Engineering bacterium for producing amino sugar intermediate as well as construction method and application of engineering bacterium

Abstract

The invention belongs to the technical field of bioengineering, and provides an engineering bacterium for producing an amino sugar intermediate as well as a construction method and application thereof, the engineering bacterium for producing the amino sugar intermediate inhibits synthesis of validamycin by knocking out genes on the basis of streptomyces hygroscopicus, and valilone synthetase is over-expressed. The engineering bacterium disclosed by the invention realizes high-yield effective alcohol amine through multiple modifications, and the yield reaches 318.8 mg / L.

Description

Technical Field

[0001] This application belongs to the field of bioengineering technology. Specifically, this application provides an engineered bacteria for producing amino sugar intermediates, its construction method, and its application. Background Technology

[0002] The aminoglycoside intermediate, effective alcoholamine, belongs to the aminocyclic alcohol class of compounds. Its chemical name is (1S,2S,3R,4S,5R)-5-(1,3-dihydroxypropane-2-ylamino)-1-(hydroxymethyl)-1,2,3,5-cyclohexanetetraol, and its chemical structural formula is shown in Formula I.

[0003]

[0004] This compound exhibits strong α-D-glucosidase inhibitory activity and is the core structure of a pseudoaminoglycolase inhibitor.

[0005] Effective alcoholamines are direct precursors of the diabetes drug voglibose, which has good hypoglycemic properties and few side effects, and is widely used in clinical practice. Currently, the main reported production methods for effective alcoholamines both domestically and internationally are "bio-fermentation + chemical synthesis," which involves using jinggangmycin A as a substrate, microbial fermentation to obtain jinggangmycin-enamine, and then performing multiple organic synthesis reactions to obtain the effective alcoholamine. This process is lengthy, has a low overall yield, high production costs, uses various organic solvents, poses high safety risks, and is environmentally unfriendly.

[0006] In 2022, Kyowa Hakko Co., Ltd. publicly reported (JP 2022-45001) that it had constructed an engineered strain of Escherichia coli that could directly ferment to produce effective alcohol amines, but its fermentation unit could only reach about 100 mg / L, which could not meet the needs of industrial production.

[0007] There is a real need in the art to provide a high-yield strain of effective alcoholamines to solve the above problems. Summary of the Invention

[0008] On the one hand, this application provides an engineered bacterium for producing amino sugar intermediates, which is based on Streptomyces hygroscopicus and inhibits the synthesis of jinggangmycin by gene knockout.

[0009] Furthermore, the engineered bacteria overexpress valiolone synthase.

[0010] Furthermore, the absorbed Streptomyces hygroscopicus var. Jinggangensis (subspecies) is PY05, which was deposited on July 15, 2024, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31292.

[0011] Furthermore, the gene being knocked out is selected from one or more of valA, valK, and valN.

[0012] Furthermore, the genes that were knocked out were valA, valK, and valN.

[0013] Furthermore, the nucleotide sequence of valA is SEQ ID NO.1, the nucleotide sequence of valK is SEQ ID NO.2, and the nucleotide sequence of valN is SEQ ID NO.3.

[0014] Furthermore, the knockout of valA, valK, and / or valN includes inserting upstream and downstream homologous fragments of the gene into the free vector pJTU1278 to construct a deletion plasmid.

[0015] Furthermore, the nucleotide sequence of the valiolone synthase is SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11.

[0016] Furthermore, the nucleotide sequence of the valiolone synthase is SEQ ID NO.5.

[0017] Furthermore, the overexpression of valiolone synthase comprises a pPM927 plasmid as a backbone, with the addition of a promoter P that drives valiolone synthase expression. valA Construct overexpression plasmids.

[0018] Furthermore, the engineered bacteria were deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 35869.

[0019] On the other hand, this application provides the application of the above-mentioned engineered bacteria in the production of amino sugar intermediates.

[0020] Furthermore, the amino sugar intermediate is an effective alcohol amine.

