Compositions and methods for inhibiting complement factor B (CFB) expression

By inhibiting CFB gene expression through double-stranded ribonucleic acid (dsRNA) of CFB RNAi agents, the problem of lack of effective treatment for complement-mediated diseases in existing technologies has been solved, achieving economical and effective CFB expression inhibition and reducing treatment frequency and cost.

CN121399259APending Publication Date: 2026-01-23SHANGHAI ARGO BIOPHARMACEUTICAL CO LTD
View PDF 18 Cites 0 Cited by

Patent Information

Application Number
CN202480038634.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-06-28
Filing Date
2024-06-28
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

There is a lack of effective and economical treatments for complement-mediated diseases such as C3 glomerulonephritis and systemic lupus erythematosus, especially for the overexpression or abnormal activation of complement factor B (CFB). Existing treatments, such as eculizumab, require high-frequency infusions and are costly.

Method used

CFB RNAi agents, including specially designed double-stranded RNA (dsRNA) agents, selectively inhibit CFB gene expression and reduce its activity by forming a double strand with a partially or completely complementary sequence to the CFB RNA transcript.

Benefits of technology

Effective inhibition of CFB gene expression provides a potential therapeutic strategy for complement-mediated diseases, reduces the need for high-dose infusions, and lowers treatment costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005730133720000051
    Figure BDA0005730133720000051
  • Figure BDA0005730133720000052
    Figure BDA0005730133720000052
  • Figure BDA0005730133720000061
    Figure BDA0005730133720000061
Patent Text Reader

Abstract

Compositions and methods useful for reducing CFB gene expression and for treating CFB-related diseases and disorders are provided. Provided are CFB dsRNA agents, CFB antisense polynucleotide agents, compositions comprising CFB dsRNA agents, and compositions comprising CFB antisense polynucleotide agents that can be used to reduce CFB expression in cells and subjects.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present invention relates, in part, to compositions and methods useful for inhibiting complement factor B (CFB) gene expression. TECHNICAL BACKGROUND

[0002] Complement was first discovered in the 1890s when it was found to assist or "complement" heat-labile antibodies present in normal serum in killing bacteria. The complement system or pathway is part of the innate immune system that defends the host against invading pathogens. It is composed of more than 30 proteins that exist either as soluble proteins in the blood or as membrane-associated proteins.

[0003] Three major pathways of complement activation have been recognized, termed the classical, the alternative, and the lectin pathways. Activation of complement leads to a sequential cascade of enzymatic reactions, termed the complement activation pathway, resulting in the formation of the potent anaphylatoxins C3a and C5a, which elicit a variety of physiological responses ranging from chemotaxis to apoptosis. Initially, complement was thought to play an important role in innate immunity, mounting a powerful and rapid response to invading pathogens. However, it has become increasingly apparent that complement also plays an important role in adaptive immunity involving T and B cells, helping to eliminate pathogens, maintain immune memory to prevent re- invasion by pathogens, and participating in a variety of human pathologies.

[0004] Functionally, complement activation occurs at low levels (C3 auto-cleavage to produce C3a and C3b) and is amplified by an enzymatic cascade that converts inactive forms of enzymes (zymogens) to active counterparts in the presence of microorganisms. One type of C3 convertase is a complex of C3b and complement factor B (CFB, factor B). Once formed, C3 convertases can convert large amounts of C3 to its cleavage products C3a and C3b in a short time. The specific C3 convertase is a complex of C3b and factor B, which was originally described in the context of the alternative pathway, but can also form in the context of the other two pathways. In the alternative pathway, factor B is also a component of C5 convertase, a complex that converts C5 (a downstream component of this pathway) to an active form.

[0005] Complement factor B (also referred to as CFB or "factor B") participates in the activation of the alternative pathway. Binding of CFB to C3b (e.g., on a cell surface) makes CFB susceptible to cleavage by factor D, forming the serine protease C3Bb, which itself is a C3 convertase, leading to an amplification loop of C3 activation. CFB is primarily synthesized in the liver, with low levels synthesized in several extrahepatic sites.

[0006] Many diseases are associated with abnormal acquired or genetic activation of the complement pathway and abnormal or overexpression of CFB. Examples include C3 glomerulonephropathy, systemic lupus erythematosus (SLE), lupus nephritis, IgA nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration, atypical hemolytic uremic syndrome, thrombotic microangiopathy, myasthenia gravis, ischemia and reperfusion injury, paroxysmal nocturnal hemoglobinuria, rheumatoid arthritis, immune complex-mediated glomerulonephritis (IC-mediated GN), post-infectious glomerulonephritis (PIGN), ischemia / reperfusion injury, antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), dysbiotic periodontitis, malaria-associated anemia, and hyperlipidemia.

[0007] Currently, treatment options for complement system-mediated diseases, symptoms, and syndromes are limited. Eculizumab, a monoclonal humanized antibody, is one such option. Although eculizumab has proven effective in treating paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), and myasthenia gravis, and is currently being evaluated in clinical trials for other complement component-related diseases, eculizumab therapy requires high-dose weekly infusions followed by maintenance infusions every two weeks, resulting in high costs. Therefore, there is a significant medical need for treatments of complement-mediated or related diseases. C3 is a key factor in complement pathway activation. Therefore, inhibiting the expression of factors involved in C3 activation (such as CFB) offers a promising therapeutic strategy for many complement-mediated diseases. Targeting CFB expression or activity through antisense oligonucleotides, double-stranded siRNAs, or small-molecule inhibitors of CFB has been proposed as a potential therapeutic strategy for various complement-mediated diseases.

[0008] Therefore, the CFB RNAi agents disclosed herein are used to treat diseases, conditions, and symptoms associated with complement activation through, for example, activation of complement factor B activity. Summary of the Invention

[0009] Generally, this disclosure is characterized by novel CFB gene-specific RNAi agents, compositions comprising CFB RNAi agents, and methods for inhibiting CFB gene expression in vitro and / or in vivo using CFB RNAi agents and compositions comprising the CFB RNAi agents described herein. The CFB RNAi agents described herein can selectively and effectively reduce, inhibit, or silence CFB gene expression in subjects (e.g., human or animal subjects).

[0010] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 1, 3 or 5 by no more than 1, 2 or 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 2, 4 or 6 by no more than 1, 2 or 3 nucleotides, wherein the sense strand and the antisense strand may be partially complementary, substantially complementary or completely complementary to each other.

[0011] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand contains a region complementary to the CFB RNA transcript and comprises at least 15 consecutive nucleotides differing from any of the antisense sequences listed in Tables 1-3 by no more than 1, 2, or 3 nucleotides. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand contains a region complementary to the CFB RNA transcript and comprises at least 15 consecutive nucleotides from any of the antisense sequences listed in any one of Tables 1-3.

[0012] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 of the antisense strand include a region complementary to the CFB RNA transcript, wherein the complementary region comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally includes a targeting ligand.

[0013] In some embodiments, a double-stranded RNA (dsRNA) agent for inhibiting CFB expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any of the nucleotide sequences 483-513, 486-516, 491-521, 483-521, 513-543, 987-1017, 989-1019, 1317-1347, 2237-2267, and 2439-2469 in SEQ ID NO:1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any of the nucleotide sequences ... The corresponding nucleotide sequence in NO:2 differs from the corresponding nucleotide sequence by at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary to each other.

[0014] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any of the nucleotide sequences 488-508, 491-511, 496-516, 488-516, 518-538, 992-1012, 994-1014, 1322-1342, 2242-2262, and 2444-2464 in SEQ ID NO:1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence in SEQ ID NO:2.

[0015] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the sense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 490-508, 493-511, 498-516, 490-516, 520-538, 994-1012, 996-1014, 1324-1342, 2244-2262, and 2446-2464 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence from SEQ ID NO: 2.

[0016] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the sense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 489-507, 492-510, 497-515, 489-515, 519-537, 993-1011, 995-1013, 1323-1341, 2243-2261, and 2445-2463 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence from SEQ ID NO: 2.

[0017] In some implementations, the CFB RNA transcript is SEQ ID NO:1.

[0018] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to one of the target regions of SEQ ID NO: 1 and is provided in any of the tables in Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any target region of SEQ ID NO: 1 and is provided in any of the tables in Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any of the tables in Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any of the tables in Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any of the tables in Tables 1-3. In some embodiments, the dsRNA agent comprises a sequence listed as a double-stranded sequence in any of the tables in Tables 1-3.

[0019] In some implementations, the sense and antisense strands of the dsRNA agent can be partially, substantially, or completely complementary.

[0020] In some embodiments, the dsRNA reagent includes at least one modified nucleotide. In some embodiments, all or substantially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least one modified nucleotide includes: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seco nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse debased nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, isomannitol nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide including a 5'-thiophosphate group, or terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bis(decyl)amide group, 2'-amino modified nucleotide, phosphoramide, or nucleotide including a non-natural base.

[0021] In some implementations, the dsRNA agent contains an E-vinylphosphonate nucleotide at the 5' end of the guide strand.

[0022] In some embodiments, the dsRNA agent comprises at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the sense strand comprises at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the antisense strand comprises at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 5' end of the antisense strand includes two phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 3' end of the antisense strand includes two phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 5' end and the 3' end of the antisense strand independently each include two phosphate-thioester nucleoside internucleotide bonds.

[0023] In some embodiments, all or substantially all nucleotides of the sense and antisense strands are modified nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides, 2'-fluoronucleotides, and UNA-modified nucleotides, wherein fewer than 6 of the modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 3 or 5 2'-fluoronucleotides, preferably 5 2'-fluoronucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoronucleotides, wherein fewer than 4 of the modified nucleotides are 2'-fluoronucleotides. In some embodiments, the sense strand comprises 3 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 15 or more modifying nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, wherein at least 14 of the modifying nucleotides are 2'-O-methylnucleotides and positions 2, 5, 7, 11, 12, 14, 16, and / or 18, counting from the first matching position at the 5' end of the antisense strand, are independently 2'-fluoronucleotides. In some embodiments, the antisense strand comprises at least one UNA-modified nucleotide and five 2'-fluoronucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 16, counting from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 18, counting from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises a UNA-modified nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 11, 14, and 16, counting from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides.In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 18, counting from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, preferably, wherein at least 18 modified nucleotides are 2'-O-methylnucleotides and the nucleotides at positions 9, 11, and / or 13, counting from the first matching position at the 3' end of the sense strand, are 2'-fluoronucleotides. In some embodiments, the sense strand comprises at least 18 modified nucleotides that are 2'-O-methylnucleotides, and the nucleotides at positions 8, 11, and / or 13, counting from the first matching position at the 3' end of the sense strand, are 2'-fluoronucleotides. In some embodiments, the modified sense strand is a modified sense strand sequence listed in one of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence listed in one of Tables 2-3.

[0024] In some embodiments, the dsRNA reagent comprises at least one modified nucleotide and further comprises one or more targeting or linking groups. In some embodiments, one or more targeting or linking groups are conjugated to a sense strand. In some embodiments, the targeting or linking group comprises N-acetylgalactosamine (GalNAc).

[0025] In some implementations, the targeting group has the following structure:

[0026]

[0027] "n" is independently selected from 1 or 2.

[0028] In some implementations, the targeting group has the following structure:

[0029]

[0030]

[0031]

[0032]

[0033] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group conjugated to the 3' end of the sense strand.

[0034] In some implementations, the antisense strand contains a reverse abase-free residue at its 3'-end.

[0035] In some embodiments, the sense chain includes one or two inverted abase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, each end of the sense chain includes one inverted abase residue. In some embodiments, each end of the sense chain includes one imann residue. In some embodiments, the 5' end of the sense chain includes an inverted abase residue or imann residue, wherein the inverted abase residue or imann residue is linked to an adjacent nucleotide at the 5' end of the nucleotide sequence of the sense chain via a phosphate thioester bond. In some embodiments, the sense chain further includes a targeting group linked to the inverted abase residue or imann residue at the 5' end of the sense chain, wherein the targeting group is linked to an adjacent inverted abase residue or imann residue via a phosphate thioester bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc). In some embodiments, the 5' end of the sense chain includes an inverted abase residue, wherein the inverted abase residue is linked to an adjacent nucleotide at the 5' end of the nucleotide sequence of the sense chain via a phosphate thioester bond. In some embodiments, the sense chain further includes a targeting group attached to an inverse abase residue at the 5' end of the sense chain, wherein the targeting group is attached to an adjacent inverse abase residue via a thiophosphate bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc), and each chain is independently 21 nucleotides long.

[0036] In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand contains a 3' overhang of at least one nucleotide. In some embodiments, at least one strand contains a 3' overhang of at least two nucleotides.

[0037] In some embodiments, the dsRNA comprises a double strand selected from AV02373, AV02375, AV02379, AV02388, AV02411, AV02464, AV02554, AV02584, AV06327, AV06328, and AV06329, wherein the double strand optionally includes a targeting ligand. In some embodiments, the dsRNA comprises a double strand selected from AD01093, AD01093-1, AD01093-2, AD01094, AD01096, AD01393, AD01393-1, AD01396, AD01399, AD01412, AD01420, and AD01420-1.

[0038] According to another aspect of the invention, a double-stranded RNA (dsRNA) agent for inhibiting CFB expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to a portion of the CFB RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, and wherein the sense strand contains a sequence that can be represented by formula (I):

[0039] 5′-(N′ L ) n′ N′ L N′ L N′ L N′ L N′ F N′ L N′ F N′ L N′ N1 N′ N2 N′ L N′ L N′ L N′ L N′ L (N′ L ) m′ -3′ (I)

[0040] in:

[0041] Each N' F Represents nucleotides with 2'-fluorine modification; each N′ N1 and N′ N2 Independently representing modified or unmodified nucleotides; each N' L The nucleotides are independently represented as modified or unmodified, but not as nucleotides with 2'-fluorine modification, and m′ and n′ are each independently integers from 0 to 7.

[0042] In some implementations, N′ N1 and N′ N2 It contains only one 2'-fluorinated nucleotide.

[0043] In some implementations, N′ N1 Independently represents nucleotides modified with 2'-fluorine.

[0044] In some implementations, N′ N2 Independently represents nucleotides modified with 2'-fluorine.

[0045] In some implementations, m′ is 2 and n′ is 4, or m′ is 2 and n′ is 2. In some implementations, m′ is 1 and n′ is 4, or m′ is 1 and n′ is 2. In some implementations, m′ is 0 and n′ is 4, or m′ is 0 and n′ is 2.

[0046] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. Preferably, the targeting group is selected from any one of GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably, the targeting group is the aforementioned GLS-15*. In some embodiments, the dsRNA agent includes a targeting group conjugated to the 3' end of the sense strand. In some embodiments, the antisense strand contains an inverted abase residue at the 3' end. In some embodiments, the sense strand contains one or two inverted abase residues and / or one or two imann residues at the 3' and / or 5' ends. In some embodiments, each 3' and 5' end of the sense strand independently contains an inverted abase residue. In some embodiments, each 3' and 5' end of the sense strand independently contains an imann residue. In some embodiments, the sense strand includes two inverted abase residues at the 3' and 5' ends, and either residue at the 3' or 5' end is further conjugated to a targeting group, preferably the aforementioned GLS-15*. In some embodiments, the sense chain includes two imann residues at the 3' and 5' ends, and either residue at the 3' or 5' end is further conjugated to a targeting group, preferably the aforementioned GLS-15*. In some embodiments, each end of the sense chain includes an inverted abase residue or imann residue at the 5' end of the sense chain, wherein the inverted abase residue or imann residue is linked to an adjacent nucleotide at the 5' end of the nucleotide sequence of the sense chain via a thiophosphate bond. In some embodiments, the sense chain further includes a targeting group linked to the inverted abase residue or imann residue at the 5' end of the sense chain, wherein the targeting group is linked to an adjacent inverted abase residue or imann residue via a thiophosphate bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc). In some embodiments, the 5' end of the sense chain includes an inverted abase residue, wherein the inverted abase residue is linked to an adjacent nucleotide at the 5' end of the nucleotide sequence of the sense chain via a thiophosphate bond. In some embodiments, the sense strand further includes a targeting group attached to an antibasic residue at the 5' end of the sense strand, wherein the targeting group is attached to an adjacent antibasic residue via a thiophosphate bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc), each strand being independently 21 nucleotides. In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of the target regions of SEQ ID NO:1, and is provided in any of Tables 1-3.

[0047] According to another aspect of the invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to the CFB RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, and wherein the antisense strand contains a sequence that can be represented by formula (II):

[0048] 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5′(II)

[0049] in:

[0050] Each N F Represents a nucleotide with 2'-fluorine modification; N M1 N M2 N M3 N M4 N M5 and N M6 Each N represents a modified or unmodified nucleotide independently; L Independently represents a modified or unmodified nucleotide, but not a 2'-fluorinated nucleotide, and n is an integer from 0 to 7.

[0051] In some embodiments, N M1 N M2 N M3 N M4 N M5 and N M6 There are only three 2'-fluorinated nucleotides.

[0052] In some implementation schemes, N M2 N M3 and N M5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0053] In some implementation schemes, NM2 N M4 and N M5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0054] In some implementation schemes, N M1 N M3 and N M6 Each of them independently represents a nucleotide modified with 2'-fluorine.

[0055] In some implementation schemes, N M2 N M3 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0056] In some implementation schemes, N M2 N M4 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0057] In some implementation schemes, N M1 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide and N M5 This indicates a nucleotide modified with UNA.

[0058] In some implementation schemes, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide and N M5 This indicates a nucleotide modified with UNA.

[0059] In some implementation schemes, N M2 N M4 and N M6 Each independently represents a 2'-fluorinated nucleotide and N M5 This indicates a nucleotide modified with UNA.

[0060] In some embodiments, n is 1, or n is 2, or n is 3, or n is 5. In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any of the target regions of SEQ ID NO:1, and is provided in any of Tables 1-3.

[0061] According to another aspect of the invention, a double-stranded RNA (dsRNA) agent for inhibiting CFB expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand and the antisense strand are complementary, wherein the antisense strand contains a region complementary to a CFB RNA transcript, wherein the complementary region contains at least 15 consecutive nucleotides, and wherein the dsRNA duplex comprises a duplex represented by formula (III):

[0062] Meaningful chain: 5′-(N′) L ) n′ N′ L N′ L N′ L N′ L N′ F N′ L N′ F N′ L N′ N1 N′ N2 N′ L N′ L N′ L N′ L N′ L (N′ L ) m′ -3′

[0063] Antisense chain: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5′

[0064] (III)

[0065] in:

[0066] Each chain is approximately 18 to 30 nucleotides in length;

[0067] Each N F and N' FIndependently represents a nucleotide modified with 2'-fluorine; N M1 N M2 N M3 N M4 N M5 N M6 、N′ N1 and N′ N2 Each N represents a modified or unmodified nucleotide independently; L and N' L Each nucleotide can be used independently to represent a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification, and each of m', n' and n can be an integer from 0 to 7.

[0068] In some embodiments, N M1 N M2 N M3 N M4 N M5 and N M6 It has only 3 2' fluorinated nucleotides, N' N1 and N' N2 It includes only one 2'-fluorinated nucleotide.

[0069] In some embodiments, m′ is 2 and n′ is 4, m′ is 2 and n′ is 6, or m′ is 2 and n′ is 2. In some embodiments, m′ is 1 and n′ is 4, or m′ is 1 and n′ is 2. In some embodiments, m′ is 0 and n′ is 4, or m′ is 0 and n′ is 2. In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0070] In some implementation schemes, N' N1 Independently represents nucleotides modified with 2'-fluorine.

[0071] In some implementation schemes, N' N2 Independently represents nucleotides modified with 2'-fluorine.

[0072] In some implementation schemes, N M2 N M3 and N M5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0073] In some implementation schemes, N M2 N M4 and N M5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0074] In some implementation schemes, N M1 N M3 and N M6 Each of them independently represents a nucleotide modified with 2'-fluorine.

[0075] In some implementation schemes, N M2 N M3 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0076] In some implementation schemes, N M2 N M4 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0077] In some implementation schemes, N M1 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide and N M5 This indicates a nucleotide modified with UNA.

[0078] In some implementation schemes, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 This indicates a nucleotide modified with UNA.

[0079] In some implementation schemes, N M2 N M4 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 This indicates a nucleotide modified with UNA.

