Sweet potato excellent genotype dose effect detection technology and application

Abstract

The invention discloses a sweet potato excellent genotype dose effect detection technology and application, and belongs to the technical field of plant genetic engineering. Whole genome association analysis, haplotype analysis and a Hi-TOM deep sequencing technology are integrated, the relationship between the genotype and dose effect of functional genes in hexaploid sweet potatoes and the functional genes is excavated, excellent haplotypes of sweet potato root rot associated genes IbCHYR1 and soft rot associated genes IbERF114 and IbNF-YA3 are obtained, and the gene dosage of the excellent haplotypes is measured, so that the gene dosage of the sweet potato root rot associated genes IbCHYR1 and the soft rot associated genes IbERF114 and IbNF-YA3 is determined, and the content of the sweet potato root rot associated genes IbCHYR1 and the soft rot associated genes IbNF-YA3 is determined. Whether the gene has the function of resisting sweet potato root rot or soft rot or not can be determined, and an important theoretical basis and a practical tool are provided for genetic breeding of sweet potatoes.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to a detection technology for dosage effect of excellent genotypes of sweet potato and application. BACKGROUND

[0002] Sweet potato has high yield and can adapt to various environments, and can be used as important food, feed, industrial raw material and new energy. Sweet potato is an excellent source of nutrients, contains a large amount of starch, vitamins, potassium, iron, calcium, minerals and carotenoids, has medicinal value due to its anticancer, antidiabetic and anti-inflammatory activities, and is deeply loved by people.

[0003] The genome of hexaploid sweet potato is complex, and the genetic background is complex, so it is difficult to directly determine the advantage genotype of functional genes by traditional whole genome association analysis method, the relationship between genotype and gene function is not clear, which provides great challenge for modern genetic engineering breeding of sweet potato. Therefore, it is of great significance to mine excellent genotypes of sweet potato for modern breeding of sweet potato and cultivation of new varieties of sweet potato. SUMMARY

[0004] The present application aims to provide a detection technology for dosage effect of excellent genotypes of sweet potato and application to solve the problems in the prior art. The present application integrates whole genome association analysis, haplotype analysis and Hi-TOM deep sequencing technology, mines excellent haplotypes of the root rot associated gene IbCHYR1 of sweet potato and the soft rot associated genes IbERF114 and IbNF-YA3, determines the gene dosage of the excellent haplotype, and determines whether the sweet potato has the functions of root rot or soft rot, thereby providing an important theoretical basis and practical tool for genetic breeding of sweet potato.

[0005] To achieve the above-mentioned purpose, the present application provides the following scheme:

[0006] The present application provides a detection method for dosage effect of excellent genotypes of sweet potato, comprising the following steps:

[0007] The haplotype genes related to the target traits of sweet potato are screened by using whole genome association analysis and haplotype analysis, and the polymorphic sites significantly related to the target traits are determined;

[0008] The genomic DNA of the sweet potato to be tested is extracted, primers are designed for the genes related to the target traits of sweet potato, PCR amplification is performed, the amplification product is subjected to Hi-TOM deep sequencing, the number of reads of each haplotype is analyzed through the sequencing result, the proportion of the number of reads of different haplotypes in the total number of reads is calculated, and the number of chromosomes represents the gene dosage of different haplotypes.

[0009] Preferably, the target traits of sweet potato include root rot and soft rot.

[0010] Preferably, the correspondence between the chromosome and the gene dosage is that when the proportion of the reads number of one haplotype in the total reads number is 1%-17%, the corresponding chromosome number is 1;

[0011] When the proportion of the reads number of one haplotype in the total reads number is 18%-33%, the corresponding chromosome number is 2;

[0012] When the proportion of the reads number of one haplotype in the total reads number is 35%-50%, the corresponding chromosome number is 3;

[0013] When the proportion of the reads number of one haplotype in the total reads number is 51%-67%, the corresponding chromosome number is 4;

[0014] When the proportion of the reads number of one haplotype in the total reads number is 68%-83%, the corresponding chromosome number is 5;

[0015] When the proportion of the reads number of one haplotype in the total reads number is 84%-100%, the corresponding chromosome number is 6.