[0021] On the other hand, this application provides the application of the above-mentioned engineered bacteria in the production of voglibose.

[0022] Furthermore, in the application, the engineered bacteria are fermented to produce amino sugar intermediates.

[0023] Furthermore, the culture medium used in the fermentation culture contains 40-120 g / L rice flour, 5-20 g / L peanut flour, 0.5-5 g / L potassium dihydrogen phosphate, 0.5-1 g / L calcium carbonate, and 1-10 g / L sodium chloride.

[0024] Furthermore, the culture medium used in the fermentation culture contains 90-110 g / L rice flour, 16-20 g / L peanut flour, 0.5-1 g / L potassium dihydrogen phosphate, 0.5-0.7 g / L calcium carbonate, and 1-2 g / L sodium chloride.

[0025] Furthermore, the culture medium used in the fermentation culture contains 100 g / L rice flour, 18 g / L peanut flour, 0.7 g / L potassium dihydrogen phosphate, 0.6 g / L calcium carbonate, and 1.4 g / L sodium chloride.

[0026] Furthermore, in the fermentation culture, engineered bacteria are inoculated into the culture medium at an inoculation rate of 1%-15%.

[0027] Furthermore, in the fermentation culture, the engineered bacteria are inoculated into the culture medium at an inoculation rate of 8%-12%.

[0028] Furthermore, in the fermentation culture, the engineered bacteria are inoculated into the culture medium at an inoculation rate of 10%.

[0029] Furthermore, the fermentation and culture time is more than 90 hours.

[0030] Furthermore, the fermentation time is 96-120 hours.

[0031] Furthermore, the fermentation time is 96 hours.

[0032] Furthermore, the fermentation culture temperature is 30-40℃.

[0033] Furthermore, the fermentation culture temperature is 35-40℃.

[0034] Furthermore, the fermentation culture temperature was 37°C.

[0035] On the other hand, this application provides a method for constructing the above-mentioned engineered bacteria, the method comprising inhibiting jinggangmycin synthesis by gene knockout based on Streptomyces hygroscopicus PY05, and overexpressing valiolone synthase.

[0036] Furthermore, the genes that were knocked out were valA, valK, and valN.

[0037] Furthermore, the nucleotide sequence of valA is SEQ ID NO.1, the nucleotide sequence of valK is SEQ ID NO.2, and the nucleotide sequence of valN is SEQ ID NO.3.

[0038] Furthermore, the nucleotide sequence of the valiolone synthase is SEQ ID NO.5.

[0039] The knockout, insertion, and overexpression genes in this application can be performed using various genetic engineering techniques known in the art, including but not limited to CRISPR-based methods, TALENs, RNA interference, transposons, homologous recombination, and various commercially available and self-made overexpression / deletion plasmids.

[0040] In this application, "effective alkanolamine," "Jinggangmycin alkanolamine," and "valiolamine" refer to the same compound and can be used interchangeably to indicate the same meaning; the CAS number of this compound is 83465-22-9, and its chemical formula is shown in Formula I:

[0041]

[0042] Based on the analysis of metabolites and pathways, this application utilizes various genetic engineering techniques to modify existing strains, achieving for the first time the large-scale fermentation production of effective alcoholamines. This application solves problems related to cost, equipment conditions, and environmental pollution associated with the chemical synthesis of effective alcoholamines, providing favorable conditions for the improvement of the production of diabetes drugs such as voglibose. Attached Figure Description

[0043] Figure 1 A schematic diagram of the construction process of GZY-1 (the gene valK is deleted in the same frame as PY05: the upstream and downstream homologous fragments of the valK gene are inserted into the free vector pJTU1278 to construct the recombinant plasmid pLQ1801 for valK gene deletion. After homologous recombination, 669 bp of the full-length 975 bp valK gene is deleted, resulting in the valK gene deletion mutant strain, named GZY-1).