[0080] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. Preferably, the targeting group is selected from any one of GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably, the targeting group is the aforementioned GLS-15*. In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. In some embodiments, the antisense strand contains an inverted abase residue at the 3' end. In some embodiments, the sense strand contains one or two inverted abase residues and / or one or two imann residues at the 3' and / or 5' ends. In some embodiments, each 3' and 5' end of the sense strand independently contains an inverted abase residue. In some embodiments, each 3' and 5' end of the sense strand independently contains an imann residue. In some embodiments, the sense strand includes two inverted abase residues at the 3' and 5' ends, and either residue at the 3' or 5' end is further conjugated to a targeting group, preferably the aforementioned GLS-15*. In some embodiments, the sense strand includes two Imann residues at its 3' and 5' ends, and either residue at the 3' or 5' end is further conjugated to a targeting group, preferably the aforementioned GLS-15*. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3' overhang of at least one nucleotide. In some embodiments, at least one strand includes a 3' overhang of at least two nucleotides. In some embodiments, each end of the sense strand includes an inverted abase residue or Imann residue at the 5' end of the sense strand, wherein the inverted abase residue or Imann residue is linked to an adjacent nucleotide at the 5' end of the nucleotide sequence of the sense strand via a phosphate thioester bond. In some embodiments, the sense strand further includes a targeting group linked to the inverted abase residue or Imann residue at the 5' end of the sense strand, wherein the targeting group is linked to an adjacent inverted abase residue or Imann residue via a phosphate thioester bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc). In some embodiments, the 5' end of the sense strand includes an inverted abase residue, wherein the inverted abase residue is linked to an adjacent nucleotide at the 5' end of the nucleotide sequence of the sense strand via a phosphate thioester bond. In some embodiments, the sense strand further includes a targeting group linked to the inverted abase residue at the 5' end of the sense strand, wherein the targeting group is linked to an adjacent inverted abase residue via a phosphate thioester bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc), each strand being 21 nucleotides independently. In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any of the target regions of SEQ ID NO:1, and is provided in any of Tables 1-3.

[0081] According to one aspect of the invention, a composition is provided comprising any embodiment of the foregoing dsRNA agents of the invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents. In some embodiments, the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration or for intravenous (IV) administration.

[0082] According to another aspect of the invention, a cell is provided comprising any embodiment of the foregoing dsRNA agent of the invention. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0083] According to another aspect of the present invention, a method for inhibiting CFB gene expression in cells is provided, the method comprising: (i) preparing cells comprising an effective amount of any embodiment of the dsRNA agent of the present invention described above or any embodiment of the composition of the present invention described above. In some embodiments, the method further comprises: (ii) maintaining the prepared cells for a sufficient time to allow degradation of the mRNA transcript of the CFB gene, thereby inhibiting CFB gene expression in the cells. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject intravenously. In some embodiments, the method further comprises assessing the inhibition of the CFB gene after administration of the dsRNA agent to the subject, wherein the assessment method comprises: (i) determining one or more physiological characteristics of the subject’s CFB-related disease or condition, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the CFB-related disease or condition and / or control physiological characteristics of the CFB-related disease or condition, wherein the comparison indicates the presence or absence of one or more of the subject’s CFB gene expression inhibition. In some embodiments, the physiological characteristics are one or more of the following: CFB mRNA level and CFB protein level. Decreased CFB expression can also be indirectly assessed by measuring a decrease in CFB biological activity, for example, in other pathologies associated with elevated CFB levels (preferably in the blood or kidneys), excessive activation of the complement pathway, or other treatments requiring inhibition of CFB expression. A decrease in one or more of the following indicators is considered: CFB mRNA level, CFB protein level, CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity of the alternative complement pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin level; and levels of one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex.

[0084] According to another aspect of the present invention, a method for inhibiting CFB gene expression in a subject is provided, the method comprising administering to the subject an effective amount of an embodiment of the present invention's dsRNA agent described above or an embodiment of the present invention's composition described above. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the method further comprises assessing the inhibition of the CFB gene after administration of the dsRNA agent, wherein the assessment method comprises: (i) determining one or more physiological characteristics of a CFB-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the CFB-related disease or condition and / or control physiological characteristics of the CFB-related disease or condition, wherein the comparison indicates the presence or absence of one or more of CFB gene expression inhibition in the subject. In some embodiments, CFB gene expression may be assessed based on the level or level change of any variable associated with CFB gene expression, such as CFB mRNA level, CFB protein level. Decreased CFB expression can also be indirectly assessed by measuring decreased CFB biological activity, for example, other pathologies associated with elevated CFB levels, preferably in the blood or kidneys, or excessive activation of the complement pathway, or other treatments requiring inhibition of CFB expression, including CFB mRNA levels, CFB protein levels, CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity of the alternative complement pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin levels; and levels of one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex.

[0085] According to another aspect of the invention, a method for treating a disease or condition associated with the presence of CFB protein is provided, the method comprising: administering to a subject an effective amount of any of the embodiments of the above-described dsRNA agents of the invention, or any embodiment of any of the foregoing compositions of the invention, for inhibiting CFB gene expression. In some implementations, the diseases, conditions, or symptoms associated with CFB are selected from: autoimmune diseases, complement system dysfunction, including abnormal upregulation of complement components such as CFB, C3 glomerulonephritis (C3G), systemic lupus erythematosus (SLE), lupus nephritis, Ig-mediated kidney diseases such as IgA nephropathy and primary membranous nephropathy, nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration (AMD), including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia-reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatic diseases, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), immune complex Compound-mediated glomerulonephritis (IC-mediated GN), post-infectious glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid antibody syndrome (APS), periodontal disease, malaria-associated anemia, dermatomyositis, bullous pemphigoid, Shiga toxin-associated Escherichia coli-associated hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposition disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular transplant rejection, graft dysfunction, myocardial infarction, graft allergy, hyperlipidemia, and sepsis.

[0086] In some embodiments, the method further includes administering an additional treatment regimen to the subject. In some embodiments, the additional treatment regimen includes treatment for CFB-related diseases or conditions. In some embodiments, the additional treatment regimen includes administering one or more of the present invention's CFB antisense polynucleotides to the subject, administering a non-CFB dsRNA therapeutic agent to the subject, and behavioral modifications to the subject. In some embodiments, the additional therapeutic agent is selected from the group consisting of oligonucleotides, small molecules, monoclonal antibodies, polyclonal antibodies, and peptides. Preferably, the additional therapeutic agent is a C5 inhibitor, such as an anticomplement component C5 antibody or its antigen-binding fragment (e.g., eculizumab, ravulizumab-cwvz, or pozerimab (REGN3918)) or a C5 peptide inhibitor (e.g., zilucoplan). Eculizumab is a humanized monoclonal IgG2 / 4, kappa light chain antibody that specifically binds to complement component C5 with high affinity and inhibits the cleavage of C5 into C5a and C5b, thereby inhibiting the formation of the terminal complement complex C5b-9. Ravulizumab-cwvz is a humanized IgG2 / 4 monoclonal antibody that specifically binds to complement component C5 with high affinity and inhibits the cleavage of C5 into C5a and C5b, thereby inhibiting the formation of the terminal complement complex C5b-9. Pozelimab (also known as H4H12166P, described in US20170355757) is a fully human IgG4 monoclonal antibody designed to block complement factor C5. Zilucoplan is a synthetic macrocyclic peptide that binds to complement component 5 (C5) with sub-nanomolar affinity and allosterically inhibits its cleavage into C5a and C5b upon activation via the classical, alternative, or lectin pathway. Preferably, an additional therapeutic agent is a C3 peptide inhibitor or an analogue thereof. In one embodiment, the C3 peptide inhibitor is campstatin. Compstatin is a cyclic decacyclic peptide with potent and selective C3 inhibitory activity.

[0087] In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the method further includes determining the efficacy of the administered double-stranded RNA (dsRNA) agent on the subject.

[0088] In some implementations, methods for determining the efficacy of treatment on a subject include: (i) determining one or more physiological characteristics of the subject’s CFB-related disease or condition, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the CFB-related disease or condition, wherein the comparison results indicate one or more of the presence, absence, and efficacy level of administration of a double-stranded RNA (dsRNA) agent to the subject.

[0089] In some implementations, CFB gene expression can be assessed based on the level or changes in the level of any variable associated with CFB gene expression, such as the subject's CFB mRNA level, CFB protein level, or CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin level; and the levels of one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex.

[0090] According to another aspect of the invention, a method is provided for reducing CFB protein levels in a subject compared to baseline pre-treatment levels, the method comprising administering to the subject an effective amount of any of the foregoing dsRNA agents of the invention or any of the foregoing compositions of the invention to reduce CFB gene expression levels. In some embodiments, the dsRNA agent is administered subcutaneously or intravenously to the subject.

[0091] According to another aspect of the invention, a method is provided to alter the physiological characteristics of a subject with CFB-related disease or condition compared to baseline pre-treatment physiological characteristics of the subject. The method comprises administering to the subject an effective amount of any of the aforementioned dsRNA agents of the invention or any of the aforementioned compositions of the invention to alter the physiological characteristics of the subject with respect to CFB-related disease or condition. In some embodiments, the dsRNA agent is administered subcutaneously or intravenously to the subject. In some embodiments, the physiological characteristics and symptoms are one or more of the following: CFB mRNA levels, CFB protein levels, or CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity of the alternative complement pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin levels; and levels of any one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex.

[0092] According to another aspect of the present invention, a method is provided for using the aforementioned dsRNA agent to treat diseases or conditions associated with the presence of CFB protein. In some embodiments, the disease or condition is one or more of the following: autoimmune diseases, complement system dysfunction (including abnormal upregulation of complement components, such as CFB), C3 glomerulonephropathy (C3G), systemic lupus erythematosus (SLE), lupus nephritis; Ig-mediated kidney diseases (e.g., IgA nephropathy and primary membranous nephropathy), nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy; age-related macular degeneration (AMD), including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia and reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatic diseases, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), immune complexes. Infectious diseases include: IC-mediated glomerulonephritis (IC-mediated GN), post-infectious glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid antibody syndrome (APS), periodontal dysbiosis, malarial anemia, bullous dermatomyositis, pemphigoid, Shiga toxin-associated Escherichia coli-associated hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposit disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular transplant rejection, graft dysfunction, myocardial infarction, transplant sensitization, hyperlipidemia, and sepsis.

[0093] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting CFB protein expression is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one consecutive nucleotide is a modified nucleotide, and wherein the nucleotide sequence of the agent is approximately 80% complementary over its entire length to an equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any of the target regions of SEQ ID NO: 1, and the complementary sequence is a sequence provided in one of Tables 1-3. In some embodiments, the antisense polynucleotide agent comprises one of the antisense sequences provided in one of Tables 1-3.

[0094] According to another aspect of the invention, a composition comprising any of the antisense polynucleotide agents described above is provided. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents for treating CFB-related diseases or conditions. In some embodiments, the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous or intravenous administration.

[0095] According to another aspect of the invention, a cell comprising any of the antisense polynucleotide agents described above is provided. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0096] According to another aspect of the invention, a method for inhibiting CFB gene expression in cells is provided, the method comprising: (i) preparing cells containing an effective amount of any of the aforementioned antisense polynucleotide reagents according to the embodiments. In some embodiments, the method further comprises (ii) maintaining the cells prepared in (i) for a time sufficient to allow degradation of the mRNA transcript of the CFB gene, thereby inhibiting CFB gene expression in the cells.

[0097] According to another aspect of the invention, a method for inhibiting CFB gene expression in a subject is provided, the method comprising administering an effective amount of any of the aforementioned antisense polynucleotide reagents to the subject.

[0098] According to another aspect of the invention, a method for treating a disease or condition associated with the presence of CFB protein is provided, the method comprising administering to a subject an effective amount of any of the above-described antisense polynucleotide agents or any of the above-described compositions of the invention to inhibit CFB gene expression. In some embodiments, the disease or condition is one or more of the following: autoimmune diseases, complement system dysfunction (including abnormal upregulation of complement components, such as CFB), C3 glomerulonephropathy (C3G), systemic lupus erythematosus (SLE), lupus nephritis, Ig-mediated nephropathy (e.g., IgA nephropathy and primary membranous nephropathy), nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration (AMD), including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia and reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatic diseases, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), immune complex-mediated... Glomerulonephritis (IC-mediated GN), post-infectious glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid antibody syndrome (APS), dysbiosis-related periodontitis, malarial anemia, bullous dermatomyositis, pemphigoid, Shiga toxin-associated Escherichia coli-associated hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposit disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular transplant rejection, graft dysfunction, myocardial infarction, transplant sensitization, hyperlipidemia, and sepsis.

[0099] According to another aspect of the invention, a method is provided for reducing CFB protein levels in a subject compared to baseline pre-treatment levels, the method comprising administering to the subject an effective amount of any of the aforementioned antisense polynucleotide reagents of the invention or any of the aforementioned compositions to reduce CFB gene expression levels. In some embodiments, the antisense polynucleotide reagent is administered to the subject subcutaneously or via intravenous injection.

[0100] According to another aspect of the invention, an antisense polynucleotide reagent for inhibiting CFB gene expression is provided, the reagent comprising 10 to 30 consecutive nucleotides, wherein at least one of the consecutive nucleotides is a modified nucleotide, and wherein the nucleotide sequence has about 80% or about 85% complementarity over its full length to the equivalent region of the nucleotide sequence of SEQ ID NO:1.

[0101] According to another aspect of the invention, a method is provided to alter the physiological characteristics of a subject with CFB-related disease or condition, compared to baseline pre-treatment physiological characteristics of the subject's CFB-related disease or condition. The method comprises administering to the subject an effective amount of any of the above-described embodiments of the antisense polynucleotide agent or any of the above-described compositions of the invention to alter the physiological characteristics of the subject's CFB disease or condition. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously or intravenously. In some embodiments, the physiological characteristics and symptoms are one or more of the following: the subject's CFB mRNA level, CFB protein level, or CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity of the alternative complement pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin level; and levels of one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex.

[0102] SEQUENCE DESCRIPTION

[0103] SEQ ID NO:1 and SEQ ID NO:2 (reverse complementary) are Homo sapiens CFB mRNA [NCBI reference sequence: NM_001710.6].

[0104] SEQ ID NO:3 and SEQ ID NO:4 (reverse complementary) are rhesus monkey (mammal) CFB mRNA [NCBI reference sequence: XM_015136029.2].

[0105] SEQ ID NO:5 and SEQ ID NO:6 (reverse complementary) are mouse (subtype 1) CFB mRNA [NCBI reference sequence: NM_008198.3].

[0106] SEQ ID NO:7-468 and 1489-1595, as shown in Table 1, are sense chain sequences.

[0107] As shown in Table 1, SEQ ID NO:469-930 and 1596-1702 are antisense sequences.

[0108] SEQ ID NO:931-1392 and 1703-1810, as shown in Table 2, are sequences with chemical modifications.

[0109] SEQ ID NO:1393-1488, 1811-1879, 1882-1951 are shown in Table 3. The delivery molecule is represented as "GLX-__" at the 3' or 5' end of each sense strand. Detailed Implementation

[0110] This invention partially includes RNAi agents, such as, but not limited to, double-stranded (ds) RNAi agents, which are capable of inhibiting CFB gene expression. This invention also partially includes compositions comprising CFB RNAi agents and methods of using such compositions. The CFB RNAi agents disclosed herein can be attached to a delivery compound for delivery to cells, including hepatocytes. Pharmaceutical compositions of this invention may comprise at least one dsRNA CFB agent and a delivery compound. In some embodiments of the compositions and methods of this invention, the delivery compound is a delivery compound containing GalNAc. CFB RNAi agents delivered to cells can inhibit CFB gene expression, thereby reducing the activity of the CFB protein product of this gene in cells. The dsRNAi agents of this invention can be used to treat CFB-related diseases and conditions.

[0111] In some embodiments of the invention, reducing CFB expression in cells or subjects treats diseases or conditions associated with CFB expression in cells or subjects. Non-limiting examples of diseases and conditions that can be treated by reducing CFB activity include: relief or improvement of one or more symptoms associated with unwanted or excessive CFB expression; CH50 activity (a measure of total hemolytic complement); AH50 (a measure of hemolytic activity of the alternative complement pathway); lactate dehydrogenase (LDH) (a measure of intravascular hemolysis); hemoglobin levels; and levels of one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex. "Treatment" can also refer to prolonged survival compared to expected survival without treatment.

[0112] As used herein, “G,” “C,” “A,” and “U” generally represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it should be understood that the terms “ribonucleotide” or “nucleotide” can also refer to modified nucleotides (described further below) or substitutional portions. Those skilled in the art will understand that guanine, cytosine, adenine, and uracil can be substituted with other portions without significantly altering the base-pairing properties of oligonucleotides containing nucleotides with such substitutions. For example, but not limited to, nucleotides containing inosine as a base can pair with nucleotides containing adenine, cytosine, or uracil. Therefore, in the nucleotide sequences of this invention, nucleotides containing uracil, guanine, or adenine can be substituted with nucleotides containing, for example, inosine. Sequences containing such substitutions are embodiments of this invention.

[0113] As used herein, “complement factor B” may be used interchangeably with the terms “factor B” or “CFB”, and refers to a naturally occurring gene encoding a complement factor B protein derived from any vertebrate or mammal, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs, unless otherwise stated. The term also refers to fragments and variants of natural CFB that retain at least one in vivo or in vitro activity of natural CFB. The amino acid sequence and complete coding sequence of the reference sequence of the human CFB gene can be found, for example, in GenBank Ref Seq Accession No. NM_001710.6 (SEQ ID NO: 1 and SEQ ID NO: 2), Macaca mulatta (rhesus monkey) CFB mRNA GenBank Ref Seq Accession No. XM_015136029.2 (SEQ ID NO: 3 and SEQ ID NO: 4), and Mus musculus (isoform 1) NM_008198.3 (SEQ ID NO: 5 and SEQ ID NO: 6). Other examples of CFB mRNA sequences are readily available using public databases such as GenBank, UniProt, Ensembl, and OMIM.

[0114] The following describes how to prepare and use compositions containing CFB single-stranded (ssRNA) and dsRNA reagents to inhibit CFB gene expression, as well as compositions and methods for treating diseases and conditions caused or regulated by CFB gene expression. The term "RNAi" is also known in the art and may be referred to as "siRNA".

[0115] As used herein, the term "RNAi" refers to an agent containing RNA and mediating targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi target region is a continuous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including messenger RNA (mRNA), a product of RNA processing as a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for targeted RNAi cleavage at or near that portion. Target sequences can be 8–30 nucleotides long (including the end value), 10–30 nucleotides long (including the end value), 12–25 nucleotides long (including the end value), 15–23 nucleotides long (including the end value), 16–23 nucleotides long (including the end value), or 18–23 nucleotides long (including the end value), encompassing all shorter lengths within each specified range. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the target sequence is between 9 and 26 nucleotides in length (including end values), including all subranges and integers therebetween. For example, although not intended to be limiting, in some embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, and its sequence is at least partially complete or at least substantially complementary to the RNA transcript of the CFB gene. Some aspects of the invention include pharmaceutical compositions comprising one or more CFB dsRNA agents and a pharmaceutically acceptable carrier. In some embodiments of the invention, the CFB RNAi described herein inhibits the expression of the CFB protein.

[0116] As used herein, "dsRNA agents" refers to compositions containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. While not wishing to be limited to a particular theory, the dsRNA agents of this invention may function through RNA interference mechanisms (i.e., by interacting with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanisms or pathways. Methods for silencing genes in plant, invertebrate, and vertebrate cells are well known in the art [see, for example (Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188)], the contents of which are incorporated herein by reference in their entirety. Gene silencing procedures known in the art can be used in conjunction with the disclosures provided herein to suppress CFB expression.

[0117] The dsRNA agents disclosed herein consist of a sense strand and an antisense strand, including but not limited to: short interfering RNA (siRNA), RNAi agents, microRNAs (miRNAs), short hairpin RNAs (shRNAs), and cleavage enzyme substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. dsRNA double-stranded structures of varying lengths are known in the art for the purpose of inhibiting target gene expression. For example, dsRNAs with double-stranded structures of 19, 20, 21, 22, and 23 base pairs are known to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). Shorter or longer RNA double-stranded structures are also known in the art to effectively induce RNA interference. In some embodiments, the sense and antisense strands may be the same or different in length. In some embodiments, each strand is no more than 40 nucleotides long. In some embodiments, each strand is no more than 30 nucleotides long. In some embodiments, each strand is no more than 25 nucleotides long. In some embodiments, each strand is no more than 23 nucleotides long. In some embodiments, the length of each strand does not exceed 21 nucleotides. In some embodiments, the lengths of the sense and antisense strands of the RNAi agent can be 15 to 49 nucleotides, respectively. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, both the sense and antisense strands are 21 nucleotides long. In some embodiments, the sense strand and antisense strand are complementary or substantially complementary, and the length of the complementary region is 15 to 23 nucleotides. In some embodiments, the length of the complementary region is 19-21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments of the invention, the CFBdsRNA may comprise at least one strand of at least 21 nt in length, or may have a shorter duplex based on one of the sequences listed in any of Tables 1-3, but it may also be effective to reduce one, two, three, or four nucleotides at one or both ends compared to the dsRNAs listed in Tables 1-3.In some embodiments of the present invention, the CFB dsRNA agent may have a partial sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one or more sequences in Tables 1-3, and its ability to inhibit CFB gene expression differs from the inhibition level produced by dsRNA containing the complete sequence by no more than 5%, 10%, 15%, 20%, 25% or 30%. The sense sequences, antisense sequences and duplexes disclosed in Tables 1-3 may be referred to herein as “parental” sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, lengthened, or included in substitutions as described herein, and the resulting sequences retain all or at least a portion of the efficacy of their parental sequences in the methods and compositions of the present invention. The sense and antisense strands included in the dsRNA of the present invention are independently selected. As used herein, the term “independently selected” means that each of two or more similar elements can be selected independently of the selection of other elements. For example, although not intended to be limiting, “elements” of both strands may be selected to be included in a duplex when preparing the dsRNA of the present invention. One selected element, the meaningful sequence, may be SEQ ID NO:932 (as shown in Table 2), while the other selected element, the antisense sequence, may be SEQ ID NO:1163, or may be SEQ ID NO:1163 modified, shortened, lengthened, and / or including one, two, or three substitutions compared to its parent sequence SEQ ID NO:1163. It should be understood that the double strands of this invention do not necessarily include both the meaningful and antisense sequences shown in pairs in Tables 1-3. Each meaningful and antisense strand sequence in the table is immediately followed by its SEQ ID NO.