[0016] The application further provides a molecular marker related to the disease resistance of sweet potato obtained by the method, and the disease of the sweet potato includes sweet potato root rot and soft rot, the molecular marker related to the sweet potato root rot resistance includes an IbCHYR1 gene molecular marker, the IbCHYR1 gene molecular marker includes a molecular marker I with a nucleotide sequence as shown in SEQ ID NO. 1 and a molecular marker II with a nucleotide sequence as shown in SEQ ID NO. 2.

[0017] The molecular marker related to the sweet potato soft rot resistance includes an IbERF114 gene molecular marker or an IbNF-YA3 gene molecular marker, the IbERF114 gene molecular marker includes a molecular marker III with a nucleotide sequence as shown in SEQ ID NO. 3 and a molecular marker IV with a nucleotide sequence as shown in SEQ ID NO. 4, and the IbNF-YA11 gene molecular marker includes a molecular marker V with a nucleotide sequence as shown in SEQ ID NO. 5 and a molecular marker VI with a nucleotide sequence as shown in SEQ ID NO. 6.

[0018] The application further provides application of a reagent for detecting the IbCHYR1 gene molecular marker in any one of the following aspects:

[0019] (1) application in the identification of sweet potato root rot resistance;

[0020] (2) application in the breeding of the sweet potato with resistance to the root rot;

[0021] (3) application in the screening of the sweet potato variety with resistance to the root rot.

[0022] The application further provides a method for identifying the resistance of the sweet potato to the root rot, comprising the following steps:

[0023] The genomic DNA of the sweet potato to be tested is used as a template, the IbCHYR1 gene molecular marker is amplified by using a primer pair, the amplified product is sequenced, the proportion of the reads of the molecular marker I and the molecular marker II of different haplotypes in the total reads is calculated according to the sequencing result, the proportion of the reads of the molecular marker of different haplotypes is represented by the number of chromosomes, the gene dosage of the molecular marker of different haplotypes is further determined, and whether the sweet potato to be tested has the resistance to the root rot of the sweet potato is determined according to the gene dosage.

[0024] Preferably, if the molecular marker I and the molecular marker II exist simultaneously, and the gene dosage of the molecular marker II is greater than or equal to 1, it indicates that the sweet potato to be tested has the resistance to the root rot of the sweet potato, and the resistance is enhanced with the increase of the gene dosage.

[0025] The gene dosage is an integer of 0≤n≤6.

[0026] The application further provides application of the reagent for detecting the IbERF114 gene molecular marker or the IbNF-YA3 gene molecular marker in any one of the following aspects:

[0027] (1) application in the identification of the resistance of the sweet potato to the soft rot;

[0028] (2) application in the breeding of the sweet potato with resistance to the soft rot;

[0029] (3) application in the screening of the sweet potato variety with resistance to the soft rot.

[0030] The application further provides a method for identifying the resistance of the sweet potato to the soft rot, comprising the following steps:

[0031] The genomic DNA of the sweet potato to be tested is used as a template, the IbERF114 gene molecular marker or the IbNF-YA3 gene molecular marker is amplified by using a primer pair, the amplified product is sequenced, the proportion of the reads of the molecular marker III and the molecular marker IV of different haplotypes in the total reads, or the proportion of the reads of the molecular marker V and the molecular marker VI in the total reads is calculated according to the sequencing result, the proportion of the reads of the molecular marker of different haplotypes is represented by the number of chromosomes, the gene dosage of the molecular marker of different haplotypes is further determined, and whether the sweet potato to be tested is the variety with resistance to the soft rot of the sweet potato is determined according to the gene dosage.

[0032] Preferably, if the molecular marker III and the molecular marker IV exist simultaneously, and the gene dosage of the molecular marker III is >=1, it indicates that the sweet potato to be tested has sweet potato soft rot disease resistance, and the resistance increases with the increase of the gene dosage;

[0033] If the molecular marker V and the molecular marker VI exist simultaneously, and the gene dosage of the molecular marker V is >=1, it indicates that the sweet potato to be tested has sweet potato soft rot disease resistance, and the resistance increases with the increase of the gene dosage;

[0034] Wherein, the gene dosage is an integer of 0<=n<=6.