[0044] Figure 2The diagram illustrates the construction process of GZY-13 (the gene valN is deleted in the same frame as in GZY-1: the upstream and downstream homologous fragments of the valN gene are inserted into the free vector pJTU1278 to construct the recombinant plasmid pLQ1811 for valN gene deletion. After homologous recombination, 762 bp of the full-length 996 bp valN gene is deleted, resulting in the valN gene deletion mutant strain, named GZY-13).

[0045] Figure 3 The diagram illustrates the construction process of GZY-14 (the gene valA is deleted in the same frame as in GZY-13: the upstream and downstream homologous fragments of the valA gene are inserted into the free vector pJTU1278 to construct the recombinant plasmid pLQ1812 for valA gene deletion. After homologous recombination, 1,062 bp of the full-length 1,245 bp valA gene is deleted, resulting in the valA gene deletion mutant strain, named GZY-14).

[0046] Figure 4 The expression plasmid structure used in the construction of GZY-15 (construction of overexpression plasmid pLQ1813: this plasmid uses pPM927 as the backbone and uses the promoter P) valA Overexpression of the driver gene amir_2000).

[0047] Figure 5 The image shows the 1H NMR spectrum of the fermentation products of GZY-15.

[0048] Figure 6 This is the carbon spectrum of the fermentation products of GZY-15.

[0049] Figure 7 This is a high-resolution mass spectrum of the fermentation product of GZY-15.

[0050] Figure 8 The expression plasmid structure used in the construction of GZY-16 (construction of overexpression plasmid pLQ1814: this plasmid uses pPM927 as the backbone and uses the promoter P) valA Overexpression of the driver gene EVS-1, similar to GZY-17 to 22).

[0051] Figure 9 The image shows the results of HPLC-TOF / MS analysis of the fermentation products of GZY-16 to 22.

[0052] Figure 10 The graph shows the yield results of fermentation products from GZY-16 to 22.

[0053] Figure 11 The image shows the 1H NMR spectrum of the fermentation products of GZY-16.

[0054] Figure 12This is the carbon spectrum of the fermentation products of GZY-16.

[0055] Figure 13 This is a high-resolution mass spectrum of the fermentation products of GZY-16.

[0056] Figure 14 The results are analyzed by single-crystal determination of fermentation products.

[0057] Figure 15 This is the analytical data for single-crystal determination of fermentation products.

[0058] Figure 16 The image shows the 1H NMR spectrum of the fermentation products of GZY-22.

[0059] Figure 17 This is the carbon spectrum of the fermentation products of GZY-22.

[0060] Figure 18 This is a high-resolution mass spectrum of the fermentation products of GZY-22. Detailed Implementation

[0061] Related sequences:

[0062] valA: (SEQ ID NO.1);

[0063]

[0064] valK:(SEQ ID NO.2);

