention and are not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for constructing a double-gene tagged cell conditional knockout mouse model, characterized in that, Comprising the following steps: (1) Constructing the PDGFRa-Cre mouse: a "Cre-rBGpA" expression frame is inserted into the N-terminal of the PDGFRa in situ gene, and Cre is expressed in PDGFRa positive cells under the control of the PDGFRa promoter, and the target sequence is knocked out through the Cre-loxP system, and the F1 generation PDGFRa-Cre mouse is obtained; wherein the process of the Cre-loxP system includes: designing and synthesizing gRNA with the sequence shown in SEQ ID NO: 13, and constructing a Donor plasmid, mixing the gRNA and the Donor plasmid to obtain an RNP complex; the RNP complex and the plasmid DNA are microinjected into the fertilized eggs of the mouse together, the fertilized eggs are cultured, embryo transfer is performed, subculture is carried out, and identification is carried out, and the F1 generation PDGFRa-Cre mouse is obtained; The lengths of the inserted fragments are 10.28 kb (5') and 8.08 kb (3'), respectively, and the sequences of the inserted fragment primers are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; (2) Constructing the CD34-Dre mouse: a "Dre-rBGpA" expression frame is inserted into the N-terminal of the CD34 in situ gene, and Dre is expressed in CD34 positive cells under the control of the CD34 promoter, and the target sequence is knocked out through the Dre-rox system, and the F1 generation CD34-Dre mouse is obtained; wherein the lengths of the inserted fragments are 8.85 kb (5') and 9.84 kb (3'), respectively, and the sequences of the inserted fragment primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively; (3) Constructing CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mice; connecting CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-Kozak-DTR elements with the homologous arms on the upstream and downstream of the target site to assemble into a Donor plasmid, using 3xSV40 pA as a transcription terminator to block the control of CAG promoter on DTR, and using a genetic recombination system to form loxP-3xSV40 pA-loxP and Rox-3xSV40 pA-Rox elements, realizing the knockout of 3xSV40 pA through a Cre-loxP system and a Dre-rox system, and obtaining F1 generation CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mice; wherein, the length of the inserted fragment is 5' Probe-Bsu36I: 4.48 kb-WT and 7.77 kb-MT and 3' Probe-BstEII: 4.77 kb-WT and 3.78 kb-MT, respectively, and the sequence of the inserted fragment 5' probe primer is shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively; the sequence of the 3' probe primer is shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively; (4) Construct CD34 + PDGFRa + Thrombocyte mice: F2 generation mice are obtained by mating F1 generation PDGFRa-Cre mice, F1 generation CD34-Dre mice and F1 generation CAGpromoter-loxP-stop-loxP-Rox-stop-Rox-DTR mice obtained in steps (1) to (3) with each other, and a three-gene positive mouse, i.e., a mouse expressing DTR in cells co-expressing CD34 gene and PDGFRa gene, is screened, and thus the thrombocyte mouse is obtained.

2. The method of claim 1, wherein the double conditional knockout mouse model is constructed by crossing a first mouse model comprising a first genetic marker with a second mouse model comprising a second genetic marker. In step (1), the sequence of the primer F1 is shown in SEQ ID NO. 9 and SEQ ID NO. 10, respectively, and the sequence of the primer F2 is shown in SEQ ID NO. 11 and SEQ ID NO. 12, respectively.

3. The method of claim 1, wherein the double conditional knockout mouse model is constructed by crossing a first mouse model comprising a first genetic marker with a second mouse model comprising a second genetic marker. In step (1), the Donor plasmid is constructed by fragment amplification, gel recovery, connection of the skeleton and the fragment or transformation, bacterial detection, extraction of the positive clone plasmid, enzyme digestion identification and sequencing in sequence, and the process includes: using P515 high-fidelity enzyme to prepare a 50 μL system for PCR amplification, 30 cycles; performing electrophoresis on the PCR product, and recovering the gel at the position of the target product; using C115 ligase to connect the recovered fragment, and using Stellar competent cells to transform the connected DNA fragment into E. coli, and culturing at 37°C overnight; picking the bacterial plaque with good morphology, and using P222 Taq enzyme to prepare a 25 μL system for PCR amplification; picking the bacterial plaque with the correct band, and inoculating into broth culture medium for small-scale shaking culture; extracting the plasmid by alkaline lysis; selecting the endonuclease of NEB, and preparing a 20 μL enzyme digestion system with the plasmid for enzyme digestion; sequencing the plasmid digested correctly; cloning the plasmid with correct sequencing results, inoculating into broth culture medium for overnight culture, and recovering the plasmid.

4. The method of claim 1, wherein the double conditional knockout mouse model is constructed by crossing a first mouse strain comprising a first genetic marker with a second mouse strain comprising a second genetic marker. In step (1), the process for preparing the RNP complex comprises: adding 0.8 μL of 100 pmol / μL CrRNA into 5.2 μL of RNase-free water, then adding 0.6 μL of 100 pmol / μL TracRNA, mixing and incubating for 5 min, then adding 0.2 μL of Cas9 protein, mixing and incubating for 10 min to obtain tube 1 solution; using the donor plasmid with a final concentration of 15 ng / μL as tube 2 solution; mixing the tube 1 solution and the tube 2 solution to obtain the RNP complex.

5. The method of claim 1, wherein the double conditional knockout mouse model is constructed by crossing a first mouse strain comprising a first genetic marker with a second mouse strain comprising a second genetic marker. In step (2), the sequence of the identification primer F3 is shown in SEQ ID NO. 14 and SEQ ID NO. 15, respectively, and the sequence of the identification primer F4 is shown in SEQ ID NO. 16 and SEQ ID NO. 17, respectively.

6. The method of claim 1, wherein the double conditional knockout mouse model is constructed by crossing a first mouse strain comprising a first genetic marker with a second mouse strain comprising a second genetic marker. In step (3), the sequence of the identification primer F5 is shown in SEQ ID NO. 18 and SEQ ID NO. 19, respectively, and the sequence of the identification primer F6 is shown in SEQ ID NO. 20 and SEQ ID NO. 21, respectively.

7. A double gene tagged cell conditional knockout mouse model, characterized in that, The double-gene labeled cell conditional knockout mouse model is constructed by the method of any one of claims 1 to 6.

8. The dual-gene tagged cell conditional knockout mouse model of claim 7, wherein, The double-gene labeled cell conditional knockout mouse model is CD34-Dre*PDGFRα-Cre*ROSA26DTR mouse.

9. The double-gene labeled cell conditional knockout mouse model of claim 7 or 8 is used for constructing an animal model related to acute lung injury disease.

Images