[0035] The present application discloses the following technical effects:

[0036] The present application determines the interval associated with sweet potato root rot and soft rot through whole genome association analysis, analyzes the promoter haplotype of IbCHYR1, IbERF114 and IbNF-YA3 genes, further determines the gene dosage of IbCHYR1 in different root rot resistance varieties by using Hi-TOM deep sequencing technology, and systematically explores the relationship between IbCHYR1, IbERF114 and IbNF-YA3 genotypes, dosage effect and gene function in hexaploid sweet potato, so as to provide more gene resources for modern sweet potato breeding. It is verified by experiments that IbCHYR1, IbERF114 and IbNF-YA3 have specific advantage haplotypes in root rot and soft rot resistance, and have very high breeding value. BRIEF DESCRIPTION OF DRAWINGS

[0037] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0038] Figure 1 To mine excellent haplotypes for whole genome association analysis, haplotype analysis and Hi-TOM deep sequencing analysis; A: Manhattan plot of whole genome association analysis of sweet potato root rot resistance in 157 sweet potato germplasms; B: SNP analysis of IbCHYR1 promoter region; C: Root rot incidence rate of different resistant and susceptible varieties and dosage effect of IbCHYR1;

[0039] Figure 2 For SNP analysis of IbERF114 promoter region and dosage effect of IbERF114 in different resistant and susceptible varieties;

[0040] Figure 3SNP analysis of IbNF-YA3 promoter region and dosage effect of IbNF-YA3 in different resistant varieties. DETAILED DESCRIPTION

[0041] Various exemplary embodiments of the present application will now be described in detail, with reference to the drawings. The detailed description is not to be considered limiting of the present application, as further aspects will become apparent to those skilled in the art upon reading the detailed description, examples, and claims.

[0042] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter is also specifically included within the scope of the present application. The intervening values of the parameter are combined with a stated value of the parameter in range form. These are only examples of the various values of the parameter, which are combined with a stated value of the parameter to form a range of values. Other combinations of the parameter, not specifically recited, are also contemplated as being within the scope of the present application. These are only examples of the various values of the parameter, which are combined with a stated value of the parameter to form a range of values. Other combinations of the parameter, not specifically recited, are also contemplated as being within the scope of the present application.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in the specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application. All documents mentioned herein are incorporated by reference.

[0044] Many modifications and variations of this application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. The disclosure of the present application is by way of example and not intended to be limiting of the scope of the application. The description herein of any advantages and aspects of the application is in no way intended to limit or define the scope of the application. Other embodiments can be apparent to those skilled in the art from consideration of the specification and can be practiced without departing from the spirit or scope of the application. For example, although this application has been described with reference to particular means, materials, and embodiments, any means mentioned herein are intended to be examples of equivalent means for performing the functions described in connection with the embodiments presented. The specification and drawings should be considered in an illustrative, rather than a restrictive, sense.

[0045] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0046] The sweet potato varieties XuShu 18, ShangShu 19, ZhanZiShu 2, Ji 10270, XinXiang, PuShu 32, SuShu 4, HongYao, QuanShu 830, DanYanHong, NongDa 16, NongDaBai, NongDa 602, XuShu 37, LongShu 9, YanShu 25 used in the present application were provided by the Key Laboratory of Sweet Potato Biology and Biotechnology, Ministry of Agriculture and Rural Affairs, China Agricultural University.