[0065] ATGTCAGCCCGCCACATCAGCCGGAGGAAACACATGTCTGACCTTCGCTCGTCGCCACTCGTACTCCGGCCAGGCACGGCGGCACCTGCCGTGCCTGGCCGCATCCTGATCCTCGGTTCCGGCTACCTTGCCGGGCACATCGCCGCCCGCCTCACCCGGCTCGGCGCCGAGACAGTGCTCAGCTCCCGGCGTGCCCCAGTCCTCCCCGAGAGCCGAGGTGTGCGCTGGAAGCAGGTCGATGTCACCTCGGGCCCGCAGGTGGCTGCCTTGATGGATGCCGTCGAGCCCGATGCCGTCGTGGCCGTGCACGGCCCCTCCGACATCACTTGGTGCGAGTCGCATCCCGAAGAGGCATACGCCACCCACCACGGTGGTGCCCGCAACATCGCAGCCGCACTGGACGGCCGCCCCGTCCTGCTGGTGTCGACCGACAACGTTTTCTCCGGCGAGGACGAGAGCTACGGGGAGTCAGCACAGACCTTCCCGGTCAACGCCTACGGCCGGGCGAAGCTCGCGGCCGAGCGGGAGCTGCTCGACACCTCCTCCGCTCTTGTCCTGCGTGTGAGCCTGGTCTACGGCTGGGAGGATCGCGGTCCGCGGCCCAACTTCCTGACCAGTGTGGTTCGTTCGCTGATGCGCAAGGAGCAGCTACGGATCCCCGACGACCACTGGAACACCCCCGTTCACGTCGAGGACGTGGCCGCGTGGGCGACGACACTGATGAGTTCCGGCCGCACCGGAACGCTGCACCTCGGCGGGCCGCGCCGCATCGGCCGAGTCGACTGGGCCAGACACATCGCCGAGCAACTCGGCGTGGACCCCATGCTCATCGTGCCGACGCCGCGTATCGGCACCGCCTACGCCTGCCGGCCGCGCAACGCCTGTCTACACAGCGAGGTGGCCGCGCAGTTGCCCGAACTGCAACACCACCGCCCGGCCGACGTCCTCGAAACCACCCATGCCCTCATCTCCTGA

[0066] valN:(SEQ ID NO.3);

[0067] GTGACTCTGGAGGAGGGCGGGCCCCGTCTGCACCGCTCGCCGCCGCCGCGCCCGCGTGAAGATCCCGCCGTACTCGTCGGCATCGAACTGGCCGCGCTGTGCCGCTCCGACCTCAAGGAGGTAGCCGGCACCCGTCACGGCCCCAGCCAGTTCGGGCACGAACTCGTCGGTGTCGTCCGCGAGTCCACCACCTCTGCGTTCGCCGAAGGCACTCGCGTCGTCCTGGACCCGAACGTGAAGGTGGAGCGGGGCACCGGGTTCGCCGATCACATGTGGGCGGCGGGCCCGGACGACCTGCTGCGGCACGCCCTGCAACCGGTACCGCACGGCCCGGCCGCCCGTCGCCTGGTCTTCGCCGAGCCGATCGCCTGCGCCCAGCACTGTCTGAGCGCCATCAAGGGGCAGGTCGGCAGCCTGCGGGGTGCACAAGTCGTGGTGCTCGGTGCCGGGACCGCCGGGCTCTTCATCGCGGCGCTCGCCGAGCGTGCGGGCGCCCAGGTGTCGGTCTGCAATCGGAGCCGCGCTCGGATGGATGCGGCCCGCAAGGCGGACCTGCTCGATGTACCCACACTGCTCTTCGGTGAACTGGCTGGAGACAGGGCCGACGTGGTGGTGGTCGCCACCAGCTTCGTGACGCCCACCGTGCTGGACGAGGCGCTACGCCTGGTCGCGCCAGGTGGTCTGGTGCTGCTCTACGGTGGCACCGCACCAGGTGACCGGCACCCCGGGCTGGAATGTGACCTCGATCAAGTGCGGCGCACCGAGGCCGTCGCCGCCTGCACCTGGCAGGGCCACTCACTCCATGTGGCCGGCAGCTACGGCACGACCGCGGAGGATTTCGCTACCGCGATCGGTGACCTCACTGACGCGGCGTCACCTCTGCGCGCCGAAGCCCTGGTGGCTGCTGAAGTGGACCTGCCAGGCTTGCTCGGACTGCTGCGGACCCCGGATGCCCTTGGACCCGGCAAGATCGTTGTCCACCCCGAACCCTTCTGA

[0068] amir_2000:(SEQ ID NO.4);

[0069]

[0070] EVS-1:(SEQ ID NO.5);

[0071]

[0072] EVS-2:(SEQ ID NO.6);

[0073]

[0074] EVS-3:(SEQ ID NO.7);

[0075]

[0076] EVS-4:(SEQ ID NO.8);

[0077]

[0078] EVS-5:(SEQ ID NO.9)。

[0079]