[0118] Some embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or administered to a subject. For example, the antisense strand listed in any of the tables in Tables 1-3 may be a composition or a composition administered to a subject to reduce CFB peptide activity and / or CFB gene expression in the subject. Table 1 shows the core extension base sequences of the antisense and sense strands of certain CFB dsRNA agents. Single-stranded antisense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as “single-stranded antisense agents” or “antisense polynucleotide agents”. Single-stranded sense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as “single-stranded sense agents” or “sense polynucleotide agents”. The term “base sequence” is used herein to refer to a polynucleotide sequence that is not chemically modified or delivers a compound. For example, the sense chain GACAAUGUGAGUGAUGAGAUA (SEQ ID NO:22) shown in Table 1 is the base sequence of SEQ ID NO:946 in Table 2 and SEQ ID NO:1393 in Table 3, where SEQ ID NO:946 and SEQ ID NO:1393 show their chemical modifications and delivery compounds. The sequences disclosed herein can be assigned identifiers. For example, a single-stranded sense sequence can be identified as “sense chain SS#”; a single-stranded antisense sequence can be identified as “antisense chain AS#”; and a double-stranded sequence including both sense and antisense strands can be identified as “double-stranded AD# / AV#”.

[0119] Table 1 includes sense and antisense strands and provides identification numbers for duplexes formed by sense and antisense strands in the same row of Table 1. In some embodiments of the invention, the antisense sequence includes nucleobase u or nucleobase a at antisense sequence position 1. In some embodiments of the invention, the antisense sequence includes nucleobase u at antisense sequence position 1. As used herein, the term "matching position" in sense and antisense strands refers to the "paired" position in each strand when the two strands are duplexes. For example, in a 21-nucleobase sense strand and a 21-nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase at position 21 of the antisense strand are at a "matching position". In yet another non-limiting example, in a 23-nucleobase sense strand and a 23-nucleobase antisense strand, nucleobase 2 of the sense strand and position 22 of the antisense strand are at a matching position. In yet another non-limiting example, in both an 18-base sense strand and an 18-base antisense strand, the base at position 1 of the sense strand and the base at position 18 of the antisense strand are matched, and the base 4 of the sense strand and the base 15 of the antisense strand are matched. Those skilled in the art know how to identify matched positions in sense and antisense strands that are or will be double-stranded and paired.

[0120] The last column in Table 1 represents the duplex AV#, which includes the meaningful and antisense sequences in the same row. For example, Table 1 discloses a duplex designated as Duplex AV02358.um, which includes the meaningful strand SEQ ID NO: 7 and the antisense strand SEQ ID NO: 469. Therefore, each row in Table 1 identifies a duplex of the present invention, and each duplex contains the meaningful and antisense sequences shown in the same row, wherein the identifier assigned to each duplex is displayed in the last column of that row.

[0121] In some embodiments of the method of the present invention, an RNAi agent comprising any one of the polynucleotide sequences shown in Tables 1-3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex comprising at least one base sequence listed in Table 1, including sequence modifications of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24. In some embodiments of the method of the present invention, an RNAi agent comprising any one of the polynucleotide sequences shown in Tables 1-3 is attached to a delivery molecule, a non-limiting example of which is a delivery compound comprising a GalNAc compound or a GLS-15* compound.

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141] Table 2 lists the antisense and sense strand sequences of certain chemically modified CFB RNAi agents of the present invention. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequences shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequences shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises the duplex identified in the first row of Table 2 and includes sequence modifications in the sense and antisense strand sequences shown in the third and sixth columns of the same row of Table 2, respectively. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be attached (also referred to herein as “attached to”) to compounds capable of delivering the RNAi agent to the cells and / or tissues of a subject. Non-limiting examples of delivery compounds that can be used in some embodiments of the present invention are compounds containing GalNAc or compounds containing GLS-15*. In Table 2, the first column represents the duplex AV# of the base sequences shown in Table 1. Table 2 discloses the duplex AV# and also shows the chemical modifications contained in the sense and antisense sequences of the duplex. For example, Table 1 shows the single-stranded base sequences SEQ ID NO:7 (sense) and SEQ ID NO:469 (antense), which together constitute a double-stranded sequence, identified as: double-stranded sequence AV#AV02358.um, while Table 2 lists the double-stranded sequence AV#AV02358. This indicates that the double-stranded sequences of SEQ ID NO:931 and SEQ ID NO:1162 respectively contain the base sequences of SEQ ID NO:7 and SEQ ID NO:469, but have the chemical modifications shown in the sense and antisense sequences in columns 3 and 6, respectively. The “sense sequence SS#” in column 2 of Table 2 is the assignment identifier for the sense sequence (including modifications) shown in column 3 of the same row. The “antense sequence AS#” in column 5 of Table 2 is the assignment identifier for the antisense sequence (including modifications) shown in column 6.

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151] Table 3 shows the antisense and sense strand sequences of certain chemically modified CFB RNAi agents of the present invention. In some embodiments of the method of the present invention, the RNAi agents shown in Table 3 are administered to cells and / or subjects. In some embodiments of the method of the present invention, RNAi agents having the polynucleotide sequences shown in Table 3 are administered to subjects. In some embodiments of the present invention, the RNAi agent administered to the subject comprises the double strand identified in the row of the first column of Table 3, and comprises the sequence modification and / or delivery compound shown in the sense strand of the third column and the antisense strand of the sixth column of the same row of Table 3, respectively. These sequences are used in certain in vivo assay studies described elsewhere herein. In some embodiments of the method of the present invention, the sequences shown in Table 3 may be attached (also referred to herein as “bound to”) to a compound for delivery, a non-limiting example of which is a GalNAc-containing compound, wherein the delivery compound is identified as “GLX-n” on the sense strand in the third column of Table 3. As used herein, “GLX-n” is used to denote a “GLS-n*” or “GLO-n” delivery compound (“X” can be “S” or “O”), while GLX-0 can be any “GLS-n*” or “GLO-n” delivery compound that can be attached to the 3' end of an oligonucleotide during synthesis. As used herein and shown in Table 3, “GLX-n” is used to indicate that the attached GalNAc-containing compound is any one of the following compounds: GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of which is provided elsewhere herein. Those skilled in the art will be able to prepare and use the dsRNA compounds of the present invention, wherein the attached delivery compound is any one of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16.The first column of Table 3 provides the duplexes AD# assigned to the sense and antisense sequences in that row. For example, duplex AD#AD01093 is a duplex with sense strand SEQ ID NO:1393 and antisense strand SEQ ID NO:1441. Each row in Table 3 provides one sense strand and one antisense strand, and discloses the duplexes of the sense and antisense strands shown. The “Sense strand SS#” in the second column of Table 3 is the assignment identifier for the sense sequence (including modifications) shown in the third column of the same row. The “Antisense strand AS#” in the fifth column of Table 3 is the assignment identifier for the antisense sequence (including modifications) shown in the sixth column. The identifiers for certain linked GalNAc-containing “GLO-n” or “GLS-n*” compounds are shown as GLS-5*, GLS-15*, or GLX-0, and it should be understood that another “GLO-n” or “GLS-n*” compound may be used instead of the compound shown as GLO-0, and the resulting compounds are included in the embodiments of the methods and / or compositions of the present invention.

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160] In some embodiments of the invention, the dsRNA (also referred to herein as a “double strand”) is the dsRNA disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a double strand comprising the sense strand sequence and the antisense strand sequence of that row. In addition to the double strands disclosed in Tables 1-3, it should be understood that in some embodiments, the double strands of the invention may comprise the sense and antisense sequences shown in Tables 1-3, which differ from the sequences shown in Tables 1-3 by zero, one, two, or three nucleotides. Thus, as a non-limiting example, in some embodiments, the antisense strand in the double strand of the invention may be SEQ ID NO: 484, 490, 497, 665, or 667, which respectively have nucleotides differing from those in SEQ ID 484, 490, 497, 665, or 667 by zero, one, two, or three nucleotides.

[0161] It should be understood that the sense and antisense sequences in the double-stranded RNA of the present invention can be selected independently. Therefore, the dsRNA of the present invention may include the sense and antisense strands of the double-stranded RNA disclosed in one row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the selected sense and antisense strands may include the sequences shown in Tables 1-3, but one or both of the sense and antisense strands may include 1, 2, 3, or more nucleobase substitutions from the parent sequence. In some embodiments, the selected sequence may be longer or shorter than its parent sequence. Therefore, the dsRNA agents included in the present invention may, but do not necessarily, include the exact sequences of the sense and antisense strand pairs disclosed as double-stranded RNAs in Tables 1-3.

[0162] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 of the antisense strand comprise a region complementary to the CFB RNA transcript, wherein the complementary region comprises at least 15 consecutive nucleotides differing from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally comprises a target ligand. In some cases, the region complementary to the CFB RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides differing from one of the antisense sequences listed in one of Tables 1-3 by no more than 3 nucleotides. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is at least substantially complementary to any of the target regions of SEQ ID NO: 1 and is provided in any of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is completely complementary to any of the target regions of SEQ ID NO: 1 and is provided in any of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense sequence listed in any of Tables 1-3, and the sense sequence is at least substantially complementary to the antisense sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense sequence listed in any of Tables 1-3, and the sense sequence is completely complementary to the antisense sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense sequence listed in any of Tables 1-3. Some embodiments of the dsRNA agent of the present invention comprise a sense sequence and an antisense sequence disclosed as a duplex in any of Tables 1-3. As described herein, it should be understood that the sense and antisense strands in the duplex of the present invention can be selected independently.

[0163] Mismatch

[0164] Those skilled in the art know that mismatches in dsRNA are tolerable for efficacy, especially mismatches in the terminal regions of dsRNA. Some mismatches are even more tolerable, for example, mismatches of the wobble base pairs G:U and A:C are tolerable for efficacy (Du et al., A systematic analysis of the silencing effects of anactive siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33(5):1671-7. Doi:10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33(11):3698). In some embodiments of the methods and compounds of the present invention, the CFB dsRNA agent may contain one or more mismatches with the CFB target sequence. In some embodiments, the CFB dsRNA agent of the present invention does not contain mismatches. In some embodiments, the CFB dsRNA agent of the present invention contains no more than one mismatch. In some embodiments, the CFB dsRNA agent of the present invention contains no more than two mismatches. In some embodiments, the CFB dsRNA agent of the present invention contains no more than three mismatches. In some embodiments of the present invention, the antisense strand of the CFB dsRNA agent contains mismatches with the CFB target sequence, and these mismatches are not located at the center of the complementary region. In some embodiments, the antisense strand of the CFB dsRNA agent contains 1, 2, 3, 4 or more mismatches, and these mismatches are located within the last 5, 4, 3, 2 or 1 nucleotides of one or both of the 5' or 3' ends of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether a CFB dsRNA agent containing mismatches with the CFB target sequence effectively inhibits the expression of the CFB gene.

[0165] Complementarity

[0166] As used herein, unless otherwise stated, the term "complementarity" when used to describe a first nucleotide sequence (e.g., a sense strand of a CFB dsRNA agent or targeting CFB mRNA) relative to a second nucleotide sequence (e.g., an antisense strand of a CFB dsRNA agent or a single-stranded antisense polynucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide comprising the second nucleotide sequence [forming base-pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)] and, under certain conditions, to form a double-stranded or double-helix structure. Other conditions, such as physiologically relevant conditions that may be encountered in vivo, may also apply. Those skilled in the art will be able to determine the set of conditions most suitable for testing the complementarity of the two sequences based on the final application of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, including native or modified nucleotides or nucleotide mimics, at least to the extent that the hybridization requirements described above are met. Sequence identity or complementarity is independent of modification.

[0167] Complementary sequences, for example, within the CFB dsRNA described herein, include oligonucleotides or polynucleotides comprising a first nucleotide sequence that pair with an oligonucleotide or polynucleotide comprising a second nucleotide sequence along the entire length of one or both nucleotide sequences. Such sequences may be referred to herein as “perfectly complementary” to each other. It should be understood that, in embodiments where two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs are not considered mismatches for the purposes of this complementarity determination. For example, a CFB dsRNA may contain one 19-nucleotide oligonucleotide and another 20-nucleotide oligonucleotide, wherein the longer oligonucleotide contains a 19-nucleotide sequence that is perfectly complementary to the shorter oligonucleotide, but may still be referred to as “perfectly complementary” for the purposes described herein. Thus, “perfectly complementary” as used herein means that all (100%) bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. The sequential sequence may include all or part of the first or second nucleotide sequence.

[0168] As used herein, the term "substantially complementary" means that in the hybridized nucleobase sequence pairs, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but not all, of the bases in the first polynucleotide sequence will hybridize with the same number of bases in the second polynucleotide sequence. The term "substantially complementary" can also be used to refer to a first sequence relative to a second sequence, such as a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) in length, where the two sequences after hybridization include one or more, for example, at least 1, 2, 3, 4, or 5 mismatched base pairs, while retaining hybridization capacity under conditions most relevant to its final application, such as repressing CFB gene expression via a RISC pathway.

[0169] The term "partial complementarity" may be used herein to refer to hybridized nucleobase sequence pairs in which at least 75% (but not all) of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. In some embodiments, "partial complementarity" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide.

[0170] As used herein, the terms “complementary,” “fully complementary,” “fundamentally complementary,” and “partially complementary” refer to base matching between the sense and antisense strands of a CFB dsRNA agent, between the antisense strand of a CFB dsRNA agent and the target CFB mRNA sequence, or between a single-stranded antisense oligonucleotide and the target CFB mRNA sequence. It should be understood that the term “antisense strand of a CFB dsRNA agent” can refer to the same sequence as a “CFB antisense polynucleotide agent.”

[0171] As used herein, the terms "substantially identical" or "substantially identical" for nucleic acid sequences refer to sequences containing at least about 85% sequence identity or higher, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% compared to a reference sequence. The percentage of sequence identity is determined by comparing two best-aligned sequences within a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same nucleic acid bases occur, resulting in a number of matching positions. This number of matching positions is divided by the total number of positions in the comparison window, and then multiplied by the result and divided by 100 to obtain the percentage of sequence identity. The invention disclosed herein covers nucleotide sequences that are substantially identical to those disclosed herein, such as those in Tables 1-3. In some embodiments, the sequences disclosed herein are identical, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to those disclosed herein, for example, in Tables 1-3.

[0172] As used herein, the term "chain containing a sequence" means an oligonucleotide containing a nucleotide chain described by a sequence referenced using standard nucleotide nomenclature. As used herein, the term "double-stranded RNA" or "dsRNA" refers to an RNAi comprising an RNA molecule or molecular complex having a hybrid double-stranded region comprising two antiparallel and substantially or completely complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to the target CFB RNA. The double-stranded region can be of any length allowing for specific degradation of the desired target CFB RNA via a RISC pathway, but is typically in the range of 9 to 30 base pairs, for example, 15–30 base pairs in length. Considering double strands between 9 and 30 base pairs, the double strand can be of any length within this range, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any subranges thereof, including but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 1... 8-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. CFB dsRNA reagents produced in cells by treatment with Dicer and similar enzymes are typically 19–22 base pairs in length. One strand of the duplex region of the CFB dsRNA reagent contains a sequence substantially complementary to the region of the target CFB RNA. The two strands forming the duplex structure can originate from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. When the duplex region is formed from the two strands of a single molecule, the molecule may have a duplex region separated by a single-stranded nucleotide chain (referred to herein as a “hairpin loop”) between the 3’ end of one strand forming the duplex structure and the 5’ end of the corresponding other strand.In some embodiments of the invention, the hairpin loop comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two substantially complementary strands of a CFB dsRNA agent consist of separate RNA molecules, these molecules do not need to be, but can be, covalently linked. When the two strands are covalently linked in a manner other than a hairpin loop, the linking structure is referred to as a “connector.” The term “siRNA” is also used herein to refer to the dsRNA agent described herein.

[0173] In some embodiments of the present invention, the CFB dsRNA agent may include sense and antisense sequences having unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent. Ends without unpaired nucleotides are referred to as "blunt ends" and have no nucleotide overhangs. If both ends of the dsRNA agent are blunt, the dsRNA is referred to as "blunt-end". In some embodiments of the present invention, the first end of the dsRNA agent is blunt; in some embodiments, the second end of the dsRNA agent is blunt; and in some embodiments of the present invention, both ends of the CFB dsRNA agent are blunt.

[0174] In some embodiments of the dsRNA reagent of the present invention, the dsRNA does not have one or two blunt ends. In this case, the end of the dsRNA reagent strand has at least one unpaired nucleotide. For example, a nucleotide overhang is present when the 3' end of one strand of the dsRNA extends beyond the 5' end of another strand, or vice versa. The dsRNA may contain at least 1, 2, 3, 4, 5, 6 or more nucleotide overhangs. The nucleotide overhangs may comprise or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). It should be understood that in some embodiments, the nucleotide overhang is located on the sense strand of the dsRNA reagent, on the antisense strand of the dsRNA reagent, or at both ends of the dsRNA reagent, and the nucleotide of the overhang may be present at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the dsRNA. In some embodiments of the present invention, one or more nucleotides in the overhang are replaced by nucleoside phosphate thioesters.

[0175] As used herein, the terms "antisense strand" or "guide strand" refer to the strand of a CFB dsRNA agent that includes regions substantially complementary to the CFB target sequence. The terms "sense strand" or "passenger strand" refer to the strand of a CFB dsRNA agent that includes regions substantially complementary to the antisense strand region of the CFB dsRNA agent.

[0176] Modification

[0177] In some embodiments of the invention, the RNA of the CFB RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in some embodiments of the invention can be synthesized and / or modified by methods well established in the art, for example, in “Current protocols in Nucleic Acid Chemistry,” Beaucage, S. Letal. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in certain embodiments of the CFB dsRNA agent of the present invention include, for example, (a) terminal modifications, such as 5' end modifications (phosphorylation, conjugation, reverse linkage, etc.), 3' end modifications (conjugation, DNA nucleotides, reverse linkage, etc.); (b) base modifications, base substitution with a stable base, a destabilized base, or a base pair having an extended repertoire of partners, base removal (de-base nucleotides), or conjugated bases; (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitution; and (d) backbone modifications, including modification or substitution of phosphodiester bonds. Specific examples of RNA compounds that may be used in certain embodiments of the CFB dsRNA agent, CFB antisense polynucleotide, and CFB sense polynucleotide of the present invention include, but are not limited to, RNA containing a modified backbone or RNA without natural nucleoside internucleotide bonds. As a non-limiting example, RNA with a modified backbone may not have phosphorus atoms in its backbone. RNA whose nucleoside internucleotide backbone does not have phosphorus atoms may be called oligonucleotides. In some embodiments of the present invention, the modified RNA has phosphorus atoms in its internucleotide backbone.

[0178] It should be understood that the terms "RNA molecule" or "RNA" or "ribonucleic acid molecule" not only cover RNA molecules expressed or found in nature, but also include RNA analogs and derivatives containing one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules may be modified in their nucleobase structure or ribose-phosphate backbone structure, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double strands. As a non-limiting example, RNA molecules may also include at least one modified ribonucleoside, including but not limited to 2'-O-methyl modified nucleosides, nucleosides containing a 5'-thiophosphate group, terminal nucleosides linked to a cholesterol derivative or a dodecanoic acid bis(decanoic acid) group, locked nucleosides, debased nucleosides, 2'-deoxy-2'-fluorinated nucleosides, 2'-amino modified nucleosides, 2'-alkyl modified nucleosides, morpholino nucleosides, aminophosphates, or nucleosides containing non-natural bases, or any combination thereof. In some embodiments of the invention, the RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more full-length CFBds RNA molecule ribonucleotides, which are modified ribonucleotides. The modifications of each of these plurality of modified ribonucleotides in the RNA molecule need not be identical.

[0179] In some embodiments, the dsRNA agents, CFB antisense polynucleotides, and / or CFB sense polynucleotides of the present invention may comprise one or more independently selected modifying nucleotides and / or one or more independently selected nonphosphodiester bonds. Hereinafter, the term “independently selected” to refer to selected elements (e.g., modifying nucleotides, nonphosphodiester bonds, etc.) means that two or more selected elements may, but need not, be identical to each other.