[0047] Example 1

[0048] I. Screening of IbCHYR1 gene associated with root rot, haplotype and gene dosage analysis thereof

[0049] 1. Genome-wide association study (GWAS) and haplotype analysis

[0050] The VCF file containing 4,599,509 SNPs of 314 Ipomoea batatas natural population germplasm resources was downloaded from the zendo database (https: / / zenodo.org / records / 7184909). These SNPs were filtered based on the Hardy-Weinberg equilibrium using PLINK (v1.90b6.21; P<1.0x10 -6 ). GWAS analysis of 1,716,948 filtered SNPs was performed by mixed linear model using GAPIT. The linkage disequilibrium (LD) region was defined as a set of SNPs associated with significant sites, with a correlation coefficient (R 2 ) > 0.2, and the physical distance size of this region was determined using PLINK. The pair-wise LD map was drawn using LDBlockShow v1.40. The haplotype between each germplasm was extracted and filtered using R scripts. The violin plot was drawn based on the genotype and the corresponding phenotype data using R scripts. The Student't test was used to compare the significance of the difference in root rot phenotype between different haplotypes.

[0051] The results are shown in A and B of Figure 1 , two SNP sites associated with root rot (Iba_chr13a_11097067 and Iba_chr14a_31763570) were screened. According to the gene annotation of the LD region thereof, a root rot susceptible gene IbCHYR1 with two haplotypes associated with root rot in the promoter region was screened. The statistical results show that when the promoter region of IbCHYR1 is (A / A, A / A), the sweet potato shows root rot susceptibility. When the region is (A / T, A / G), the sweet potato shows root rot resistance.

[0052] The gene associated with soft rot was screened, and according to the gene annotation of the LD region thereof, a soft rot susceptible gene IbERF114 with two haplotypes associated with soft rot in the promoter region was screened. The statistical results show that when the promoter region of IbERF114 is (TCTAACAA, G) (the positions of the two sites are shown in the corresponding positions of the sequences shown in SEQ ID NO. 3-4), the sweet potato shows soft rot susceptibility. When the region is (-, T), the sweet potato shows soft rot resistance. "-" represents the absence of "TCTAACAA".

[0053] Genes associated with soft rot were screened, and based on gene annotations of their LD regions, a soft rot-susceptible gene, IbNF-YA3, with two haplotypes associated with soft rot at its promoter was identified. Statistical results showed that sweet potato exhibited susceptibility to soft rot when the IbNF-YA3 promoter region was (TAT, T) (the two-position locations are detailed in the corresponding positions of the sequences shown in SEQ ID NO. 5-6). When the region was (-, A), sweet potato exhibited resistance to soft rot. "-" indicates the deletion of "TAT".

[0054] 2. Hi-TOM deep sequencing

[0055] 2.1 Extraction of sweet potato genomic DNA

[0056] Take 1g of young leaves from different root rot and soft rot resistant sweet potato varieties [Xushu 18 (X18), Shangshu 19 (S19), Zhanzishu 2 (ZZS2), Ji 10270 (J1), Xinxiang (XX), Pushu 32 (P32), Sushu 4 (SS4), Hongyao (HY), Quanshu 830 (QS830), Danyanhong (DZH), Yanshu 5 (YS5), Nongda 16 (Nongda16), Nongdabai (Nongdabai), Nongda 602 (Nongda602), Xushu 37 (Xushu37), Longshu 9 (Longshu9), Yanshu 25 (Yanshu25)], grind them into powder in liquid nitrogen, add them to 2 mL centrifuge tubes, and extract total RNA from sweet potatoes using the CTAB method.

[0057] 2.2 PCR amplification

[0058] The first round of PCR amplification of the genomic fragment was performed using specific primers with a universal sequence added to the 5' end. The substrate concentration was 200 ng / μL, and the amplification cycle was controlled at 30 cycles. The primer sequences are shown below:

[0059] IbCHYR1-SNP-F: 5′-GAGTTGGATGCTGGATGGTGGACACTGGCCTCTTATATATAC -3′ (SEQID NO.7);

[0060] IbCHYR1-SNP-R: 5′-GGAGTGAGTACGGTGTGCCCCCACTTCTCGCCTTATC-3′ (SEQ ID NO. 8).

[0061] IbERF114-SNP-F: 5′-GGAGTGAGTACGGTGTGCAGCGTGATCTTAGCTCCTG-3′ (SEQ IDNO.9);

[0062] IbERF114-SNP-R: 5'-GAGTTGGATGCTGGATGG TGAGATCGAGACAACCTTTGAC-3' (SEQ ID NO. 10).