[0080] EVS-6:(SEQ ID NO.10)。

[0081]

[0082] EVS-7:(SEQ ID NO.11)。

[0083]

[0084] Strains: The starting strain PY05 (S. hygroscopicus var. jinggangensis) in this example is a strain derived from the high-yield jinggangmycin strain TL01, by deleting shbR1 (SHJG7318), shbR3 (SHJG4003), and valJ, and introducing the ΦC31 attB site (for specific construction methods, see: Peng Yao, Genetic Engineering Modification of High-Yielding Jinggangmycin Strains, CNKI Master's Thesis Electronic Journal, 2020, No. 03). This strain was deposited on July 15, 2024, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31292. Culture media and basic fermentation methods:

[0085] Fermentation medium: First, prepare an inorganic salt stock solution, with each liter containing 0.6g calcium carbonate, 1.4g sodium chloride, and 0.7g potassium dihydrogen phosphate. Dispense the solution into 250mL Erlenmeyer flasks, adding 50mL of the inorganic salt solution to each flask. Then weigh out 5g of rice flour and 0.9g of peanut flour, sterilize at 121℃ for 30min, and store at room temperature.

[0086] Liquid seed culture of *S. hygroscopicus* var. *jinggangensis* was performed using TSBY medium. For inoculation, a 1 cm section was cut from a solid medium containing aerial mycelia. 2 Small pieces of the culture were inoculated into 30 mL / 250 mL TSBY medium and cultured at 30°C and 220 rpm for 36-48 h until the mycelium grew densely. For fermentation, 5 mL of the seed culture was inoculated into 50 mL / 250 mL Jinggangmycin fermentation medium and cultured at 37°C and 220 rpm for 4 days.

[0087] Example 1: Production of valiolamine isomers from PY05 fermentation

[0088] The fermentation broth of PY05, fermented in shake flasks at 37°C for 4 days, was analyzed using HPLC-TOF / MS. In positive ion mode, the characteristic ion of valiolamine was extracted, with a theoretical m / z of 194.1023 [M+H]. + The results showed that m / z = 194.1010[M+H] was detected at a retention time of 7.3 min. + The ion peaks and the corresponding [M+Na] + (m / z = 216.0827) and [M+K] +(m / z = 232.0565) peak. These results indicate that PY05 is very likely to generate and accumulate valiolamine or its isomers.

[0089] To further clarify the structure of the product, it was isolated, purified, and its structure was identified. 4 L of fermentation broth was collected, and after centrifugation to remove the bacterial cells, it was first decolorized using macroporous resin D201, and then purified using a Dowex 50W×8 (H) resin. + The amino-containing compounds were enriched using a (type) cation exchange resin. Further separation was then performed using Sephadex LH-20 molecular sieve chromatography to obtain a crude product containing the target compounds. Finally, the product was purified by Dowex 1×8 (OH) chromatography. - The product was further purified using an anion exchange resin of type (50:50, v / v), eluted with ethanol / water (50:50, v / v), and finally lyophilized to obtain a white powdery purified product.

[0090] The product 1 The 1H NMR spectrum showed two characteristic methylene proton signals at the C-6 position [2.01 (dd, J = 15.5, 2.1 Hz) and 1.82 (dd, J = 15.5, 3.8 Hz)], as well as the remaining proton signals attributed to the cyclic alcohol skeleton. 13 C10 NMR and DEPT-135 spectra show that the compound has a total of 7 carbon signals, including a quaternary carbon signal [75.69 (C5)], a methylene carbon signal [31.11 (C6)], and a signal linked to an amino group [50.62 (C1)].