[0180] As used herein, “nucleotide base,” “nucleotide,” or “nucleobase” refers to heterocyclic pyrimidine or purine compounds, which are standard components of all nucleic acids and include the nucleotides adenine, guanine, cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not intended to limit, universal bases, hydrophobic bases, hybrid bases, size-enhanced bases, and fluorinated bases. The terms “ribonucleotide” or “nucleotide” may be used herein to refer to an unmodified nucleotide, a modified nucleotide, or a substitute moiety. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil may be substituted with other moieties without substantially altering the base-pairing properties of the oligonucleotide containing the nucleotide with such a substitution moiety.

[0181] In one embodiment, the modified RNA considered for use in the methods and compositions described herein is a peptide nucleic acid (PNA) that has the ability to form the desired double-stranded structure and allows or mediates the specific degradation of the target RNA via a RISC pathway. In some embodiments of the invention, the CFB RNA disruptor comprises a single-stranded RNA that interacts with the target CFB RNA sequence to guide the cleavage of the target CFB RNA.

[0182] The modified RNA backbone may include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonates, including 3'-alkylene phosphonates and chiral phosphonates, hypophosphonates, aminophosphates, including 3'-aminoaminophosphates and aminoalkylaminophosphates, thioaminophosphates, thioalkylphosphonates with normal 3'-5' linkages, thioalkyl phosphate triesters and borophosphates, 2'-5' linkage analogs of these, and those with reverse polarity, wherein adjacent nucleoside unit pairs are linked at 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. Methods for preparing phosphorus-linked RNAs are conventional practices in the art, and such methods can be used to prepare certain modified CFB dsRNA reagents, certain modified CFB antisense polynucleotides, and / or certain modified CFB sense polynucleotides of the present invention.

[0183] The phosphorus-free modified RNA backbone has a backbone formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatoms or heterocyclic nucleoside bonds. These include backbones with morpholine bonds (partially formed by the sugar moiety of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formyl and thioformyl backbones; methyleneformyl and thioformyl backbones; olefin-containing backbones; aminosulfonate backbones; methyleneimino and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and other backbones with mixed N, O, S, and CH2 components. Methods for preparing phosphorus-free modified RNA backbones are conventional in the art, and such methods can be used to prepare certain modified CFB dsRNA agents, certain modified CFB antisense polynucleotides, and / or certain modified CFB sense polynucleotides of the present invention.

[0184] In some embodiments of the invention, RNA mimics are included in CFB dsRNA, CFB antisense polynucleotides, and / or CFB sense polynucleotides, for example, but not limited to, replacing the sugar and nucleoside bonds of the nucleotide units, i.e., the backbone, with novel groups. In such embodiments, the base units are retained to hybridize with suitable CFB nucleic acid target compounds. One such oligomeric compound, an RNA mimic that has shown excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. Nucleobases are retained and bind directly or indirectly to the aza-nitrogen atoms of the amide moiety of the backbone. Methods for preparing RNA mimics are conventional practice in the art, and such methods can be used to prepare certain modified CFB dsRNA agents of the present invention.

[0185] Some embodiments of the present invention include RNA having a phosphate thioester backbone and oligonucleotides having a heteroatom backbone, and particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as methylene (methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- [wherein the natural phosphodiester backbone is represented as -OPO-CH2-]. Methods for preparing RNA having a phosphate thioester backbone and oligonucleotides having a heteroatom backbone are conventional practices in the art, and such methods can be used to prepare certain modified CFB dsRNA reagents, certain CFB antisense polynucleotides, and / or certain CFB sense polynucleotides of the present invention.

[0186] The modified RNA may also contain one or more substituted sugar moieties. The CFB dsRNA, CFB antisense polynucleotide, and / or CFB sense polynucleotide of the present invention may contain one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl groups may be substituted or unsubstituted C1 to C2 groups. 10 Alkyl or C2 to C 10 Alkenyl and ynyl groups. Exemplary suitable modifications include O[(CH2)] n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) nCH3)]2, where n and m are 1 to about 10. In other embodiments, the dsRNA at the 2' position includes one of the following: C1 to C 10 Lower alkyl groups, substituted lower alkyl groups, alkylaryl groups, aryl alkyl groups, O-alkylaryl or O-aryl alkyl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclic alkyl groups, heterocyclic alkylaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleaving groups, reporter groups, intercalating agents, groups used to improve the pharmacokinetic properties of CFB dsRNA agents, or groups used to improve the pharmacodynamic properties of CFB dsRNA agents, CFB antisense polynucleotides and / or CFB sense polynucleotides, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., alkoxy-alkoxy. Another exemplary modification is 2'-dimethylaminoethoxyethoxy, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in the examples below, and 2'-dimethylaminoethoxyethoxy (also known as 2'-dimethylaminoethoxyethoxy) (also known as 2'-DMAOE). It is referred to in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Methods for preparing modified RNA, such as those described, are conventional practices in the art, and such methods can be used to prepare certain modified CFB dsRNA agents of the present invention.

[0187] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluorine (2'-F). Similar modifications can also be made at other positions on the RNA of the CFB dsRNA reagents, CFB antisense polynucleotides, and / or CFB sense polynucleotides of the present invention, particularly at the 3' position of the sugar on the 3' terminal nucleotide or at the 2'-5' linked CFB dsRNA, CFB antisense polynucleotide, or CFB sense polynucleotide, and at the 5' position of the 5' terminal nucleotide. The CFB dsRNA reagents, CFB antisense polynucleotides, and / or CFB sense polynucleotides may also have a sugar mimic, such as replacing the cyclobutyl moiety of the furanylpentose sugar. Methods for preparing modified RNA, such as those described, are conventional practice in the art, and such methods can be used to prepare certain modified CFB dsRNA reagents, CFB antisense polynucleotides, and / or CFB sense polynucleotides of the present invention.

[0188] In some embodiments, the CFB dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide may include nucleobase (generally referred to in the art simply as "base") modification or substitution. As used herein, "unmodified" or "natural" nucleobases include purine bases adenine and guanine, and pyrimidine bases thymine, cytosine, and uracil. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halogenated uracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, and cytosine. And thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyaldehyde, other 8-substituted adenine and guanine, 5-halogenated, especially 5-bromine, 5-trifluoromethyl and other 5-substituted uracil, cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-azaadenine, and 3-deadenine and 3-deadenine. Additional nucleobases that may be included in certain embodiments of the CFB dsRNA agent of the present invention are known in the art, see, for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P.Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science and Engineering, pages 858-859, Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, Stan Lebleu, B., Ed., CRC Press, 1993.Methods for preparing dsRNAs, CFB antisense polynucleotides, and / or CFB sense polynucleotides containing nucleobase modifications and / or substitutions (such as those described herein) are conventional practices in the art, and such methods may be used to prepare certain modified CFB dsRNA reagents, CFB sense polynucleotides, and / or CFB antisense polynucleotides of the present invention.

[0189] Some embodiments of the CFB dsRNA agents, CFB antisense polynucleotides, and / or CFB sense polynucleotides of the present invention comprise RNA modified to contain one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety containing an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-inner structural conformation. Adding locked nucleic acids to the CFB dsRNA agents, CFB antisense polynucleotides, and / or CFB sense polynucleotides of the present invention increases stability in serum and reduces off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for preparing dsRNA agents containing locked nucleic acids, CFB antisense polynucleotides, and / or CFB sense polynucleotides are conventional practices in the art, and such methods can be used to prepare certain modified CFB dsRNA agents of the present invention.

[0190] Certain embodiments of the CFB dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the present invention comprise at least one modified nucleotide, wherein said at least one modified nucleotide comprises: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seco nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide comprising a 5'-phosphothioester group, nucleotide comprising a vinylphosphonate, or comprising... Nucleotides of adenosine-glycol nucleic acid (GNA), nucleotides containing the S-isomer of thymidine-glycol nucleic acid (GNA), nucleotides containing 2'-deoxythymidine-3' phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, nucleotides containing 2'-deoxyadenosine-3'-phosphate, nucleotides containing 2'-deoxycytidine-3'-phosphate, nucleotides containing 2'-deoxyuridine-3'-phosphate, or terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bis(decanoic acid) amide group, 2'-amino-modified nucleotides, aminophosphates, or nucleotides containing non-natural bases. In some embodiments, the CFB dsRNA compound contains an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0191] Some embodiments of the CFB dsRNA compounds of the present invention, the 3' and 5' ends of sense polynucleotides and / or the 3' end of antisense polynucleotides, include at least one modified nucleotide, wherein the at least one modified nucleotide includes: debased nucleotide, ribitol, inverted nucleotide, inverted debased nucleotide, inverted 2'-OMe nucleotide, inverted 2'-deoxy nucleotide. It is known to those skilled in the art that including a debased or inverted debased nucleotides at the ends of oligonucleotides can enhance stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31(11):2705-2716).

[0192] doi:10.1093 / nar / gkg393). In some embodiments, the CFB dsRNA compound contains one or more invab residues at the 3' or 5' end, or both the 3' and 5' ends. Exemplary invab residues include, but are not limited to, the following:

[0193]

[0194] Certain embodiments of the CFB dsRNA compound, 3' and 5' sense polynucleotides, and / or 3' antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: an isomannitol residue or a stereoisomer of said isomannitol residue. Specific examples of isomannitol residues or stereoisomers of said isomannitol residues include, but are not limited to:

[0195]

[0196] Among the phrases

[0197] Each "Olig" independently represents a polynucleotide moiety. Exemplary isomannose residues (imann) include, but are not limited to, those listed below.

[0198] As follows:

[0199] or

[0200] In some embodiments, isomannoside nucleotides may also be conjugated to one or more targeting groups or delivery molecules, such as the GalNAc moiety.

[0201] CFB dsRNA compounds and certain embodiments of the antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide comprises an unlocked nucleic acid nucleotide (UNA) and / or a glycol nucleic acid nucleotide (GNA). It is known to those skilled in the art that UNA and GNA are thermally unstable chemical modifications that can significantly improve the off-target profile of siRNA compounds (Janas et al., Selection of GalNAc-conjugate siRNAs with limit off-target-driven rat. Nat Commun. 2018; 9(1):723. doi:10.1038 / s41467-018-02989-4; Laursen et al., Enhancing in vitro and in vivo performance of siRNAs using unlocked nucleic acids (UNA). Mol BioSyst. 2010; 6:862–70).

[0202] Another modification that may be included in the RNA of certain embodiments of the CFB dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide of the present invention includes chemically linking one or more ligands, portions, or conjugates to the RNA, said ligands, portions, or conjugates enhancing one or more features of the CFB dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide, respectively. Non-limiting examples of features that may be enhanced include: activity of the CFB dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide; cellular distribution; delivery of the CFB dsRNA agent; pharmacokinetic properties of the CFB dsRNA agent; and cellular uptake of the CFB dsRNA agent. In some embodiments of the present invention, the CFB dsRNA agent comprises one or more targeting groups or linking groups, which, in certain embodiments of the CFB dsRNA agent of the present invention, are conjugated to the sense strand. Non-limiting examples of targeting groups are compounds comprising N-acetyl-galactosamine (GalNAc). The terms “targeting group,” “targeting agent,” “linker,” “targeting compound,” “delivery molecule,” “delivery compound,” and “targeting ligand” are used interchangeably herein. In some embodiments of the invention, the CFB dsRNA agent comprises a targeting compound conjugated to the 5' end of the sense strand. In some embodiments of the invention, the CFB dsRNA agent comprises a targeting compound conjugated to the 3' end of the sense strand. In some embodiments of the invention, the CFB dsRNA agent comprises a targeting group containing GalNAc. In some embodiments of the invention, the CFB dsRNA agent does not include a targeting compound conjugated to one or both of the 3' and 5' ends of the sense strand. In some embodiments of the invention, the CFB dsRNA agent does not include a GalNAc-containing targeting compound conjugated to one or both of the 5' and 3' ends of the sense strand.

[0203] Other targeting agents and linkers are well known in the art. For example, targeting agents and linkers that can be used in certain embodiments of the present invention include, but are not limited to, lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. USA, 1989, 86: 6553-6556), bile acids (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060), thioethers, such as beryl-S-triphenylmethylthiol (Manoharan et al., Ann. NYAcad. Sci., 1992, 660: 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3: 2765-2770), and a type of thiocholesterol (Oberhauser et al., Nucl. Acids). Res., 1992, 20:533-538), aliphatic chains, such as dodecyl glycol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, such as di-hexadecyl-racemic-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemic-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973) or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmitic moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0204] Some embodiments of compositions comprising CFB dsRNA agents, CFB antisense polynucleotides, and / or CFB sense polynucleotides may include ligands that alter the distribution, targeting, etc., of the CFB dsRNA agent. In some embodiments of compositions comprising the CFB dsRNA agent of the present invention, the ligand increases affinity for selected targets (e.g., molecules, cells or cell types, compartments, such as cell or organ compartments, tissues, organs, or body regions) compared to species where such ligands are absent. Ligands that can be used in the compositions and / or methods of the present invention can be naturally occurring substances, such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazene. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide polyamines, peptide mimicry polyamines, dendritic polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.

[0205] The ligands included in the compositions and / or methods of the present invention may contain a targeting group, non-limiting examples of which are cell or tissue targets, such as lectins, glycoproteins, lipids, or proteins, such as antibodies that bind to specific cell types (e.g., kidney cells or hepatocytes). The targeting group may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polylactose, polygalactose, N-acetylgalactosamine, N-acetylglucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.

[0206] Other examples of ligands include dyes, intercalators (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, tecosafrine, safeline), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol, bile acids, adamantine, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O-hexadecylglycerol, geranyoxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)lithocholic acid, etc. Cholestyric acid, dimethoxytriphenylmethyl or phenoxazine) and peptide conjugates (e.g., tentacledopod peptide, Tat peptide), alkylating agents, phosphates, amino groups, thiol groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled substances, enzymes, haptens (e.g., biotin), transport / absorption promoters (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, diimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraza macrocyclic Eu3+ complexes), dinitrophenyl, HRP or AP.

[0207] The ligands included in the compositions and / or methods of the present invention may be proteins, such as glycoproteins or peptides, molecules having a specific affinity for an accessory ligand, or antibodies, such as antibodies that bind to a specific cell type (e.g., cancer cells, endothelial cells, cardiomyocytes, or osteocytes). Useful ligands in embodiments of the compositions and / or methods of the present invention may be hormones or hormone receptors. Useful ligands in embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, or polyvalent fucose. Useful ligands in embodiments of the compositions and / or methods of the present invention may be substances capable of increasing the entry of CFB dsRNA agents into cells, for example, by disrupting the cellular cytoskeleton, for example, by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of this type of drug are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.

[0208] In some embodiments, the ligand linked to the CFB dsRNA agent of the present invention serves as a pharmacokinetic (PK) modulator. Examples of PK modulators that can be used in the compositions and methods of the present invention include, but are not limited to: lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholic acids, lithocholic acids, dialkyl glycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, aptamers that bind serum proteins, etc. Oligonucleotides containing a large number of thiophosphate bonds are also known to bind serum proteins; therefore, short oligonucleotides (e.g., oligonucleotides of about 5, 10, 15, or 20 bases) containing multiple thiophosphate bonds in their main chain can also be used as ligands in the compositions and / or methods of the present invention.

[0209] CFB dsRNA agent composition

[0210] In some embodiments of the invention, a CFB dsRNA agent is present in the composition. The compositions of the invention may include one or more CFB dsRNA agents, and optionally one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable markers, etc. Non-limiting examples of potentially useful targeting agents according to some embodiments of the method of the invention are agents that direct the CFB dsRNA agent of the invention to cells to be treated and / or to cells to be treated. The choice of targeting agent will depend on factors such as the nature of the CFB-related disease or condition and the type of cells to be targeted. In a non-limiting example, in some embodiments of the invention, it may be desirable to direct the CFB dsRNA agent to hepatocytes and / or to hepatocytes. It should be understood that in some embodiments of the method of the invention, the therapeutic agent comprises a CFB dsRNA agent having only a delivery agent, such as a delivery agent containing N-acetylgalactosamine (GalNAc), without any additional elements. For example, in some aspects of the invention, the CFB dsRNA agent can be linked to a delivery compound containing GalNAc and contained in a composition containing a pharmaceutically acceptable carrier and administered to cells or subjects without requiring any detectable marker or target to be linked to the CFB dsRNA agent.

[0211] When the CFB dsRNA agent of the present invention is applied together with and / or attached to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will understand and be able to select and use agents suitable for the methods of the present invention. Labeling agents can be used in certain methods of the present invention to determine the location of the CFB dsRNA agent in cells and tissues, and can be used to determine the location of cells, tissues, or organs containing a therapeutic composition having been applied in the methods of the present invention. Procedures for attaching and using labeling agents (e.g., enzyme labeling, dyes, radiolabeling, etc.) are well known in the art. It should be understood that in some embodiments of the compositions and methods of the present invention, the labeling agent is attached to one or both of the sense polynucleotides and antisense polynucleotides contained in the CFB dsRNA agent.

[0212] Delivery of CFB dsRNA reagent and CFB antisense polynucleotide reagent

[0213] Some embodiments of the method of the present invention include delivering a CFB dsRNA agent into cells. As used herein, the term "delivery" means promoting or influencing cellular uptake or absorption. Absorption or uptake of the CFB dsRNA agent can occur through independent diffusion or active cellular processes, or through the use of a delivery agent, targeting agent, etc., that can be associated with the CFB dsRNA agent of the present invention. Delivery methods suitable for the method of the present invention include, but are not limited to, in vivo delivery, wherein the CFB dsRNA agent is injected into a tissue site or administered systemically. In some embodiments of the present invention, the CFB dsRNA agent is linked to a delivery agent.

[0214] Non-limiting examples of methods that can be used to deliver CFB dsRNA agents to cells, tissues, and / or subjects include: CFB dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in the art to deliver therapeutic RNAi agents for the treatment of a variety of diseases and conditions, such as, but not limited to, liver disease, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, etc. Details of the various delivery methods can be found in the following publications: Nikam, RR & K.R. Gore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018; Springer AD & S.F. Dowdy (2018) Nucleic Acid Ther. Jun1; 28(3): 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; and Nair, J.K. et al., (2014) J.Am.Chem.Soc.136: 16958-16961, all of which are incorporated herein by reference.

[0215] Some embodiments of the present invention include the delivery of the CFB dsRNA agent of the present invention to cells, tissues, and / or subjects using lipid nanoparticles (LNPs). LNPs are commonly used for in vivo delivery of CFB dsRNA agents, including therapeutic CFB dsRNA agents. One advantage of using LNPs or other delivery agents is that the stability of the CFB RNA agent is increased when delivered to a subject using LNPs or other delivery agents. In some embodiments of the present invention, the LNP comprises a cationic LNP carrying one or more CFB RNAi molecules of the present invention. When an LNP containing CFB RNAi molecules is administered to a subject, the LNP and its attached CFB RNAi molecules are absorbed by cells via endocytosis, and their presence leads to the release of RNAi-triggered molecules, thereby mediating RNAi.

[0216] Another non-limiting example of a delivery agent that can be used in embodiments of the invention to deliver the CFB dsRNA agent of the invention to cells, tissues, and / or subjects is a reagent containing GalNAc, which is attached to the CFB dsRNA agent of the invention and to deliver the CFB dsRNA agent to cells, tissues, and / or subjects. Examples of certain additional delivery agents containing GalNAc that can be used in certain embodiments of the methods and compositions of the invention are disclosed in PCT application: WO2020191183A1 (the entire contents of which are incorporated herein). Non-limiting examples of GalNAc targeting ligands that can be used in the compositions and methods of the invention to deliver the CFB dsRNA agent to cells are targeting ligand clusters. Examples of targeting ligand clusters presented herein are referred to as: GalNAc ligands having a phosphodiester linkage (GLO) and GalNAc ligands having a phosphate thioester linkage (GLS). The term "GLX-n" may be used herein to indicate that the GalNAc-containing compound being linked is any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, each with the structure shown below, wherein the GalNAc targeting ligand is linked to the RNAi agent of the present invention at the rightmost position (using...) of each. (Shown). It should be understood that any RNAi and dsRNA molecules of the present invention can attach to GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The structures of GLO-1 to GLO-16 and GLS-1* to GLS-16* are shown below.

[0217]

[0218]

[0219]

[0220]

[0221] In some embodiments, the aforementioned isomannonucleotide may also be conjugated to one or more GalNAc targeting ligands. Specific examples of isomannonucleotides conjugated to GalNAc targeting ligands include, but are not limited to: The phrase “olig” refers to each polynucleotide portion independently.

[0222] In some embodiments of the invention, in vivo delivery can also be performed via β-glucan delivery systems, such as those described in U.S. Patent No. 5,100,000. The entire contents of U.S. Patent Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005 / 0281781 are incorporated herein by reference. CFB RNAi agents can also be introduced into cells in vitro using methods known in the art, such as electroporation and lipid transfection. In some embodiments of the methods of the invention, CFB dsRNA is delivered without a target agent. These RNAs can be delivered as “naked” RNA molecules. As a non-limiting example, the CFB dsRNA of the invention can be administered to a subject in a pharmaceutical composition containing but not containing an RNAi agent to treat the subject’s CFB-related disease or condition, such as cardiovascular disease. Target agents, such as GalNAc targeting compounds, are also possible.