[0063] IbNF-YA3-SNP-F: 5'-GGAGTGAGTACGGTGTGCAGATACCCTGCGATCAAAGTC-3' (SEQ ID NO. 11);

[0064] IbNF-YA3-SNP-R: 5'-GAGTTGGATGCTGGATGG AGTCAAACAACAAATCCAGGCAC-3' (SEQ ID NO. 12).

[0065] Amplification reaction system: 2 x Exp Taq Master Mix Ver.2 (dye plus) 25 μL, upstream primer 1 μL, downstream primer 1 μL, template 2 μL, ddH2O supplemented to 50 μL.

[0066] The reaction program is: 94°C for 1 min; 94°C for 10 s, 56°C for 30 s, 72°C for 2 min, 32 cycles; 72°C for 5 min; 4°C storage.

[0067] 2.3 Dose effect determination

[0068] The PCR product was sent to Hangzhou Hi-TOM platform for sequencing, with 5000 reads, 1% filter threshold, illumina platform sequencing, and finally analyzed on the Hi-TOM platform (http: / / www.hi-tom.net / hi-tom / ).

[0069] The sequencing results provide reads with different haplotypes, and the number of reads of each haplotype is counted. The proportion of the number of reads of different haplotypes in the total number of reads is calculated, and the number of chromosomes represents the gene dose of different haplotypes, i.e. 1-17% for 1, 18-33% for 2, 35-50% for 3, 51-67% for 4, 68%-83% for 5, and 84-100% for 6 (C, Figure 1 in, Figures 2-3 ).

[0070] 2.4 Verification of gene dose and phenotype

[0071] The corresponding haplotypes were amplified as follows:

[0072] >IbCHYR1 Hap1 (SEQ ID NO. 1):

[0073] TGGACACTGGCCTCTTATATATACGCCCATTTATTATCTCAACCCCCTTCTCAGGCCCTCGGCACCACCAAAATTGGAAATTATTAAAT A ATTTGACCATAGTTAATGTTACTATATATGGAAACTCCATTGGTAGATCCAG A TGGGAGAGAGGATAAGGCGAGAAGTGGGG.

[0074] > IbCHYR1 Hap2 (SEQ ID NO. 2):

[0075] TGGACACTGGCCTCTTATATATACGCCCATTTATTATCTCAACCCCCTTCTCAGGCCCTCGGCACCACCAAAATTGGAAATTATTAAAT T ATTTGACCATAGTTAATGTTACTATATATGGAAACTCCATTGGTAGATCCAG G TGGGAGAGAGGATAAGGCGAGAAGTGGGG.

[0076] > IbERF114 Hap1 (SEQ ID NO. 3):

[0077] AGCGTGATCTTAGCTCCTGCTTTTGCCCTTTTTCATTTTCCCCTTAAGATAAAACCTCTCACTCTATATATCAACTCCTTACAACCTTAAAGGACAAAGAGGCCAAAGAAACCCAAACCC TCTAACAA AACAAAACAAAAC G CTTTGTTTTTCGATCTTCGATCTCTCCGTTTCTTCGATTTTATGTTGTTTTTATGTTCTTAGCTCTCCCCAATACGTAGTCAAAGGTTGTCTCGATCTCA.

[0078] > IbERF114 Hap2 (SEQ ID NO. 4):

[0079] AGCGTGATCTTAGCTCCTGCTTTTGCCCTTTTTCATTTTCCCCTTAAGATAAAACCTCTCACTCTATATATCAACTCCTTACAACCTTAAAGGACAAAGAGGCAGAAGAAACCCAAACCCAACAAAACAAAAC T CTTTGTTCGATCTTCGATCTCTCCGTTTCTTCGATTTTATGTTGTTTTTATGTTCTTAGCTCTCCCCAATACGTAGTCAAAGGTTGTCTCGATCTCA.