[0091] These characteristics are highly similar to the spectrum of the standard valiolamine. However, the chemical shifts of the proton signal at position C-2 [3.71 (dd, J = 10.0, 4.4 Hz)], position C-4 [3.48 (d, J = 9.5 Hz)], and position C-6 (methylene proton signal [2.01 and 1.82 ppm]] are generally shifted to a lower field compared to the corresponding signals in the valiolamine standard (C-2: [3.58 (dd, J = 9.9, 4.2 Hz)]; C-4: [3.42 (dd, J = 9.5 Hz)]; C-6: [1.89 and 1.70 ppm]). This change may originate from the difference in shielding effect caused by the change in the configuration of the hydroxyl group at position C-5, suggesting that this compound is a stereoisomer of valiolamine.

[0092] Table 1. 5-epi-valiolamine and valiolamine 1 H and 13 C NMR data

[0093]

[0094]

[0095] 1 H and 13 C NMR data are recorded at 600and 150MHz,respectively.

[0096] Based on mass spectrometry and NMR data, it was basically confirmed that the product is the stereoisomer of valiolamine, 5-epi-valiolamine.

[0097] Example 2: Reduced byproducts and increased 5-epi-valiolamine yield

[0098] The main fermentation product of PY05 is jinggangmycin A, which not only results in only a small amount of metabolic flux flowing to the synthesis of 5-epi-valiolamine, reducing synthesis efficiency, but also leads to a large accumulation of jinggangmycin A in the fermentation broth, increasing the difficulty of 5-epi-valiolamine purification. To obtain a chassis strain more suitable for 5-epi-valiolamine production, reduce the synthesis of byproducts such as jinggangmycin A and available oxamine A, and guide the metabolic flux to the synthesis of 5-epi-valiolamine as much as possible, this study investigated the synthesis of 5-epi-valiolamine using GZY-1(PY05ΔvalK). Figure 1 Based on this, valN was further knocked out to construct the double knockout mutant strain GZY-13. Figure 2 The study also compared and analyzed the changes in metabolites in the fermentation broth.

[0099] The fermentation broth of GZY-13 after 4 days of shake-flask fermentation at 37℃ was analyzed by HPLC-TOF / MS. The results showed that, compared to PY05, no jinggangmycin A or available oxamine A was detected in the fermentation broth of GZY-13, indicating that GZY-13 effectively reduced the formation of byproducts. A [M+H] concentration of m / z = 194.1023 was detected at 7.7 min. + The ion peak indicates that GZY-13 can synthesize 5-epi-valiolamine normally.

[0100] Further quantitative analysis of 5-epi-valiolamine in the GZY-13 fermentation broth using HPLC-QQQ / MS revealed a concentration of 5.17 mg / L, representing a 72.9% increase compared to PY03. These results indicate that GZY-13 effectively reduces byproduct accumulation while increasing the yield of 5-epi-valiolamine, making it a superior chassis strain. Further modifications can be made to alter the C-5 configuration of the product, thereby achieving more efficient valiolamine synthesis.

[0101] Example 3: Metabolic pathway optimization to correct the stereoconfiguration of 5-epi-valiolamine

[0102] To correct the stereoconfiguration of 5-epi-valiolamine, valA was knocked out in GZY-13. Figure 3 It also overexpresses the valiolone synthase amir_2000 derived from Actinosynnema mirum DSM 43827. Figure 4 GZY-15 was obtained, and valiolamine in the fermentation broth of GZY-15 was quantitatively detected by HPLC-QQQ / MS. The content of valiolamine in the fermentation broth of GZY-15 was found to be 15.5 mg / L.

[0103] Collect 4L of fermentation broth, centrifuge to remove bacterial cells, first decolorize with macroporous resin D201, then pass through a Dowex 50W×8 (H) filter. + The amino-containing compounds were enriched using a (type) cation exchange resin. Further separation was then performed using Sephadex LH-20 molecular sieve chromatography to obtain a crude product containing the target compounds. Finally, the product was purified by Dowex 1×8 (OH) chromatography. - The product was further purified using an anion exchange resin of type (50:50, v / v), eluted with ethanol / water (50:50, v / v), and finally lyophilized to obtain a white powdery purified product.