[0223] In addition to certain delivery methods described herein, it should be understood that RNAi delivery methods, such as, but not limited to, those described herein and those used in the art, may be used in conjunction with implementation schemes of the CFB RNAi agents and treatment methods described herein.

[0224] The CFB dsRNA reagent of the present invention can be administered to subjects in a quantity and manner that effectively reduces the level and activity of CFB peptides in cells and / or subjects. In some embodiments of the method of the present invention, one or more CFB dsRNA reagents are administered to cells and / or subjects to treat diseases or conditions associated with CFB expression and activity. In some embodiments, the method of the present invention includes administering one or more CFB dsRNA reagents to subjects requiring such treatment to reduce diseases or conditions associated with CFB expression in the subject. The CFB dsRNA reagent or CFB antisense polynucleotide reagent of the present invention can be administered to reduce CFB expression and / or activity in one or more cells in vitro, ex vivo, and in vivo.

[0225] In some embodiments of the invention, the level of CFB peptides in cells is reduced, and thus their activity is decreased, by delivering (e.g., introducing) a CFB dsRNA agent or a CFB antisense polynucleotide agent into cells. Targeting agents and methods can be used to facilitate the delivery of a CFB dsRNA agent or a CFB antisense polynucleotide agent to specific cell types, cell subtypes, organs, spatial regions, and / or intracellular subcellular regions within a subject. The CFB dsRNA agent can be administered alone or in combination with one or more additional CFB dsRNA agents in certain methods of the invention. In some embodiments, two, three, four, or more independently selected CFB dsRNA agents are administered to the subject.

[0226] In some embodiments of the invention, a CFB dsRNA agent is administered to a subject in combination with one or more additional treatment regimens for treating CFB-related diseases or conditions. Non-limiting examples of additional treatment regimens include: administration of one or more of the CFB antisense polynucleotides of the invention, administration of a non-CFB dsRNA therapeutic agent, and behavioral modification. Additional treatment regimens may be administered before, simultaneously with, and after administration of the CFB dsRNA agent of the invention at one or more times. It should be understood that, as used herein, "zero time" refers to the time during which the CFB dsRNA agent of the invention is administered to the subject within five minutes, ten minutes, 30 minutes, 45 minutes, and 60 minutes of zero time. Non-limiting examples of non-CFB dsRNA therapeutic agents include: C5 inhibitors, such as anti-complement component C5 antibodies or their antigen-binding fragments (e.g., eculizumab, ravulizumab-cwvz, or polzalimab (REGN3918)) or C5 inhibitor peptide inhibitors (e.g., zilucoplan). Eculizumab is a humanized monoclonal IgG2 / 4, kappa light chain antibody that binds specifically to complement component C5 with high affinity and inhibits the cleavage of C5 into C5a and C5b, thereby inhibiting the formation of the terminal complement complex C5b-9. Ravulizumab-cwvz is a humanized IgG2 / 4 monoclonal antibody that binds specifically to complement component C5 with high affinity and inhibits the cleavage of C5 into C5a and C5b, thereby inhibiting the formation of the terminal complement complex C5b-9. Pozelimab (also known as H4H12166P, described in US20170355757) is a fully human IgG4 monoclonal antibody designed to block complement factor C5. Zilucoplan is a synthetic macrocyclic peptide that binds to complement component 5 (C5) with sub-nanomolar affinity and, upon activation via the classical, alternative, or lectin pathway, allosterically inhibits its cleavage into C5a and C5b. Preferably, an additional therapeutic agent is a C3 peptide inhibitor or an analogue thereof. In one embodiment, the C3 peptide inhibitor is campstatin. Compstatin is a cyclic decacyclic peptide with potent and selective C3 inhibitory activity. These and other therapeutic agents and behavioral modifiers are known in the art and are used to treat CFB-related diseases or conditions in subjects and can be administered to subjects in combination with one or more CFB dsRNA agents of the present invention to treat CFB-related diseases or conditions. The CFB dsRNA agents of the present invention administered to cells or subjects to treat CFB-related diseases or conditions can act synergistically with one or more other therapeutic agents or activities and increase the effectiveness of said one or more therapeutic agents or activities and / or increase the effectiveness of the CFB dsRNA agents in treating CFB-related diseases or conditions.

[0227] The treatment methods of the present invention include the administration of a CFB dsRNA agent, which may be used before the onset of and / or while the CFB-related disease or condition is present, including the early, middle, and late stages of the disease or condition, and all times before and after these stages. The methods of the present invention can also be used to treat subjects who have previously been treated with one or more other therapeutic agents and / or treatment activities that have been unsuccessful, had a low success rate, and / or are no longer successful in treating the subject's CFB-related disease or condition.

[0228] vector-encoded dsRNA

[0229] In some embodiments of the invention, a vector can be used to deliver a CFB dsRNA agent into cells. The CFB dsRNA agent transcription unit can be contained in a DNA or RNA vector. The preparation and use of such vectors encoding transgenes for the delivery of sequences to cells and / or subjects are well known in the art. Vectors can be used in the methods of the invention to result in transient expression of CFB dsRNA, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or longer. The length of transient expression can be determined using conventional factor-based methods, factors such as, but not limited to, the selected specific vector construct and the target cells and / or tissues. Such transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrated or non-integrated vectors. Transgenes can also be constructed to allow their inheritance as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0230] The single-stranded or multi-stranded CFB dsRNA agent can be transcribed from a promoter on an expression vector. When expressing two separate strands to produce, for example, dsRNA, two separate expression vectors can be co-introduced into the cell using methods such as transfection or infection. In some embodiments, each separate strand of the CFB dsRNA agent of the present invention can be transcribed from a promoter contained on the same expression vector. In some embodiments of the present invention, the CFB dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence, such that the CFB dsRNA agent has a stem and loop structure.

[0231] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. The expression vectors useful in the embodiments of the present invention can be compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from many commercial sources. Delivery of the CFB dsRNA expression vector can be systemic, such as by intravenous or intramuscular administration, by administration to target cells removed from the subject and then reintroduced into the subject, or by any other means that allows for the introduction of the desired target cells.

[0232] Viral vector systems that may be included in embodiments of this method include, but are not limited to: (a) adenovirus vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) piconemavirus vectors; (i) poxvirus vectors, such as orthopoxvirus vectors or fowlpoxvirus vectors, such as canarypoxvirus vectors or chickenpoxvirus vectors; and (j) helper-dependent or enterovirus-free adenoviruses. Constructs for recombinant expression of CFB dsRNA agents may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. The use of viral vector systems, promoters, and enhancers, etc., is conventional in the art and can be used in conjunction with the methods and compositions described herein.

[0233] Some embodiments of the present invention include the delivery of CFB dsRNA reagent into cells using a viral vector. Many adenovirus-based delivery systems are conventionally used in the art for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that can be used in the methods of the present invention are: AAV vectors, poxviruses such as vaccinia virus, modified aniviruses (MVA), NYVAC, fowlpox such as chickenpox or canarypox.

[0234] Some embodiments of the present invention include a method for delivering a CFB dsRNA reagent into cells using a vector, and such a vector may be located in a pharmaceutically acceptable carrier, which may, but does not necessarily, include a sustained-release matrix in which a gene delivery vector is embedded. In some embodiments, the vector for delivering CFB dsRNA may be generated by recombinant cells, and the pharmaceutical compositions of the present invention may include one or more cells that generate a CFB dsRNA delivery system.

[0235] Pharmaceutical compositions containing CFB dsRNA or ssRNA agents

[0236] Some embodiments of the present invention include pharmaceutical compositions containing a CFB dsRNA agent or a CFB antisense polynucleotide agent and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing a CFB dsRNA agent or a CFB antisense polynucleotide agent can be used in the methods of the present invention to reduce CFB gene expression and CFB activity in cells, and can be used to treat CFB-related diseases or conditions. Such pharmaceutical compositions can be formulated according to the route of administration. Non-limiting examples of formulations for delivery methods are: formulations for subcutaneous delivery, formulations for systemic administration via parenteral delivery, formulations for intravenous (IV) delivery, formulations for intrathecal delivery, formulations for direct delivery to the brain, etc. Administration of the pharmaceutical compositions of the present invention to deliver a CFB dsRNA agent or a CFB antisense polynucleotide agent into cells can be performed in one or more ways, such as: topically (e.g., via a transdermal patch), pulmonaryly, for example, by inhalation or blowing in powder or aerosol, including via a nebulizer; intratracheally, intranasally, epidermally and transdermally, orally or parenterally. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous, for example, via an implanted device; or intracranial, for example, via intraparenchymal, intrathecal, or intraventricular administration. CFB dsRNA agents or CFB antisense polynucleotide agents may also be delivered directly to target tissues, such as the liver, kidneys, etc. It should be understood that "delivery of CFB dsRNA agents" or "delivery of CFB antisense polynucleotide agents" into cells includes, respectively, the direct delivery of CFB dsRNA agents or CFB antisense polynucleotide agents and the expression of CFB dsRNA agents in cells from a coding vector delivered to the cells, or the presence of CFB dsRNA or CFB antisense polynucleotide agents in cells by any suitable means. Methods for preparing and using formulations and delivering repressive RNA are well known in the art and are routinely used.

[0237] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of the present invention’s CFB dsRNA agent or CFB antisense polynucleotide agent and a pharmaceutically acceptable carrier. The term “pharmaceuticalally acceptable carrier” refers to a carrier used for administering the therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. This term explicitly excludes cell culture media. For orally administered pharmaceuticals, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginate are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If desired, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. Pharmaceutical agents contained in pharmaceutical formulations are further described below.

[0238] As used herein, terms such as “pharmacologically effective amount,” “therapeuticly effective amount,” and “effective amount” refer to the amount of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention that produces the expected pharmacological, therapeutic, or preventative outcome. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then a therapeutically effective amount of the drug used to treat that disease or condition is the necessary amount to reduce that parameter by at least 10%. For example, a therapeutically effective amount of a CFB dsRNA agent or CFB antisense polynucleotide agent can reduce CFB peptide levels by at least 10%.

[0239] Effective dose

[0240] The method of the present invention, in some aspects, includes contacting cells with an effective amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent to reduce CFB gene expression in the contacted cells. Some embodiments of the method of the present invention include administering an effective amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent to a subject to reduce CFB gene expression and treat the subject with a CFB-related disease or condition. An “effective amount” for reducing CFB expression and / or treating a CFB-related disease or condition is an amount necessary or sufficient to achieve the desired biological effect. For example, an effective amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent for treating a CFB-related disease or condition may be an amount necessary to (i) slow or stop the progression of the disease or condition; or (ii) reverse, reduce, or eliminate one or more symptoms of the disease or condition. In some aspects of the present invention, an effective amount is an amount that produces a therapeutic response that prevents and / or treats the disease or condition when a CFB dsRNA agent or a CFB antisense polynucleotide agent is administered to a subject requiring treatment for a CFB-related disease or condition. According to some aspects of the invention, an effective amount is the amount that produces a therapeutic response to prevent and / or treat a CFB-related disease or condition when the CFB dsRNA agent or CFB antisense polynucleotide agent of the invention is administered to a subject in combination with or in combination with a treatment method for another CFB-related disease or condition. In some embodiments of the invention, the biological effect of treating a subject with the CFB dsRNA agent or CFB antisense polynucleotide agent of the invention may be improvement and / or complete elimination of symptoms caused by a CFB-related disease or condition. In some embodiments of the invention, the biological effect is the complete elimination of a CFB-related disease or condition, for example, by diagnostic testing indicating that the subject has no CFB-related disease or condition. Non-limiting examples of detectable physiological symptoms include a decrease in CFB levels in the liver of a subject after administration of the agent of the invention. Other methods known in the art for assessing the status of a CFB-related disease or condition may be used to determine the effect of the agent and / or method of the invention on a CFB-related disease or condition.

[0241] Typically, an effective amount of a CFB dsRNA agent or CFB antisense polynucleotide agent that reduces CFB peptide activity to a level sufficient to treat CFB-related disease or condition will be determined in clinical trials, establishing the effective dose for the test population relative to a control population in blinded studies. In some embodiments, the effective amount will be the amount that results in the desired response, such as a reduction in the amount of CFB-related disease or condition in cells, tissues, and / or subjects with the disease or condition. Therefore, an effective amount of a CFB dsRNA agent or CFB antisense polynucleotide agent that treats CFB-related disease or condition by reducing CFB peptide activity can be an amount that, when administered, reduces CFB peptide activity in a subject to less than the amount present in cells, tissues, and / or subjects without administration of the CFB dsRNA agent or CFB antisense polynucleotide agent. In some aspects of the invention, the level of CFB peptide activity and / or CFB gene expression present in cells, tissues, and / or subjects not exposed to or administered the CFB dsRNA agent or CFB antisense polynucleotide agent of the invention is referred to as the “control” amount. In some embodiments of the method of the present invention, the control dose for the subject is the subject's pre-treatment dose; in other words, the subject's level before administration of the CFB agent can be the subject's control level and compared with the level of CFB peptide activity and / or CFB gene expression in the subject after administration of siRNA. In the case of treating CFB-related diseases or conditions, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in cells, tissues, and / or the subject. The reduction or elimination may be temporary or permanent. It should be understood that methods for determining CFB peptide activity, CFB gene expression, symptom assessment, clinical testing, etc., can be used to monitor the status of CFB-related diseases or conditions. In some aspects of the present invention, the desired response to treatment is a "delay" or even prevention of the onset of the CFB-related disease or condition.

[0242] The effective amount of a compound that reduces CFB peptide activity can also be determined by assessing the physiological effects of administration of the CFB dsRNA agent or CFB antisense polynucleotide agent on cells or subjects (e.g., reduction of CFB-related disease or symptoms after administration). The efficacy of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention (which may be administered in the form of the pharmaceutical compounds of the present invention) can be determined using subject assays and / or symptom monitoring, and to determine whether there is a response to treatment. Non-limiting examples include one or more tests known in the art for CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity via the alternative complement pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin levels; and levels of one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex. Another non-limiting example is that the status of CFB-related lipid imbalance in subjects can be determined using one or more liver function tests known in the art before and after treatment with the CFB dsRNA agent of the present invention.

[0243] Some embodiments of the present invention include methods for determining the efficacy of the dsRNA agent or CFB antisense polynucleotide agent of the present invention administered to a subject, said methods for treating a CFB-related disease or condition by assessing and / or monitoring one or more “physiological features” of the subject’s CFB-related disease or condition. Non-limiting examples of physiological features of a CFB-related disease or condition are CFB mRNA levels, CFB protein levels or CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity of the alternative complement pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin levels; and levels of one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex. Standard methods for determining such physiological features are known in the art, including but not limited to blood tests, imaging studies, physical examinations, etc.

[0244] It should be understood that the amount of CFB dsRNA agent or CFB antisense polynucleotide agent administered to the subject can be modified, at least in part, based on the determination of the subject's disease and / or condition and / or physiological characteristics. The therapeutic dose can be varied, for example, by increasing or decreasing the amount of CFB dsRNA agent or CFB antisense polynucleotide agent, by changing the composition of the CFB dsRNA agent or CFB antisense polynucleotide agent administered respectively, by changing the route of administration, by changing the time of administration, etc. The effective amount of CFB dsRNA agent or CFB antisense polynucleotide agent will vary depending on the specific condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of treatment, the nature of concurrent treatments (if any), the specific route of administration, and other factors within the knowledge and expertise of the healthcare practitioner. For example, the effective amount may depend on the required CFB peptide activity and / or CFB gene expression level for effective treatment of CFB-related diseases or conditions. Those skilled in the art can determine the effective amount of a specific CFB dsRNA agent or CFB antisense polynucleotide agent used in the methods of the present invention based on experience without excessive experimentation. Based on the teachings provided herein, an effective preventative or therapeutic regimen for a specific subject can be planned by selecting from the various CFB dsRNA agents or CFB antisense polynucleotide agents of the present invention and weighing factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred route of administration. As used in the embodiments of the present invention, the effective amount of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention can be the amount that produces the desired biological effect in the cell upon contact with the cell.

[0245] It should be recognized that CFB gene silencing can be determined in any CFB-expressing cell by constitutive or genomic engineering and by any suitable assay. In some embodiments of the invention, by administration of the CFB dsRNA agent of the invention, CFB gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the invention, by administration of the CFB dsRNA agent of the invention, CFB gene expression is reduced by between 5% and 10%, 5% and 25%, 10% and 50%, 10% and 75%, 25% and 75%, 25% and 100%, or 50% and 100%.

[0246] dose

[0247] CFB dsRNA agents and CFB antisense polynucleotide agents are delivered in the pharmaceutical composition at doses sufficient to inhibit CFB gene expression. In some embodiments of the invention, the dose of the CFB dsRNA agent or CFB antisense polynucleotide agent is in the range of 0.01 to 200.0 mg / kg body weight per day for the recipient, typically in the ranges of 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, and 4 to 15 mg / kg body weight per day (inclusive). For example, the CFB... dsRNA agents or CFB antisense polynucleotide agents can be administered in the following single dose / body weight amounts: approximately 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, etc. g / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2 mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg , 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg to 50mg / kg. .

[0248] Various factors can be considered when determining the dosage and timing of administration of the CFB dsRNA agent of the present invention. The absolute amount of the CFB dsRNA agent or CFB antisense polynucleotide agent administered will depend on various factors, including concurrent treatment, number of doses, and individual subject parameters, including age, physical condition, body size, and weight. These factors are well known to those skilled in the art and can be resolved through routine experiments. In some embodiments, a maximum dose may be used, i.e., the highest safe dose based on reasonable medical judgment.

[0249] In some embodiments, the method of the present invention may include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of a CFB dsRNA agent or a CFB antisense polynucleotide agent. In some cases, the pharmaceutical compound (e.g., containing a CFB dsRNA agent or a CFB antisense polynucleotide agent) may be administered to the subject at least daily, every other day, weekly, every other week, monthly, etc. The dose may be administered once or more daily, for example, 2, 3, 4, 5 or more times within a 24-hour period. The pharmaceutical composition of the present invention may be administered once daily, or the CFB dsRNA agent or CFB antisense polynucleotide agent may be administered throughout the day as two, three or more fractional doses at appropriate intervals, or even by continuous infusion or delivery by controlled-release formulation. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention may be administered to the subject once or more daily, once or more weekly, once or more monthly, or once or more annually.

[0250] In some aspects, the method of the present invention includes administering a pharmaceutical compound alone, in combination with one or more other CFB dsRNA agents or CFB antisense polynucleotide agents, and / or in combination with other pharmaceutical therapies or treatment activities or regimens administered to a subject suffering from a CFB-related disease or condition. The pharmaceutical compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the method of the present invention may be sterile and contain an amount of CFB dsRNA agent or CFB antisense polynucleotide agent that reduces the activity of the CFB polypeptide to a level sufficient to produce a desired response at a weight or volume unit suitable for administration to the subject. The dose of the pharmaceutical composition, comprising a CFB dsRNA agent or CFB antisense polynucleotide agent to reduce CFB protein activity, administered to the subject can be selected based on various parameters, particularly the route of administration and the subject's condition. Other factors include the required duration of treatment. If the subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or the dose may be effectively increased via a different, more localized delivery route).

[0251] treat

[0252] The terms “CFB-related diseases,” “CFB-related diseases and conditions,” and “diseases and conditions caused and / or regulated by CFB” as used in this article are intended to include any disease associated with the CFB gene or protein. These diseases may be caused by overproduction of the CFB protein, mutations in the CFB gene, abnormal cleavage of the CFB protein, or abnormal interactions between CFB and other proteins or other endogenous or exogenous substances. Exemplary CFB-related diseases include, but are not limited to: autoimmune diseases, complement system dysfunction (including abnormal upregulation of complement components, such as CFB), C3 glomerulonephritis (C3G), systemic lupus erythematosus (SLE), lupus nephritis, Ig-mediated nephropathy (e.g., IgA nephropathy and primary membranous nephropathy), nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration (AMD), including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia and reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatic diseases, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), immune complex-mediated glomerulonephritis (IC). Mediated GN), post-infectious glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid antibody syndrome (APS), dysbiosis-related periodontitis, malarial anemia, bullous dermatomyositis, pemphigoid, Shiga toxin-related Escherichia coli-associated hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposit disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular transplant rejection, graft dysfunction, myocardial infarction, transplant sensitization, hyperlipidemia, sepsis, or lipid imbalances associated with CFB.

[0253] In some aspects of the invention, the CFB dsRNA agent or CFB antisense polynucleotide agent of the invention may be administered to a subject at one or more times before or after a diagnosis of a CFB-related disease or condition. In some aspects of the invention, the subject is at risk of having or developing a CFB-related disease or condition. A subject at risk of developing a CFB-related disease or condition is a subject who has an increased likelihood of developing a CFB-related disease or condition compared to a control risk level. In some embodiments of the invention, the risk level may be statistically significant compared to a control level. Subjects at risk may include, for example, subjects who are or will be: subjects with a pre-existing disease and / or genetic abnormality that makes them more susceptible to a CFB-related disease or condition than controls without a pre-existing disease or genetic abnormality; subjects with a family and / or personal history of a CFB-related disease or condition; and subjects who have previously received treatment for a CFB-related disease or condition. It should be understood that the pre-existing disease and / or genetic abnormality that makes a subject more sensitive to CFB-related diseases or conditions can be a disease or genetic abnormality that has been pre-identified as having a higher likelihood of developing a CFB-related disease or condition when it is present.