[0080] >IbNFYA3 Hap1 (SEQ ID NO. 5):

[0081] AGATACCCTGCGATCAAAGTCATCTGCTGTGTCTATCAATAACTTGCGTGTCTCGTGTCTAATATGTTGATTTTCTGGGTGCATATCTTAGATGAAATAATGAATTAGTTATTTAGTTATCAGTTCAAGTCAGAATGTTACTTTTTTGCCAATGCTATTAAATTCCTTAAGAATAATACAT A GTTAAAGTATTCCTTTGTTCTAAGTTGATTGGGTGGTGAATGGTGCCTGGATTTGTTGTTTGACT.

[0082] >IbNFYA3 Hap2 (SEQ ID NO. 6):

[0083] AGATACCCTGCGATCAAAGTCATCTGCTGTGTCTATCAATAACTTGCGTGTCTCGTGTCTAATATGTTGATTTTCTGGGTGCATATCTTAGATGAAATAATGAATTAGTTATTTAGTTATCAGTTCAAGTCAGAATGTTACTTTTTTGCCAATGCTATTAAATTCCTTAAGAATA TAT GTACAT T GTTAAAGTATTCCTTTGTTCTAAGTTGATTGGGTGGTGAATGGTGCCTGGATTTGTTGTTTGACT.

[0084] Gene dosage of IbCHYR1 and the root rot phenotype (see Table 1):

[0085] Table 1 IbCHYR1 gene dosage and root rot phenotype

[0086]

[0087] According to Table 1, when haplotype 2 of IbCHYR1 appears, it is resistant to root rot, and the resistance to root rot of sweet potato increases with the increase of gene dosage.

[0088] IbERF114 gene dosage and root rot phenotype (see Table 2):

[0089] Table 2 IbERF114 gene dosage and root rot phenotype

[0090]

[0091] According to Table 2, when haplotype 1 of IbERF114 appears, it is resistant to soft rot, and the resistance to soft rot of sweet potato increases with the increase of gene dosage.

[0092] IbNF-YA3 gene dosage and root rot phenotype (see Table 3):

[0093] Table 3 IbNF-YA3 gene dosage and root rot phenotype

[0094]

[0095] According to Table 3, when haplotype 1 of IbNF-YA3 appears, it is resistant to soft rot, and the resistance to soft rot of sweet potato increases with the increase of gene dosage.

[0096] According to the correspondence between haplotype gene dosage and resistance to root rot and soft rot, it is confirmed that this method can identify haplotypes associated with excellent phenotypes, and can provide excellent genes for subsequent DNA-free genetic breeding.

[0097] The above-described embodiments are only to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A method for detecting dosage effect of an excellent genotype of sweet potato, characterized by, The method comprises the following steps: Screening haplotype genes related to target traits of sweet potato by whole genome association analysis and haplotype analysis, and determining the polymorphic sites significantly related to the target traits; Extracting the genomic DNA of the sweet potato to be tested, designing primers for the genes related to the target traits of the sweet potato, performing PCR amplification, performing Hi-TOM deep sequencing on the amplification products, analyzing the number of reads of each haplotype through the sequencing results, calculating the proportion of the number of reads of different haplotypes in the total number of reads, and taking the number of chromosomes as the gene dosage of different haplotypes.

2. The method of claim 1, wherein, The target traits of the sweet potato include sweet potato root rot and soft rot.

3. The method of claim 1, wherein, When the proportion of the number of reads of one haplotype in the total number of reads is 1%-17%, the corresponding number of chromosomes is 1; When the proportion of the number of reads of one haplotype in the total number of reads is 18%-33%, the corresponding number of chromosomes is 2; When the proportion of the number of reads of one haplotype in the total number of reads is 35%-50%, the corresponding number of chromosomes is 3; When the proportion of the number of reads of one haplotype in the total number of reads is 51%-67%, the corresponding number of chromosomes is 4; When the proportion of the number of reads of one haplotype in the total number of reads is 68%-83%, the corresponding number of chromosomes is 5; When the proportion of the number of reads of one haplotype in the total number of reads is 84%-100%, the corresponding number of chromosomes is 6.