[0104] The purified sample was analyzed by high-resolution mass spectrometry. Figure 7 The data are as follows: HRMS m / z: [M+H]+Calcd for C7H16NO5 194.1023; Found 194.1025, indicating that the GZY-15 fermentation sample has the same molecular formula as valiolamine. Further 1H NMR spectroscopy was performed... Figure 5 ) and carbon spectrum ( Figure 6 The measurement results are as follows: 1H NMR(600MHz,D2O)δ3.84(t,J=9.7Hz,1H),3.58(dd,J=9.9,4.2Hz,1H),3.53(d,J=11.3Hz,1H),3.46(d,J=11.3Hz,1 H), 3.42 (d, J = 9.5Hz, 1H), 3.34 (dd, J = 7.1, 3.7Hz, 1H), 1.89 (dd, J = 15.2, 2.9Hz, 1H), 1.70 (dd, J = 15.2, 3.9Hz, 1H). 13 C NMR (150MHz, D2O) δ 78.79, 76.54, 76.53, 73.88, 68.26, 52.96, 35.31. The identification results indicate that GZY-15 can synthesize valiolamine samples with the correct stereoconfiguration.

[0105] Example 4: Metabolic Engineering to Increase Yield

[0106] The low production volume of GZY-15 is not conducive to subsequent modification and industrial production.

[0107] Given that Amir_2000 is a heterologously expressed cyclase, its catalytic efficiency in the S. hygroscopicus host may be limited. An attempt was made to remove this limiting factor by replacing it with a more efficient isoenzyme.

[0108] Considering that EVS-like Sh7P cyclases are mainly distributed in gene clusters related to the biosynthesis of C7N aminocyclic alcohols, these gene clusters typically contain pseudoglycosyltransferases homologous to ValL. To improve the specificity of EVS screening, this study first used the ValL pseudoglycosyltransferase protein sequence from the Val gene cluster as a query and performed BLASTP analysis in NCBI, obtaining 500 similar protein sequences. It was inferred that the strains containing these ValL homologous proteins may carry gene clusters related to the biosynthesis of C7N aminocyclic alcohols, encoding potential EVS-like Sh7P cyclases. To narrow down the candidate pool, complete proteomic data of the aforementioned strains were downloaded and a local BLAST database was constructed. Then, BLASTP alignment was performed using Amir_2000 as the query sequence, ultimately obtaining 500 potential EVS homologous protein sequences.

[0109] To facilitate the differentiation of different types of Sh7P cyclases, several representative Sh7P cyclase sequences, including EEVS ValA and DDGS (4-deoxygadusol synthase) Ava_3858, were added to the above sequences. A phylogenetic tree was constructed based on all the above protein sequences to guide the subsequent screening and validation of highly efficient EVS isoenzymes.

[0110] In the initial phylogenetic tree, some branches deviated significantly from the main branch of the major Sh7P cyclase, indicating a distant evolutionary relationship with Amir_2000 and suggesting they did not belong to EVS activity. Therefore, these branches were removed in subsequent optimization. Based on the phylogenetic analysis results, 13 possible EVS candidate sequences were initially screened. After further excluding some redundant sequences with high similarity, five representative candidate EVS sequences with significant evolutionary differences were finally selected as functional validation targets, named EVS-1 to EVS-5 respectively.

[0111] On the other hand, this study used the protein sequence of Amir_2000 as the query sequence and performed DIAMOND-BLASTP alignment on 18,762 assembled actinomycete genomes in the Natural Products Discovery Center (NPDC, https: / / npdc.rc.ufl.edu) database. Two Amir_2000 homologous proteins annotated as 2-epi-valiolone synthases were identified, with sequence similarities of 56.4% and 52.8% with Amir_2000, respectively.