[0254] It should be understood that the CFB dsRNA agent or CFB antisense polynucleotide agent can be administered to the subject based on the individual subject's medical condition. For example, healthcare providers may assess CFB levels measured in samples obtained from the subject and determine the desired reduction in the subject's CFB levels by administering the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention. In this example, CFB levels can be considered a physiological characteristic of CFB-related diseases even if the subject has not been diagnosed with one (as disclosed herein). Healthcare providers may monitor changes in the subject's CFB levels as a measure of the efficacy of the administered CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention. In a non-limiting example, biological samples (e.g., blood or serum samples) may be obtained from the subject, and the subject's CFB levels may be determined in the samples. The CFB dsRNA agent or CFB antisense polynucleotide agent is administered to the subject, and a blood sample is obtained from the subject after administration, which is used to determine the CFB levels, and the results are compared with those determined in samples taken before (before) administration. The decrease in CFB levels in the subjects' later samples compared to pre-treatment levels indicates that the administered CFB dsRNA agent or CFB antisense polynucleotide agent was effective in reducing the subjects' lipid levels.

[0255] Some embodiments of the method of the present invention include adjusting the treatment, which comprises administering the dsRNA agent or CFB antisense polynucleotide agent of the present invention to the subject, based at least in part on an assessment of changes in one or more physiological characteristics of a CFB-related disease or condition induced by the treatment. For example, in some embodiments of the present invention, the effect of the administered dsRNA agent or CFB antisense polynucleotide agent of the present invention can be determined and used to assist in adjusting the amount of the dsRNA agent or CFB antisense polynucleotide agent of the present invention subsequently administered to the subject. In a non-limiting example, the subject is administered the dsRNA agent or CFB antisense polynucleotide agent of the present invention, and the subject's CFB level is measured after administration. Based at least in part on the measured level, a higher amount of the dsRNA agent or CFB antisense polynucleotide agent is determined to be desirable in order to increase the physiological effect of the administered agent, for example, to reduce or further reduce the subject's CFB level. In another non-limiting example, the subject is administered the dsRNA agent or CFB antisense polynucleotide agent of the present invention, and the subject's CFB level is measured after administration. Based at least in part on the measured level, a lower amount of the dsRNA agent or CFB antisense polynucleotide agent is desired to be administered to the subject.

[0256] Therefore, some embodiments of the present invention include assessing changes in one or more physiological characteristics induced by prior treatment of a subject to adjust the amount of the dsRNA agent or CFB antisense polynucleotide agent of the present invention subsequently administered to the subject. Some embodiments of the method of the present invention include performing 1, 2, 3, 4, 5, 6 or more measurements on physiological characteristics of CFB-related diseases or conditions to assess and / or monitor the efficacy of the administered CFB dsRNA agent or the CFB antisense polynucleotide agent of the present invention, and optionally using the measurements to adjust one or more of the dosage, administration regimen, and / or administration frequency of the dsRNA agent or CFB antisense polynucleotide agent of the present invention to treat CFB-related diseases or conditions in the subject. In some embodiments of the method of the present invention, the desired outcome of administering an effective amount of the dsRNA agent or CFB antisense polynucleotide agent of the present invention to a subject is a decrease in the subject's CFB mRNA level, a decrease in the subject's CFB protein level, or a decrease in CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity of the alternative complement pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin level; and the levels of any one or more of C3, C9, C5, C5a, C5b, and the soluble C5b-9 complex.

[0257] As used herein, the terms “treatment,” “therapeutic,” or “under treatment” when applied to CFB-related disease or condition can refer to preventive treatment that reduces the likelihood of a subject developing a CFB-related disease or condition, or to treatment after a subject has developed a CFB-related disease or condition, to eliminate the CFB-related disease or condition or reduce the level of the CFB-related disease or condition, prevent the CFB-related disease or condition from becoming more advanced (e.g., more severe), and / or slow the progression of the CFB-related disease or condition in a subject, compared to a subject without treatment that reduces the activity of CFB peptides in the subject.

[0258] Certain embodiments of the agents, compositions, and methods of the present invention can be used to inhibit CFB gene expression. The terms “inhibit,” “silence,” “reduction,” “downregulation,” and “knockdown” used herein with respect to CFB gene expression refer to a reduction in CFB gene expression when cells, cell groups, tissues, organs, or subjects are contacted (e.g., treated) with the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention, compared to control levels of RNA transcribed from the CFB gene, levels of CFB activity expressed, or levels of CFB translated from mRNA, as measured by one or more of the following in the cells, cell groups, tissues, organs, or subjects in which the CFB gene is transcribed: levels of RNA transcribed from the gene, levels of CFB activity expressed, and levels of CFB polypeptides, proteins, or protein subunits translated from mRNA. In some embodiments, the control level is the level in cells, tissues, organs, or subjects that have not been contacted (e.g., treated) with the CFB dsRNA agent or CFB antisense polynucleotide agent.

[0259] Administration method

[0260] Multiple routes of administration of CFB dsRNA agents or CFB antisense polynucleotide agents can be used in the methods of the present invention. The specific delivery modality chosen will depend at least in part on the specific condition being treated and the dosage required for therapeutic efficacy. Generally, the methods of the present invention can be implemented using any medically acceptable mode of administration, meaning any mode that produces an effective therapeutic level of CFB-related disease or condition without causing clinically unacceptable side effects. In some embodiments of the present invention, CFB dsRNA agents or CFB antisense polynucleotide agents can be administered via oral, enteral, mucosal, subcutaneous, and / or parenteral routes. The term “parenteral” includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., via a gastrointestinal tube), percutaneous, vaginal, rectal, sublingual, and inhalation. Delivery routes of the present invention may include intrathecal, intraventricular, or intracranial. In some embodiments of the present invention, CFB dsRNA agents or CFB antisense polynucleotide agents may be placed in a sustained-release matrix and administered by placing the matrix in the subject. In some aspects of the invention, CFB dsRNA agents or CFB antisense polynucleotide agents can be delivered to subject cells using nanoparticles coated with delivery agents targeting specific cells or organelles. Various delivery methods, approaches, and reagents are known in the art. Non-limiting examples of delivery methods and delivery agents are also provided elsewhere herein. In some aspects of the invention, the term "delivery" relating to CFB dsRNA agents or CFB antisense polynucleotide agents can refer to the administration of one or more "naked" CFB dsRNA agent or CFB antisense polynucleotide agent sequences to cells or a subject, and in other aspects of the invention, "delivery" refers to administration to cells or a subject via transfection, delivery of cells containing a CFB dsRNA agent or CFB antisense polynucleotide agent to a subject, or delivery of a vector encoding a CFB dsRNA agent or CFB antisense polynucleotide agent into a subject. Delivery of CFB dsRNA agents or CFB antisense polynucleotide agents using transfection methods can include administration of a vector to cells and / or a subject.

[0261] In some methods of the present invention, one or more CFB dsRNA agents or CFB antisense polynucleotide agents may be administered in a formulation, which may be administered in a pharmaceutically acceptable solution, typically containing pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the present invention, the CFB dsRNA agent or CFB antisense polynucleotide agent may be formulated with another therapeutic agent for simultaneous administration. According to the methods of the present invention, the CFB dsRNA agent or CFB antisense polynucleotide agent may be administered in a pharmaceutical composition. Generally, the pharmaceutical composition comprises a CFB dsRNA agent or CFB antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the effectiveness of the bioactivity of the active ingredient, such as the ability of a CFB dsRNA agent or CFB antisense polynucleotide agent to inhibit CFB gene expression in cells or a subject. Various methods for administering and delivering CFB dsRNA agents or CFB antisense polynucleotide agents for treatment are known in the art and can be used in the methods of the present invention.

[0262] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in pharmaceuticals, salts should be pharmaceutically acceptable, but non-pharmaceuticalally acceptable salts may be conveniently used to prepare their pharmaceutically acceptable salts and are not excluded from the scope of this invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. Furthermore, pharmaceutically acceptable salts can be prepared as alkali metal or alkaline earth salts, such as sodium, potassium, or calcium salts.

[0263] Some embodiments of the method of the present invention include direct administration of one or more CFB dsRNA agents or CFB antisense polynucleotide agents to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which CFB-related disease or condition is present or may occur, a non-limiting example being the heart. Direct tissue administration can be achieved by direct injection or other means. Many orally delivered compounds naturally travel through and through the liver and kidneys, and some embodiments of the treatment methods of the present invention include oral administration of one or more CFB dsRNA agents to a subject. CFB dsRNA agents or CFB antisense polynucleotide agents, alone or in combination with other therapeutic agents, can be administered once, or alternatively, they can be administered multiple times. If administered multiple times, CFB dsRNA agents or CFB antisense polynucleotide agents can be administered via different routes. For example, although not intended to be limiting, the first (or first few) administrations can be performed subcutaneously, and one or more subsequent administrations can be oral and / or systemic.

[0264] For embodiments of the present invention requiring systemic administration of CFB dsRNA agents or CFB antisense polynucleotide agents, the CFB dsRNA agents or CFB antisense polynucleotide agents can be formulated for parenteral administration by injection, such as by bolus or continuous infusion. The injectable formulation can be in unit dose form, such as ampoules or multi-dose containers, with or without preservatives. CFB dsRNA agent formulations (also referred to as pharmaceutical compositions) can be in the form of suspensions, solutions, or emulsions in oily or aqueous carriers, and can contain formulations such as suspending agents, stabilizers, and / or dispersants.

[0265] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Parenteral carriers include sodium chloride solutions, Ringer's glucose, glucose and sodium chloride, lactated Ringer's solutions, or non-volatile oils. Intravenous carriers include fluids and nutritional supplements, electrolyte supplements (such as Ringer's glucose-based supplements), etc. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases. Other forms of administration (such as intravenous administration) may have lower doses. If a subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or the dose may be effectively increased by using a different, more localized route of delivery). Multiple doses can be used daily as needed to achieve appropriate systemic or local levels of one or more CFB dsRNA agents or CFB antisense polynucleotide agents and to achieve an appropriate reduction in CFB protein activity.

[0266] In other embodiments, the method of the present invention includes the use of a delivery carrier, such as biocompatible microparticles, nanoparticles, or an implant suitable for implantation into a recipient (e.g., a subject). Exemplary biodegradable implants that may be used according to this method are described in PCT Publication WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix containing biomacromolecules.

[0267] Both non-biodegradable and biodegradable polymer matrices can be used in the methods of the present invention to deliver one or more CFB dsRNA reagents or CFB antisense polynucleotide reagents to a subject. In some embodiments, the matrix may be biodegradable. The matrix polymer may be a natural or synthetic polymer. The polymer may be selected based on the desired release time period, typically on the order of hours to a year or longer. Typically, release over a period of hours to three to twelve months may be used. The polymer is optionally in the form of a hydrogel that can absorb up to about 90% of its weight in water and is further optionally crosslinked with multivalent ions or other polymers.

[0268] Generally, in some embodiments of the present invention, CFB dsRNA agents or CFB antisense polynucleotide agents can be delivered using bioerodible implants by diffusion or by degradation of a polymer matrix. Exemplary synthetic polymers for such uses are well known in the art. CFB dsRNA agents or CFB antisense polynucleotide agents can be delivered using both biodegradable and bionon-degradable polymers by methods known in the art. Bioadhesive polymers such as bioerodible hydrogels (see H.S. W. H., C.P. Pathak and J.A. Hubell in Macromolecules, 1993, 26, 581-587, whose teachings are incorporated herein by reference) can also be used to deliver CFB dsRNA agents or CFB antisense polynucleotide agents to treat CFB-related diseases or conditions. Other suitable delivery systems may include timed-release, delayed-release, or sustained-release delivery systems. Such systems avoid repeated administration of CFB dsRNA agents or CFB antisense polynucleotide agents, thereby increasing convenience for subjects and healthcare professionals. Many types of release delivery systems are available and are known to those skilled in the art. (See, for example: U.S. Patent Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teachings of each patent are incorporated herein by reference). Additionally, pump-based hardware delivery systems may be used, some of which are suitable for implantation.)

[0269] The use of long-release implants may be suitable for prophylactic treatment in subjects, as well as for subjects at risk of recurrent CFB-related disease or condition. Long-release, as used herein, refers to an implant constructed and positioned to deliver therapeutic levels of CFB dsRNA or CFB antisense polynucleotides for at least 10, 20, 30, 60, 90 days, six months, one year, or longer. Long-release implants are well known to those skilled in the art and include some of the release systems described above.

[0270] Therapeutic formulations of CFB dsRNA agents or CFB antisense polynucleotide agents can be prepared for storage in the form of lyophilized formulations or aqueous solutions by mixing molecules or compounds of desired purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers. [Remington's Pharmaceutical Sciences 21] st [edition, (2006)]. Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the doses and concentrations used and include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethyl ammonium chloride; benzalkonium chloride, benzyl chloride; phenol, butanol, or benzyl alcohol; alkyl parabens such as methyl or propyl parabens; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10). (1 residue) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as... Or polyethylene glycol (PEG).

[0271] Cells, subjects and controls

[0272] The methods of this invention can be used in conjunction with cells, tissues, organs, and / or subjects. In some aspects of this invention, the subject is a human or vertebrate mammal, including but not limited to dogs, cats, horses, cattle, goats, mice, rats, and primates such as monkeys. Therefore, this invention can be used to treat CFB-related diseases or conditions in human and non-human subjects. In some aspects of this invention, the subject can be a farm animal, zoo animal, domesticated animal, or undomesticated animal, and the methods of this invention can be used in veterinary prevention and treatment programs. In some embodiments of this invention, the subject is a human, and the methods of this invention can be used in human prevention and treatment programs.

[0273] Non-limiting examples of subjects to whom this invention can be applied are subjects diagnosed with, suspected of having, or at risk of developing a disease or condition associated with higher than expected CFB expression and / or activity, also referred to as “elevated CFB expression levels.” Non-limiting examples of diseases and conditions associated with higher than expected CFB expression and / or activity are described elsewhere herein. The methods of this invention can be applied to subjects diagnosed with a disease or condition associated with higher than expected CFB expression and / or activity at the time of treatment, or subjects considered at risk of developing or progressing to a disease or condition associated with higher than expected CFB expression and / or activity. In some aspects of this invention, the disease or condition associated with higher than expected CFB expression and / or activity is an acute disease or condition, while in other aspects, the disease or condition associated with higher than expected CFB expression and / or activity is a chronic disease or condition.

[0274] In a non-limiting example, the CFB dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of having statin-resistant hypercholesterolemia, a condition requiring reduction of CFB expression. The method of the present invention can be applied to subjects who have been diagnosed with the disease or condition at the time of treatment, or subjects considered to be at risk of having or developing the disease or condition.

[0275] In another non-limiting example, the CFB dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of developing hyperlipidemia, a disease requiring reduction of CFB expression. The method of the present invention can be applied to subjects diagnosed with, or considered to be at risk of developing, the disease or condition during treatment.

[0276] Cells to which the methods of this invention can be applied include in vitro, in vivo, and ex vivo cells. Cells may be in a subject, in a culture, and / or in a suspension, or under any other suitable conditions. Cells to which the methods of this invention can be applied may be hepatocytes, liver cells, cardiomyocytes, pancreatic cells, cardiovascular cells, kidney cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some aspects of this invention, cells to which the methods of this invention can be applied are healthy, normal cells, which are unknown to be diseased cells. In some embodiments of this invention, the cells to which the methods and compositions of this invention are applied are hepatocytes, liver cells, cardiomyocytes, pancreatic cells, cardiovascular cells, and / or kidney cells. In some aspects of this invention, control cells are normal cells; however, it should be understood that cells suffering from a disease or condition may also serve as control cells in specific circumstances, for example, when comparing the results of treatment of cells suffering from a disease or condition with the results of untreated cells suffering from the disease or condition.

[0277] According to the method of the present invention, the level of CFB peptide activity can be determined and compared with a control level of CFB peptide activity. The control can be a predetermined value, which can take various forms. It can be a single cutoff value, such as a median or average. It can be established based on a comparison group, such as a group with normal levels of CFB peptide and / or CFB peptide activity and a group with elevated levels of CFB peptide and / or CFB peptide activity. Another non-limiting example of a comparison group can be a group with one or more symptoms of a CFB-related disease or condition or diagnosed with a CFB-related disease or condition; a group without one or more symptoms of such a disease or condition or not diagnosed with such a disease or condition; a group of subjects treated with the siRNA of the present invention; or a group of subjects not treated with the siRNA of the present invention. Typically, the control can be based on a clearly healthy normal individual or clearly healthy cells within an appropriate age range. It should be understood that, in addition to predetermined values, the control according to the present invention can also be a sample of material tested in parallel with the experimental material. Examples include samples from a control population or control samples manufactured to be tested in parallel with the experimental sample. In some embodiments of the invention, the control may include cells or subjects not exposed to or treated with the CFB dsRNA agent of the invention, and in such cases, the control level of CFB peptide and / or CFB peptide activity may be compared with the level of CFB peptide and / or CFB peptide activity in cells or subjects exposed to the CFB dsRNA agent or CFB antisense polynucleotide agent of the invention.

[0278] In some embodiments of the invention, the CFB peptide level determined for a subject may be a control level compared to CFB peptide levels determined for the same subject at different times. In a non-limiting example, the CFB level is determined in a biological sample obtained from a subject who has never received CFB treatment of the invention. In some embodiments, the biological sample is a serum sample. The CFB peptide level determined from the sample obtained from the subject may be used as a baseline or control for the subject. In the treatment methods of the invention, after administering the CFB dsRNA agent to a subject once or more times, one or more additional serum samples may be obtained from the subject, and the CFB peptide level in the subsequent one or more samples may be compared to the subject's control / baseline level. Such comparisons can be used to assess the onset, progression, or regression of CFB-related disease or condition in the subject. For example, a higher level of CFB peptide in a baseline sample obtained from the subject than the level obtained from the same subject after administering the CFB dsRNA agent or CFB antisense polynucleotide agent of the invention to that subject indicates regression of the CFB-related disease or condition and indicates the efficacy of the administered CFB dsRNA agent of the invention in treating the CFB-related disease or condition.

[0279] In some aspects of the invention, one or more of the levels of CFB peptides and / or CFB peptide activity measured in a subject can serve as control values ​​for later comparison of the levels of CFB peptides and / or CFB activity in the subject under the same conditions, thereby allowing assessment of changes in CFB peptide activity in the subject relative to “baseline.” Thus, an initial CFB peptide level and / or initial CFB peptide activity level can be present and / or determined in the subject, and the methods and compounds of the invention can be used to reduce CFB peptide levels and / or CFB peptide activity in a subject, wherein the initial level serves as a control level for that subject.

[0280] Using the method of the present invention, the CFB dsRNA agent and / or CFB antisense polynucleotide agent of the present invention can be administered to a subject. The efficacy of administration and treatment of the present invention can be evaluated when the level of CFB peptide in serum samples obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-administration level of CFB peptide in serum samples obtained from the subject, or compared to the level of a non-contact control (e.g., the level of CFB peptide in a control serum sample). It should be understood that the levels of CFB peptide and CFB peptide activity are correlated with the level of CFB gene expression. Certain embodiments of the method of the present invention include administering the CFB dsRNA agent and / or CFB antisense agent of the present invention to the subject in an amount that effectively inhibits CFB gene expression and thereby reduces the level of CFB peptide in the subject and reduces the level of CFB peptide activity.

[0281] Some embodiments of the present invention include determining the presence, absence, and / or amount (also referred to herein as level) of CFB peptides in one or more biological samples obtained from one or more subjects. This determination can be used to evaluate the effectiveness of the treatment methods of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of CFB peptides in biological samples obtained from subjects previously treated with the CFB dsRNA agent and / or CFB antisense agent of the present invention. A CFB peptide level measured in a serum sample obtained from a treated subject that is at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more lower than the pre-treatment CFB peptide level measured in that subject or compared to the level in a non-contact control biological sample indicates the efficacy level of the treatment administered to the subject.

[0282] In some embodiments of the invention, the physiological characteristics of CFB-related disease or condition measured against a subject may be control measurements against physiological characteristics measured against the same subject at different times. In non-limiting examples, physiological characteristics such as CFB mRNA levels, CFB protein levels, or CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin levels in the subject; and the levels of any one or more of C3, C9, C5, C5a, C5b, and soluble C5b-9 complexes in plasma or tissue samples are measured in biological samples (e.g., serum samples) obtained from the subject (who has not yet been treated with the CFB agent of the invention). The CFB mRNA levels (and / or other physiological characteristics of CFB disease or condition) measured in samples obtained from the subject can serve as a baseline or control for the subject. After one or more administrations of the CFB dsRNA agent to the subject using the treatment method of the invention, one or more additional serum samples may be obtained from the subject, and the CFB mRNA levels and / or CFB protein levels in one or more subsequent samples are measured and compared to the subject's control / baseline levels and / or ratios, respectively. Such comparisons can be used to assess the onset, progression, or decline of CFB-related disease or condition in subjects. For example, a higher CFB mRNA level in a baseline sample obtained from a subject compared to a CFB mRNA level measured in a sample obtained from the same subject after administration of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention indicates that the CFB-related disease or condition is resolving and demonstrates the efficacy of the administered CFB dsRNA agent of the present invention in treating the CFB-related disease or condition.