4. The molecular marker associated with disease resistance in sweet potato obtained by the method according to any one of claims 1 to 3, characterized in that, The diseases of the sweet potato include sweet potato root rot and soft rot, the molecular marker related to the resistance of the sweet potato to root rot includes an IbCHYR1 gene molecular marker, the IbCHYR1 gene molecular marker comprises a molecular marker I with a nucleotide sequence as shown in SEQ ID NO. 1 and a molecular marker II with a nucleotide sequence as shown in SEQ ID NO. 2; The molecular marker related to the resistance of the sweet potato to soft rot includes an IbERF114 gene molecular marker or an IbNF-YA3 gene molecular marker; wherein the IbERF114 gene molecular marker comprises a molecular marker III with a nucleotide sequence as shown in SEQ ID NO. 3 and a molecular marker IV with a nucleotide sequence as shown in SEQ ID NO. 4; and the IbNF-YA11 gene molecular marker comprises a molecular marker V with a nucleotide sequence as shown in SEQ ID NO. 5 and a molecular marker VI with a nucleotide sequence as shown in SEQ ID NO.

6.

5. Application of the reagent for detecting the IbCHYR1 gene molecular marker in any one of the following: (1) application in the identification of the resistance of the sweet potato to root rot; (2) application in the assisted breeding of the sweet potato resistant to root rot; (3) application in the screening of sweet potato varieties resistant to root rot.

6. A method for identifying resistance to root rot disease in sweet potato, characterized by, The method comprises the following steps: The genomic DNA of the to-be-tested sweet potato is used as a template, a primer pair is used to amplify the IbCHYR1 gene molecular marker in claim 4, the amplification product is sequenced, the proportion of reads of different haplotypes of the molecular marker I and the molecular marker II in total reads is counted according to the sequencing result, the proportion of reads of different haplotypes of the molecular marker is expressed in the number of chromosomes, and then the gene dosage of the molecular marker of different haplotypes is determined, and whether the to-be-tested sweet potato has the resistance to the sweet potato root rot is determined according to the gene dosage.

7. The method of claim 6, wherein, If the molecular marker I and the molecular marker II exist simultaneously, and the gene dosage of the molecular marker II is ≥1, it indicates that the to-be-tested sweet potato has the resistance to the sweet potato root rot, and the resistance is enhanced with the increase of the gene dosage. The gene dosage is an integer of 0≤n≤6.

8. Application of a reagent for detecting the IbERF114 gene molecular marker or the IbNF-YA3 gene molecular marker in claim 4 in any one of the following: (1) application in the identification of the resistance to the soft rot of sweet potato; (2) application in the auxiliary breeding of the sweet potato resistant to the soft rot; (3) application in the screening of the sweet potato variety resistant to the soft rot.

9. A method for identifying sweet potato resistance to soft rot disease, characterized by, The method comprises the following steps: The genomic DNA of the to-be-tested sweet potato is used as a template, a primer pair is used to amplify the IbERF114 gene molecular marker or the IbNF-YA3 gene molecular marker in claim 4, the amplification product is sequenced, the proportion of reads of different haplotypes of the molecular marker III and the molecular marker IV in total reads, or the proportion of reads of the molecular marker V and the molecular marker VI in total reads is counted according to the sequencing result, the proportion of reads of different haplotypes of the molecular marker is expressed in the number of chromosomes, and then the gene dosage of the molecular marker of different haplotypes is determined, and whether the to-be-tested sweet potato is the variety resistant to the soft rot of sweet potato is determined according to the gene dosage.

10. The method of claim 9, wherein, If the molecular marker III and the molecular marker IV exist simultaneously, and the gene dosage of the molecular marker III is ≥1, it indicates that the to-be-tested sweet potato has the resistance to the soft rot of sweet potato, and the resistance is enhanced with the increase of the gene dosage. If the molecular marker V and the molecular marker VI exist simultaneously, and the gene dosage of the molecular marker V is ≥1, it indicates that the to-be-tested sweet potato has the resistance to the soft rot of sweet potato, and the resistance is enhanced with the increase of the gene dosage. The gene dosage is an integer of 0≤n≤6.

Images