[0283] In certain aspects of the invention, one or more physiological characteristic values ​​for a CFB-related disease or condition identified in a subject can be used as control values ​​to allow for later comparison of the physiological characteristics of the same subject, thereby allowing assessment of changes in the subject's physiological characteristics relative to a "baseline". Thus, a subject may have and / or have identified initial physiological characteristics, and the methods and compounds of the invention can be used to reduce the level of CFB peptides and / or CFB peptide activity in a subject, wherein the initial physiological characteristic measurements serve as a control for that subject.

[0284] Using the method of the present invention, the CFB dsRNA agent and / or CFB antisense polynucleotide agent of the present invention can be administered to a subject in an effective amount to treat CFB-related diseases or conditions. The effectiveness of the administration and treatment of the present invention can be assessed by determining changes in one or more physiological characteristics of CFB-related diseases or conditions. In a non-limiting example, the CFB mRNA level in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to pre-administration lipids in a serum sample obtained from the subject at a previous time point, or compared to non-contact control levels (e.g., CFB mRNA levels in a control serum sample). It should be understood that the subject's CFB mRNA level, CFB protein level, or lipid levels, triglyceride levels, cholesterol levels, and free fatty acid levels in plasma or tissue samples are all correlated with CFB gene expression levels. Some embodiments of the method of the present invention include administering to a subject an amount of the present invention’s CFB dsRNA agent and / or CFB antisense agent that effectively inhibits CFB gene expression, thereby reducing the subject’s CFB mRNA level, CFB protein level, or otherwise positively influencing the subject’s physiological characteristics of CFB-related diseases or conditions.

[0285] Some embodiments of the present invention include using methods such as, but not limited to, the following to determine the presence, absence, and / or variation of physiological characteristics of CFB-related diseases or conditions: (1) assessing the physiological characteristics of one or more biological samples obtained from one or more subjects; (2) imaging the subjects (e.g., but not limited to obtaining liver images); and (3) conducting a physical examination of the subjects. This assay can be used to evaluate the efficacy of the treatment methods of the present invention.

[0286] medicine box

[0287] Kits containing CFB dsRNA reagents and / or CFB antisense polynucleotide reagents, and their instructions for use in the methods of the present invention, are also within the scope of the present invention. Kits of the present invention may include one or more of CFB dsRNA agents, CFB sense polynucleotides, and CFB antisense polynucleotide agents that can be used to treat CFB-related diseases or conditions. Kits containing one or more CFB dsRNA reagents, CFB sense polynucleotides, and CFB antisense polynucleotide reagents can be prepared for use in the treatment methods of the present invention. Components of the kits of the present invention may be packaged in an aqueous medium or in lyophilized form. Kits of the present invention may include a carrier spaced apart to tightly and confinedly receive one or more container devices or a series of container devices therein, such as test tubes, vials, flasks, bottles, syringes, etc. The first container device or series of container devices may contain one or more compounds, such as CFB dsRNA reagents and / or CFB sense or antisense polynucleotide reagents. The second container device or series of container devices may contain a targeting agent, a labeling agent, a delivery agent, etc., which, in one embodiment of the treatment method of the present invention, may be included as part of the CFB dsRNA agent and / or CFB antisense polynucleotide to be administered.

[0288] The kit of the present invention may also include instructions. The instructions are typically in written form and provide guidance on how to implement the treatment contained in the kit and on making decisions based on that treatment.

[0289] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. Those skilled in the art will understand that the present invention is applicable to a variety of compositions and methods. DETAILED DESCRIPTION

[0291] Example 1. Phosphoramide compound 2

[0292]

[0293] A solution of pyridine (400 mL) in DMTTrCl (232 g, 684 mmol, 1.0 eq) was added to a solution of pyridine (600 mL) in isomannitol compound A (100 g, 684 mmol, 1.0 eq), and the mixture was stirred at 25 °C for 12 hours. LC-MS showed complete consumption of compound A, with a main peak of the desired mass detected. The resulting reaction mixture was diluted with water (500 mL), extracted with DCM (500 mL x 2), and the combined organic phases were washed with brine (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to obtain compound B (150 g, 48.9% yield) as a yellow solid.

[0294] 1 H NMR: EC4783-404-P1B1_C (400MHz, DMSO-d6) δppm 7.46 (br d, J=7.63Hz, 2H) 7.28-7.37 (m, 6H) 7.19-7.25 (m, 1H) 6.90 (br d,J=7.88Hz,4H)4.70(d,J=6.50Hz,1H)3.99-4.09(m,6H)3.88-3.96(m,2H)3.83(br dd,J=7.82,6.94Hz,1H)3.74(s,6H)3.41(brt,J=8.13Hz,1H)3.05(t,J=8.44Hz,1H)2.85(br t,J=7.50Hz,1H).

[0295] At 25°C and under N2 atmosphere, 2H-tetrazole (0.45M, 436mL, 1.1eq) was added dropwise to a DCM (800mL) solution of compound B (80.0g, 178mmol, 1.0eq), followed by a DCM (200mL) solution of compound C (80.6g, 267mmol, 85.0mL, 1.5eq). The reaction mixture was stirred at 25°C for 1.0 h. LC-MS showed that compound B was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold saturated NaHCO3 (500mL), extracted with DCM (500mL*3), and the combined organic layers were washed with saturated NaHCO3 / salt water at a ratio of 1:1 (300mL / 300mL), dried over Na2SO4, and concentrated under vacuum (35°C) to obtain a residue (100mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound 2 (77 g, 119 mmol, yield 66.5%) as a white solid.

[0296] 1H NMR: EC4783-423-P1B1_C (400MHz, DMSO-d6) δppm 7.22 (br d, J=7.50Hz, 2H) 7.05-7.14 (m, 6H) 6.96-7.02 (m, 1H) 6.67 (br dd,J=8.82,1.81Hz,4H)3.95-4.07(m,2H)3.73-3.83(m,1H)3.62-3.72(m,2H)3.48-3.53(m ,6H)3.27-3.37(m,3H)3.11(s,6H)2.82(td,J=8.54,2.31Hz,1H)2.47-2.63(m,3H)2.28(br d,J=1.63Hz,3H)0.82-1.00(m,13H).

[0297] Phosphamide compound 1

[0298]

[0299] Compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) were added to a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) in DCM (5.0 mL) at 0–5 °C under N2 conditions. The mixture was stirred at 25 °C for 1.0 h. LC-MS showed complete consumption of compound B, with several new peaks and detection of approximately 70.9% of the desired compound. The resulting reaction mixture was cooled to -20 °C and poured into a cold (0–5 °C) saturated NaHCO3 (5.0 mL) solution. Extraction was performed with DCM (5.0 mL x 2). The combined organic layers were washed with cold (0–5 °C) saturated NaHCO3 / salt water at a 1:1 ratio (5.0 mL / 5.0 mL), dried over Na2SO4, and concentrated under vacuum to obtain a residue (~5 mL). The residue was purified by column chromatography (alkaline Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to give compound 1 as a white solid (280 mg, 471 μmol, yield 42.3%).

[0300] 1H NMR: EC10615-49-P1N (400MHz, DMSO-d6) δppm 7.44 (br d, J=7.63Hz, 2H), 7.31 (br t,J=7.94Hz,6H),7.18-7.26(m,1H),6.89(brd,J=8.00Hz,4H),4.08-4.13(m,1H),3.95-4 .03(m,1H),3.84-3.93(m,1H),3.77-3.83(m,1H),3.74(s,6H),3.43-3.53(m,3H),3.38(br d,J=6.75Hz,1H),2.94-3.04(m,1H),2.70-2.85(m,1H),1.09-1.15(m,12H),1.07(br s,3H).

[0301] Other phosphoramides can be prepared according to the procedures described herein and / or existing technologies such as, but not limited to, US426,220 and WO02 / 36743.

[0302] Example 2. Preparation of a solid support containing the phosphorus amide monomer of the present invention

[0303]

[0304] Indicates the macroporous amyl methyl polyethylene resin carrier portion

[0305] Under nitrogen protection, 19.50 kg of dichloromethane was added to a 50 L glass reactor. Stirring was started, and the temperature was controlled at 20–30 °C. DMTrimann (1.47 kg), triethylamine (1.50 kg), 4-dimethylaminopyridine (0.164 kg), and succinic anhydride (1.34 kg) were added to the glass reactor. The mixture was kept at 20–30 °C for 18 h, and a sample was taken to terminate the reaction. A saturated sodium bicarbonate solution (22.50 kg) was added to the reaction system, and the mixture was stirred for 10–20 min, resulting in layer separation. The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to obtain 1.83 kg of a gray to grayish-white solid residue.

[0306] N,N-Dimethylformamide (23.50 kg) was added to a 100 L glass reactor and stirred. The temperature was controlled at 20–30 °C. Under nitrogen protection, the products from the previous step, O-benzotriazole tetramethylurea hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg), were added to the 100 L glass reactor through a solid feed funnel. After stirring for 10–30 minutes, the mixture was drained into a 50 L zinc tank for later use. Macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Hecheng Technology Co., Ltd., batch number HA2X1209, loading 0.48 mmol / g) was added to the 100 L solid-phase synthesis reactor through a solid feed funnel. The temperature was controlled at 20–30 °C. N,N-Dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the zinc tank in the previous step were added to the solid-phase synthesis reactor. The system was subjected to an insulated reaction, with the solid load monitored to be ≥250 μmol / g using UV detection. Nitrogen pressure filtration was performed, and the filter cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg), leaving the filter cake in the reactor. CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine and 30% N-methylimidazolium and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) were added to an 80L glass reactor and stirred for 3–8 min before use. This operation was repeated three times. The reactor was then capped, and acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) was added to the solid-phase synthesis reactor. Nitrogen bubbling was applied for 10–30 minutes, followed by pressure filtration. Repeat this operation 4 times, purging the filter cake with nitrogen in a solid-phase synthesis reactor for 2-4 hours, and then transfer it to a 50L filter press. Control the temperature at 15-30℃ and continue drying. After drying, a yellow to white solid product is obtained, weighing 3.516 kg.

[0307] Isomannitol residues are added to the 5' or 3' end of the oligonucleotide chain by methods well known to those skilled in the art, such as reverse debasing (invab), and further added to the target group.

[0308] Example 3. Synthesis of CFB RNAi agent.

[0309] The CFB RNAi agent duplexes shown in Table 2-3 above were synthesized according to the following general procedure:

[0310] The sense and antisense sequences of siRNA were synthesized on an oligonucleotide synthesizer using a mature solid-phase synthesis method based on phosphoramide chemistry. Oligonucleotide chain growth was achieved through a four-step cycle: deprotection, condensation, capping, and oxidation or sulfidation steps for adding each nucleotide. Synthesis was performed on a controlled-pore glass (CPG) system. The reaction is carried out on a solid support prepared by [the process described]. The monomeric phosphoramide can be purchased from a commercial source or can be the phosphoramide compound from Example 1. The phosphoramide compound described herein can be attached as a monomeric phosphoramide to the 3'-terminus and further attached to the CPG solid support. In the case of 5'-terminal attachment, the phosphoramide compound can be used for the final coupling reaction and can be further conjugated to a targeting ligand if desired.

[0311] Phosphamides with GalNAc ligand clusters (GLS-5* or GLS-15* phosphoramides as non-limiting examples) are disclosed in WO2023 / 045995A1 (the entire contents of which are incorporated herein by reference). For siRNAs used for in vitro screening (Table 2), synthesis was performed at a scale of 2 μmol, and for siRNAs used for in vivo assays (Table 3), synthesis was performed at a scale of 5 μmol or greater. A CPG solid support with GalNAc ligand attached was used when the GalNAc ligand (GLO-n phosphoramide, as a non-limiting example, is disclosed in WO2023 / 045995A1 (the entire contents of which are incorporated herein by reference) was conjugated to the 3'-terminus of the sense strand. In the case of a GalNAc ligand (GLS-5* or GLS-15* as a non-limiting example attached to the 5' end of the sense chain, GLS-5* or GLS-15* phosphorous amide with a GalNAc ligand cluster attached to the 5' end of the sense chain, as per WO2023 / 045995A1 (the entire contents of which are incorporated herein by reference)), GalNAc phosphorous amide is used for the final coupling reaction. A 3% dichloromethane solution of trichloroacetic acid (TCA) is used for deprotection of the 4,4'-dimethoxytriphenylmethyl protecting group (DMT). 5-Ethylthio-1H-tetrazole is used as the activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN are used for the oxidation and sulfidation reactions, respectively. After the final solid-phase synthesis step, the oligomer bound to the solid support is cleaved and the protecting group is removed by treatment with a 1:1 volume mixture of 40 wt% aqueous methylamine and 28% ammonium hydroxide solution. To synthesize siRNA for in vitro screening, the crude mixture was concentrated. The remaining solid was dissolved in 1.0 M NaOAc, and ice-cold EtOH was added to precipitate the single-stranded product as a sodium salt, which could be used for annealing without further purification. To synthesize siRNA for in vivo testing, the crude single-stranded product was further purified by ion-pair reversed-phase HPLC (IP-RP-HPLC). The purified single-stranded oligonucleotide product from IP-RP-HPLC was converted to a sodium salt by dissolving it in 1.0 M NaOAc and precipitating it with ice-cold EtOH. Annealing of the sense and antisense oligonucleotides in water with equimolar complementarity was performed to form a double-stranded siRNA product, which was then lyophilized to provide a fluffy white solid.

[0312] In some studies, methods of attaching a targeting group containing GalNAc (also referred to herein as a GalNAc delivery compound) to the 5' end of the sense chain include using GalNAc phosphoramide (GLS-5* or GLS-15* phosphoramide) in the final coupling step of solid-phase synthesis, using synthetic processes, such as those used in oligonucleotide chain growth in which nucleotides are added to the 5' end of the sense chain.

[0313] In some studies, methods for attaching a GalNAc-containing targeting group to the 3' end of a sense chain include using a solid support (CPG) containing GLO-n. Other methods involve attaching the GalNAc-containing targeting group to a CPG solid support via an ester bond, and then using the resulting CPG with the attached GalNAc targeting group during the synthesis of the sense chain, thereby obtaining a GalNAc targeting group attached to the 3' end of the sense chain.

[0314] The imann residue can be added to the 5' or 3' end of the oligonucleotide chain, and / or further added to the targeting group targeting GalNAc, by methods well known to those skilled in the art, such as the invab method.

[0315] Example 4. In vitro screening of CFB siRNA duplexes

[0316] Huh7 cells were digested with trypsin and adjusted to an appropriate density, mixed with a complex of psiCHECK™-2 vector plasmid and Lipofectamine 2000 (Invitrogen-11668-019), and seeded into 96-well plates. Following the manufacturer's recommendations, cells were transfected with either test or control siRNA using Lipofectamine RNAiMax (Invitrogen-13778-150) concurrently with seeding. The siRNA was tested in triplicate at two concentrations (1 nM and 10 nM).

[0317] Day 1, psiCHECK™-2 vector transfection (one plate)

[0318] (1) Transfer 2.5 μg psiCHECK(TM)-2 vector plasmid into an Eppendorf tube free of RNASE (solution mixing #1).

[0319] (2) Add trypsin to a flask to dissociate Huh7 cells, count the cells using a Vi-Cell counter, and adjust the cell density to 1*10^5 / ml.

[0320] (3) Transfer 7.5 μL of Lipofectamine 2000 (Invitrogen-11668-019) to solutionmix #1 and mix well.

[0321] (4) Add the solution from step 3 to the cell suspension, mix well, and then divide the suspension into 96-well plates (100 μl / well).

[0322] Day 2, siRNA transfection

[0323] (1) Use Culture medium dilution RNAiMAX reagent.

[0324] (2) Dilute siRNA with water that does not contain RNA to prepare a 12× stock solution.

[0325] (3) Mix equal volumes of diluted RNAiMax with siRNA and incubate at room temperature for 15 minutes to allow the complex to form.

[0326] (4) Compound at 45 μl / well Add RNAiMAX (Opti-MEM) mixture to 225 μl / well of fresh DMEM medium, discard the supernatant in the detection plate, and add 120 μl / well of the compound mixture to a 96-well plate.

[0327] (5) Compound-free control wells are defined as cells transfected with psiCHECK™-2 vector and not treated with siRNA; blank control wells are cells-only wells.

[0328] Day 3 Luciferase assay

[0329] (1) Add the reagent to the assay plate and wait 10 minutes for cell lysis to occur.

[0330] (2) Transfer 100 μl of cell lysate to a plate and then measure the bioluminescence of fireflies.

[0331] (3) Take 50 μl of Reagent was added to the assay plate and mixed, and the mixture was allowed to stand for 10 minutes before measuring the luminescence of the sea kidney.

[0332] (4) Calculate the relative expression

[0333] Data Analysis

[0334] Sample well ratio = (renaeus luminescent sample - background blank) / (firefly luminescent sample - background blank)

[0335] Compound-free control well ratio = (control kidney luminescence - background blank) / (control sample firefly luminescence - background blank)

[0336] Inhibition rate = 100 - (sample well ratio / average ratio of compound-free control) × 100%

[0337] The double-stranded sequences used correspond to the sequences shown in Table 5-7.

[0338] Table 5 presents the results of in vitro studies on the inhibition of CFB expression using various CFB RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.

[0339]

[0340]

[0341] Table 6 presents the results of in vitro studies on the inhibition of CFB expression using various CFB RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.

[0342]

[0343]

[0344]

[0345] Table 7 presents the results of in vitro studies on the inhibition of CFB expression using various CFB RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.

[0346]

[0347]

[0348]

[0349] Example 5. In vivo testing of CFB siRNA duplexes

[0350] On day 1, female C57BL / 6J mice (n=4 per group) were infected via intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding the human CFB and luciferase genes. On day 8, mice were subcutaneously administered a single dose of 2 or 3 mg / kg CFB siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, day 15, day 22, and day 29. Plasma samples were isolated, and luciferase activity was measured according to the manufacturer's recommended protocol. Since human CFB expression levels are correlated with luciferase expression levels, the percentage of residual CFB was calculated by comparing luciferase activity before and after treatment in the siRNA treatment group samples, normalized by changes in luciferase activity over the same time period in the control treatment group samples. The results are summarized in Tables 8 and 9.

[0351] Table 8. Screening of single 3mpk subcutaneous doses of CFB siRNA in AAV-CFB transduced mice. The percentage reduction in human CFB in mouse serum was normalized based on CFB expression before siRNA administration and the PBS control group.

[0352]

[0353] Table 9. Screening of CFB siRNA single 2mpk subcutaneous dose in AAV-CFB transduced mice. The percentage reduction in human CFB in mouse serum was normalized based on CFB expression before siRNA administration and the PBS control group.

[0354]

[0355]

[0356] Example 6. In vivo testing of CFB siRNA duplexes

[0357] On day 1, female C57BL / 6J mice (n=4 per group) were infected via intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding the human CFB and luciferase genes. On day 8, mice were subcutaneously injected with a single 2 mg / kg CFB siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, day 18, day 25, and day 32. Plasma samples were separated and serum samples were collected, and protein levels were quantitatively measured by ELISA according to the manufacturer's recommended protocol. Since human CFB expression levels are correlated with luciferase expression levels, the percentage of residual CFB was calculated by comparing samples before and after treatment in the siRNA treatment group, and normalized by ELISA changes in the control group samples over the same time period. The results are summarized in Table 10.

[0358] Table 10. Screening of CFB siRNA with a single 2mpk subcutaneous dose in AAV-CFB transduced mice. The percentage reduction in human CFB in mouse serum was normalized based on CFB expression before siRNA administration and the PBS control group.

[0359]

[0360]

[0361] Blood samples were collected on day 8, before siRNA administration, day 15, day 22, and day 29. The results are summarized in Tables 11 and 12.

[0362] Table 11. Screening of CFB siRNA single 2mpk subcutaneous dose in AAV-CFB transduced mice. The percentage reduction of human CFB in mouse serum was normalized based on CFB expression before siRNA administration and the PBS control group.

[0363]

[0364]

[0365] Table 12. Screening of CFB siRNA single 2mpk subcutaneous dose in AAV-CFB transduced mice. The percentage reduction of human CFB in mouse plasma was normalized based on CFB expression before siRNA administration and the PBS control group.

[0366]

[0367] Example 7. In vivo testing of CFB siRNA duplexes in an NHP PD model

[0368] This study recruited 6-year-old cynomolgus monkeys weighing 3–6 kg, with 3 monkeys in each group. Each monkey received a single subcutaneous injection of 6 mg / kg CFB siRNA reagent or PBS on day 1 (before siRNA administration). After overnight fasting, serum was collected on days -14 (before administration), -7 (before administration), day 1 (before administration), day 8, day 15, day 22, day 29, day 35, day 43, day 50, day 57, day 64, and day 71. Residual CFB protein was determined by Western blotting, and the results are shown in Table 13.

[0369]

[0370]

[0371] Example 9. In vivo testing of CFB siRNA duplexes in an NHP PD model

[0372] This study recruited cynomolgus monkeys (6 years old, weighing 3–6 kg, 3 monkeys per group). After fasting overnight, serum was collected from each monkey on day -14 (before drug administration), day -7 (before drug administration), and day 1 (before drug administration). On day 1 (before siRNA administration), a single subcutaneous injection of 3 mg / kg CFB siRNA or PBS was administered. Sample collection times for each group were: day -14, day -7, day 1, day 8, day 15, day 22, day 29, day 35, day 43, day 50, and day 57. Western blot (WB) was used to detect the residual CFB protein, and the results are shown in Table 17.

[0373] Table 17. Results of serum CFB protein concentration determination by Western blot (WB).

[0374]

[0375] Example 10. In vivo screening of CFB siRNA duplexes.

[0376] Huh7 cells were digested with trypsin, adjusted to an appropriate density, and seeded in 96-well plates. On the second day after seeding, cells were transfected using Lipofectamine 2000 (Invitrogen-11668-019) with the psiCHECK™-2 vector plasmid, blank vector pCNDNA3.0, siRNAs, or control siRNA complex, following the manufacturer's recommended protocol. The siRNA was tested in triplicate at different concentrations (10 nM and 1 nM).

[0377] On day 1, trypsin was added to the culture flask to dissociate Huh7 cells. Cells were counted using a Vi-Cell counter, and the cell density was adjusted to 1*10^5 / ml. The cells were then cultured in DMEM medium.

[0378] On day 2, psiCHECK(TM)-2 vector / blank vector pCDNA3.0 / siRNAs / Lipofectamine 2000 were mixed for transfection.

[0379] (1) Mix an appropriate amount of Lipofectamine 2000 (Invitrogen-11668-019) with... Mix the culture medium (solution mixture #1). Finally, add 0.3 μl of Lipofectamine 2000 and 4.7 μl of [unspecified ingredient] to each well. Culture medium.

[0380] (2) Combine the appropriate psiCHECK(TM)-2 vector, blank pCNDNA 3.0 vector, and siRNAs with... Mix the culture medium (solution mixture #2).

[0381] (3) Mix equal volumes of solution mixture #1 and mixture #2 (mixture #3), resulting in 10 μl per well. Incubate the mixture at room temperature for 15 minutes to form a complex.

[0382] (4) Remove the DMEM medium and add 10 μl of well mixed solution mixture #3 and 90 μl of fresh DMEM medium.

[0383] (5) Compound-free control wells are defined as cells transfected with psiCHECK™-2 vector and blank vector pCNDNA 3.0 and not treated with siRNA; blank control wells contain only cells.

[0384] Day 3 Luciferase assay

[0385] (1) Add the reagent to the test plate and wait 10 minutes to allow the cells to lyse.

[0386] (2) Transfer 100 μl of cell lysate to a plate and then measure the firefly luminescence.

[0387] (3) Take 50 μl of The reagents were added to the detection plate and mixed. After 10 minutes, the Renilla luminescence was measured.

[0388] (4) Calculate relative expression

[0389] Data Analysis

[0390] Sample well ratio = (Sample Renilla luminescence - Background blank) / (Sample Firefly luminescence - Background blank)

[0391] Compound-free control well ratio = (Renilla luminescence of control sample - background blank) / (Firefly luminescence of control sample - background blank)

[0392] Inhibition rate = 100 - (sample well ratio / average ratio of compound-free control) × 100%

[0393] Table 18 presents the experimental results of in vitro studies on the inhibition of CFB expression using various CFB RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.

[0394]

[0395]

[0396] EQUIVALENTS

[0397] Although several embodiments of the invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing functions and / or obtaining results and / or one or more advantages described herein, and each of these variations and / or modifications is considered to be within the scope of the invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended as examples, and actual parameters, dimensions, materials, and / or configurations will depend on the specific application using the teachings of this invention. Those skilled in the art will recognize, or be able to determine, many equivalents of the specific embodiments of the invention described herein using only conventional experiments. Therefore, it should be understood that the foregoing embodiments are presented by way of example only and within the scope of the appended claims and their equivalents; the invention may be practiced in ways different from the specific descriptions and claims. The invention relates to each individual feature, system, article, material, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods, provided that such features, systems, articles, materials, and / or methods do not contradict each other, is included within the scope of the invention.

[0398] All definitions defined and used in this document should be understood as control dictionary definitions, definitions referenced in incorporated documents, and / or the general meaning of the defining terms.

[0399] The indefinite articles “a” and “an” used in this specification and claims, unless otherwise expressly stated, shall be understood as “at least one”.

[0400] The phrase “and / or” as used in the specification and claims shall be understood as “any one or both” of the combined elements, that is, the elements exist together in some cases and separately in others. Other elements may optionally exist in addition to those expressly identified in the “and / or” clause, whether related to or unrelated to the expressly identified elements, unless otherwise expressly stated.

[0401] All references, patents, patent applications and publications cited or mentioned in this application are incorporated herein by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO:2 by no more than 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary to each other.

2. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 483-513, 486-516, 491-521, 483-521, 513-543, 987-1017, 989-1019, 1317-1347, 2237-2267, and 2439-2469 from SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence from SEQ ID NO: 2, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary to each other.

3. The dsRNA agent according to claims 1-2, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 488-508, 491-511, 496-516, 488-516, 518-538, 992-1012, 994-1014, 1322-1342, 2242-2262, or 2444-2464 from SEQ ID NO:1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO:

2.

4. The dsRNA agent of claim 1, wherein the antisense strand comprises a region complementary to the CFB RNA transcript, the complementary region comprising at least 15 consecutive nucleotides differing from any antisense sequence listed in any of Tables 1-3 by no more than 1, 2, or 3 nucleotides.

5. The dsRNA agent of claim 1, wherein the antisense strand comprises a region complementary to the CFB RNA transcript, the region comprising at least 15 consecutive nucleotides from any of the antisense sequences listed in any one of Tables 1-3.

6. The dsRNA agent of claim 1, wherein the double-stranded ribonucleic acid (dsRNA) agent is used to inhibit CFB expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 of the antisense strand comprise a region complementary to the CFB RNA transcript, wherein the complementary region comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally comprises a targeting ligand.

7. The dsRNA agent of claim 6, wherein the region complementary to the CFB RNA transcript comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides, which differ from one of the antisense sequences listed in any one of Tables 1-3 by no more than 3 nucleotides.

8. The dsRNA agent according to any one of claims 1-7, wherein the antisense strand of the dsRNA is substantially or completely complementary to any target region of SEQ ID NO:1, and preferably the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1-3.

9. The dsRNA agent according to any one of claims 1-8, wherein the sense sequence and the antisense sequence in the dsRNA agent are at least substantially complementary or completely complementary, preferably, wherein the dsRNA agent comprises any one of the sense sequences described in Tables 1-3.

10. The dsRNA agent according to any one of claims 1-9, wherein the dsRNA agent comprises a sequence listed as a double-stranded sequence in any one of Tables 1-3.

11. The dsRNA agent according to any one of claims 1-10, wherein the dsRNA agent comprises at least one modified nucleotide.

12. The dsRNA agent according to any one of claims 1-11, wherein all or substantially all nucleotides of the sense strand and / or antisense strand are modified nucleotides.

13. The dsRNA agent of any one of claims 1-12, wherein the double-stranded ribonucleic acid (dsRNA) agent is used to inhibit CFB expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region partially complementary to the CFB RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand comprises a sequence that can be represented by formula (I): 5′-(N′ L ) n′ N′ L N′ L N′ L N′ L N′ F N′ L N′ F N′ L N′ N1 N′ N2 N′ L N′ L N′ L N′ L N′ L (N′ L ) m′ -3′(I) Like: Each N' F Represents nucleotides with 2'-fluorine modification; each N′ N1 and N′ N2 Independently representing modified or unmodified nucleotides; each N' L The m' and n' are independent integers from 0 to 7, representing modified or unmodified nucleotides, but not 2'-fluorinated nucleotides.

14. The dsRNA agent according to any one of claims 1-12, wherein the double-stranded ribonucleic acid (dsRNA) agent is used to inhibit CFB expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are complementary, wherein the antisense strand contains a region partially complementary to the CFB RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand contains a sequence that can be represented by formula (II): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5′(II) in: Each N F Represents nucleotides with 2'-fluorine modification; each N M1 N M2 N M3 N M4 N M5 and N M6 Each N represents a modified or unmodified nucleotide independently; L Independently represents a modified or unmodified nucleotide but not a 2'-fluorinated nucleotide, and n is an integer from 0 to 7.

15. The dsRNA agent according to any one of claims 1-12, wherein the double-stranded ribonucleic acid (dsRNA) agent is used to inhibit CFB expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand and the antisense strand are complementary, wherein the antisense strand contains a region complementary to the CFB RNA transcript, wherein the complementary region contains at least 15 consecutive nucleotides, wherein the dsRNA comprises a duplex represented by formula (III): Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ L N′ F N′ L N′ F N′ L N′ N1 N′ N2 N′ L N′ L N′ L N′ L N′ L (N′ L ) m′ -3′ Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5′ (III) in: Each chain is approximately 18 to 30 nucleotides in length; Each N F and N' F Independently represents a nucleotide modified with 2'-fluorine; N M1 N M2 N M3 N M4 N M5 、N′ N1 and N′ N2 Each can independently represent a modified or unmodified nucleotide; N' N1 and N' N2 Contains only one 2'-fluorinated nucleotide; N M1 N M2 N M3 N M4 N M5 and N M6 It has only three 2'-fluorinated nucleotides; each N L and N' L Each nucleotide can be used independently to represent a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification, and each of m', n' and n can be an integer from 0 to 7.

16. The dsRNA agent according to any one of claims 11-15, wherein the one or more modified nucleotides are independently selected from: 2'-O-methyl nucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2'3'-seco nucleotide mimics, locked nucleotides, unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, debased nucleotides, ribitol, reverse nucleotides, reverse debased nucleotides, isomannoside nucleotides, reverse 2'-OMe nucleotides, reverse 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholinonucleotides, 3'-OMe nucleotides, nucleotides containing a 5'-thiophosphate group, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bis(decylamide) group, 2'-amino-modified nucleotides, aminophosphates, or nucleotides containing non-natural bases.

17. The dsRNA agent according to any one of claims 1-16, wherein the 5' end of the guide strand comprises an E-vinylphosphonate nucleotide.

18. The dsRNA agent according to any one of claims 1-17, wherein the dsRNA agent comprises at least one phosphate thioester nucleoside internucleotide bond.

19. The dsRNA agent according to any one of claims 1-17, wherein the sense strand comprises at least one phosphate thioside internucleotide bond.

20. The dsRNA agent according to any one of claims 1-17, wherein the antisense strand comprises at least one phosphate thioside internucleotide bond.

21. The dsRNA agent according to any one of claims 1-17, wherein the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.

22. The dsRNA agent according to any one of claims 1-17, wherein the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.

23. The dsRNA agent according to any one of claims 1-22, wherein the modified sense strand is a modified sense strand sequence shown in any one of Tables 2-3.

24. The dsRNA agent according to any one of claims 1-22, wherein the modified antisense strand is a modified antisense strand sequence shown in any one of Tables 2-3.

25. The dsRNA agent according to any one of claims 1-24, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides.

26. The dsRNA agent according to any one of claims 1-25, wherein the length of the complementary region is 19-21 nucleotides.

27. The dsRNA agent according to any one of claims 1-26, wherein the length of each strand does not exceed 30 nucleotides.

28. The dsRNA agent according to any one of claims 1-26, wherein the length of each strand does not exceed 25 nucleotides.

29. The dsRNA agent according to any one of claims 1-26, wherein the length of each strand does not exceed 23 nucleotides.

30. The dsRNA agent according to any one of claims 1-29, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.

31. The dsRNA agent of claim 30, wherein one or more targeting groups or linking groups are conjugated to a sense strand.

32. The dsRNA agent of claim 30 or 31, wherein the targeting group or linking group comprises N-acetylgalactosamine (GalNAc).

33. The dsRNA agent according to any one of claims 30-32, wherein the targeting group has the following structure: "n" can be 1 or 2 independently.

34. The dsRNA agent according to any one of claims 30-33, wherein the targeting group has the following structure:

35. The dsRNA agent of any one of claims 1-34, wherein the dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand.

36. The dsRNA agent of any one of claims 1-34, wherein the dsRNA agent comprises a targeting group conjugated to the 3' end of the sense strand.

37. The dsRNA agent according to any one of claims 1-34, wherein the antisense strand contains a reverse debasement residue at its 3' end.

38. The dsRNA agent according to any one of claims 1-34, wherein the sense strand contains one or two reverse debasement residues or imann residues at the 3' and / or 5' ends.

39. The dsRNA agent according to any one of claims 1-38, wherein the dsRNA agent has two blunt ends.

40. The dsRNA agent according to any one of claims 1-38, wherein at least one strand comprises a 3' overhang of at least one nucleotide.

41. The dsRNA agent according to any one of claims 1-38, wherein at least one strand comprises a 3' overhang of at least two nucleotides.

42. The dsRNA agent according to any one of claims 1-41, wherein the CFB RNA transcript is SEQ ID NO:

1.

43. A composition comprising the dsRNA agent according to any one of claims 1-42.

44. The composition of claim 43, further comprising a pharmaceutically acceptable carrier.

45. The composition of claim 44, further comprising one or more additional therapeutic agents.

46. ​​The composition of claim 45, wherein the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial.

47. The composition of any one of claims 43-46, wherein the composition is formulated for subcutaneous or intravenous (IV) administration.

48. A cell comprising the dsRNA agent of any one of claims 1-42, wherein the cell is optionally a mammalian cell, optionally a human cell.

49. A method for inhibiting CFB gene expression in cells, the method comprising: (i) Preparing cells containing an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-42 or the composition of any one of claims 43-47.

50. The method of claim 49, further comprising: (ii) The cells prepared in claim 49(i) are maintained for a sufficient time to allow for the degradation of the mRNA transcript of the CFB gene, thereby inhibiting the expression of the CFB gene in the cells.

51. The method of any one of claims 49-50, wherein the cells are located in the subject and the dsRNA agent is administered subcutaneously to the subject.

52. The method of any one of claims 49-50, wherein the cells are located in the subject and the dsRNA agent is administered to the subject via IV.

53. The method of claim 51 or 52, further comprising assessing the repression of the CFB gene after administration of a dsRNA agent to a subject, wherein the means for assessment include: (i) Identify one or more physiological characteristics of the subject’s CFB-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline pre-treatment physiological characteristics of CFB-related diseases or conditions and / or with control physiological characteristics of CFB-related diseases or conditions. The comparisons described herein indicate one or more of the presence or absence of inhibition of CFB gene expression in the subjects.

54. The method of claim 53, wherein the determined physiological characteristic is one or more of the following: CFB mRNA level, CFB protein level, or CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level in the subject; and any one or more of C3, C9, C5, C5a, C5b and soluble C5b-9 complex levels.

55. The method of claim 54, wherein one or more of the following are reduced: the subject's CFB mRNA level, the subject's CFB protein level; and / or one or more of the following are reduced: CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, the level of any one or more of the C3 / C9 / C5 / C5a / C5b / soluble C5b-9 complex, and lipid levels in blood or serum, indicating a decrease in CFB gene expression in the subject.

56. A method for inhibiting CFB gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-42 or a composition according to any one of claims 43-47.

57. The method of claim 56, wherein the dsRNA agent is administered subcutaneously to the subject.

58. The method of claim 56, wherein the dsRNA agent is administered to the subject via IV administration.

59. The method of any one of claims 56-58, further comprising evaluating the repression of the CFB gene after administration of the dsRNA agent, wherein the means for evaluation include: (i) Identify one or more physiological characteristics of the subject’s CFB-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline pre-treatment physiological characteristics of CFB-related diseases or conditions and / or with control physiological characteristics of CFB-related diseases or conditions. The comparisons described therein indicate one or more instances of the presence or absence of inhibition of CFB gene expression in the subjects.

60. The method of claim 60, wherein the determined physiological characteristic is one or more of the following: CFB mRNA level, CFB protein level, or CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level in the subject; any one or more of C3, C9, C5, C5a, C5b, soluble C5b-9 complex levels, and lipid levels in blood or serum.

61. The method of claim 60, wherein a decrease in one or more of the subject's CFB mRNA level and the subject's CFB protein level; and / or a decrease in one or more of the following: CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, C3, C9, C5, C5a, C5b, soluble C5b-9 complex level, and lipid levels in blood or serum, indicates a decrease in the subject's CFB gene expression.

62. A method for treating a disease or condition associated with the presence of CFB protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-42 or a composition according to any one of claims 43-47 to inhibit CFB gene expression.

63. The method of claim 62, wherein the disease or condition is one or more of the following: autoimmune diseases; complement system dysfunction, including abnormal upregulation of complement components, such as CFB, C3 glomerulonephropathy (C3G), systemic lupus erythematosus (SLE), lupus nephritis; Ig-mediated kidney diseases, such as IgA nephropathy and primary membranous nephropathy, nephrotic syndrome, diabetic nephropathy, polycystic kidney disease, membranous nephropathy; age-related macular degeneration (AMD), including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia-reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatic diseases, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), immune disorders. Complex-mediated glomerulonephritis (IC-mediated GN), post-infectious glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid antibody syndrome (APS), dysbiosis-related periodontitis, malarial anemia, bullous pemphigoid dermatomyositis, Shiga toxin E. coli-associated hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposition disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular transplant rejection, graft dysfunction, myocardial infarction, graft allergy, hyperlipidemia, and sepsis.

64. The method of claim 63, further comprising administering an additional treatment to the subject.

65. The method of claim 64, wherein the additional treatment option comprises: The administration of one or more of the present invention’s CFB antisense polynucleotides to the subject, the administration of a non-CFB dsRNA therapeutic agent to the subject, and behavioral modifications to the subject.

66. The method of claim 65, wherein the non-CFB dsRNA therapeutic agent is one or more of the following: a C5 inhibitor, such as an anti-complement component C5 antibody or its antigen-binding fragment (e.g., eculizumab, ravulizumab-cwvz, or pozelimab (REGN3918)) or a C5 peptide inhibitor (e.g., zilucoplan); a C3 peptide inhibitor (e.g., campstatin).

67. The method of any one of claims 62-66, wherein the dsRNA agent is administered subcutaneously to the subject.

68. The method of any one of claims 62-66, wherein the dsRNA agent is administered to the subject via IV administration.

69. The method of any one of claims 62-69, further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.

70. The method of claim 69, wherein the method for determining the efficacy of the treatment in the subject comprises: (i) Identify one or more physiological characteristics of the subject’s CFB-related disease or condition, and (ii) Compare the identified physiological characteristics with the baseline pre-treatment physiological characteristics of CFB-related diseases or conditions. The comparisons indicate the presence, absence, and efficacy levels of a double-stranded RNA (dsRNA) agent administered to the subjects.

71. The method of claim 70, wherein the determined physiological characteristics are: the subject's CFB mRNA level, CFB protein level, or CH50 activity, AH50, lactate dehydrogenase (LDH), and hemoglobin level. The levels of one or more of C3, C9, C5, C5a, C5b, and soluble C5b-9 complexes, and lipid levels in blood or serum.

72. The method of claim 70, wherein a decrease in one or more of the subject's CFB mRNA level, CFB protein level, and / or a decrease in one or more of the following: CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, levels of one or more of C3, C9, C5, C5a, C5b, soluble C5b-9 complex, and lipid levels in blood or serum, indicates that administration of the double-stranded RNA (dsRNA) agent to the subject is effective.

73. A method for reducing the level of CFB protein in a subject compared to a baseline pre-treatment level of CFB protein in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-42 or a composition according to any one of claims 43-47 to reduce the level of CFB gene expression.

74. The method of claim 73, wherein the dsRNA agent is administered subcutaneously to the subject or administered via intravenous injection to the subject.

75. A method for altering the physiological characteristics of a subject with CFB-related disease or condition compared to baseline pre-treatment physiological characteristics of the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-42 or a composition according to any one of claims 43-47 to alter the physiological characteristics of the subject with CFB-related disease or condition.

76. The method of claim 75, wherein the dsRNA agent is administered subcutaneously to the subject or administered via intravenous injection to the subject.

77. The method of any one of claims 75-76, wherein the physiological characteristic is one or more of the following: CFB mRNA level, CFB protein level, CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level in the subject; any one or more of C3, C9, C5, C5a, C5b, soluble C5b-9 complex, and lipid level in blood or serum.

Citation Information

Patent Citations

  • Drug delivery product and methods

    US20050281781A1

  • Anti-c5 antibodies and uses thereof

    US20170355757A1

  • Drug-delivery system

    US3854480A

  • Seal-lock

    US426220A

  • Cholesterol matrix delivery system for sustained release of macromolecules

    US4452775A