[0112] Although the biosynthetic gene clusters containing these two homologous proteins are both predicted to be secondary metabolic gene clusters of non-ribosomal peptide synthases (NRPS), these clusters also contain several genes related to the biosynthesis of cyclic alcohols (such as valienol-1-P nucleotide transferase, validamine-7-P glycosyltransferase, 2-epi-5-epi-valiolone-7-kinase, and 2-epi-5-epi-valiolone epimerase), indicating that these two Amir_2000 homologous proteins are likely involved in the biosynthesis of cyclic alcohols. These two enzymes were named EVS-6 and EVS-7, respectively.

[0113] To evaluate the ability of each candidate EVS to be synthesized in *S. hygroscopicus*, the gene sequences of EVS-1 to EVS-7 were first codon-optimized for the host *S. hygroscopicus*, and the corresponding gene fragments (SEQ ID NO. 5-11) were synthesized. Subsequently, the overexpression vector pPM927-P was constructed. valA -evs-1 to pPM927-P valA -evs-7, named pLQ1814 to pLQ1820 respectively (see the example pLQ1814 construction process). Figure 8The above overexpression vectors were transformed into strain GZY-14 to obtain mutant strains GZY-14::pLQ1814 to GZY-14::pLQ1820, which were named GZY-16 to GZY-22, respectively.

[0114] The fermentation yield of valiolamine for each mutant strain was analyzed by HPLC-QQQ / MS after 4 days of shake-flask fermentation at 37℃. Except for GZY-17, which did not produce the expected product, the other mutant strains showed corresponding ion peaks at a retention time of 6.1 min. Figure 9 Among them, GZY-22 had the highest yield, reaching 513.8 mg / L, which was 33.1 times higher than GZY-15; followed by GZY-16, with a yield of 318.8 mg / L, which was 20.6 times higher than GZY-15. Figure 10 This indicates that the replacement strategy of EVS high-efficiency isoenzyme effectively improves the synthesis efficiency of the target product.

[0115] 4L of fermentation broth from strain GZY-16 was collected. After centrifugation to remove the bacterial cells, the broth was first decolorized using macroporous resin D201, and then passed through a Dowex 50W×8 (H) filter. + The amino-containing compounds were enriched using a (type) cation exchange resin. Further separation was then performed using Sephadex LH-20 molecular sieve chromatography to obtain a crude product containing the target compounds. Finally, the product was purified by Dowex 1×8 (OH) chromatography. - The product was further purified using an anion exchange resin of type (50:50, v / v), eluted with ethanol / water (50:50, v / v), and finally lyophilized to obtain a white powdery purified product.

[0116] The purified sample was structurally identified by measuring its 1H NMR spectrum. Figure 11 ), carbon spectrum ( Figure 12 High-resolution mass spectrometry (HDMS) Figure 13 The data is as follows: 1 H NMR(600MHz,D2O)δ3.75(t,J=9.7Hz,1H),3.49(dd,J=9.9,4.2Hz,1H),3.43(d,J=11.3Hz,1H),3.37(d,J=11.3Hz,1 H), 3.33 (d, J = 9.5Hz, 1H), 3.25 (dd, J = 7.1, 3.8Hz, 1H), 1.80 (dd, J = 15.2, 2.9Hz, 1H), 1.60 (dd, J = 15.2, 3.9Hz, 1H). 13 C NMR(150MHz,D2O)δ75.94,73.68,73.68,71.03,65.40,50.11,32.44.HRMS m / z:[M+H] +Calcd forC7H16NO5 194.1023; Found 194.1026.

[0117] To further verify the absolute configuration of the sample, single crystals were grown and measurements were performed. The results are analyzed below ( Figure 14 , Figure 15 Crystal size: 0.14 x 0.12 x 0.1 mm 3 The space group is P212121, and the unit cell parameters are: α = β = γ = 90°, number of asymmetric units in the unit cell volume Z = 4, absorption coefficient is 1.109 mm⁻¹. Reliability factor R₁ = 0.0253, wR₂ = 0.0619. The final stoichiometric formula within one asymmetric unit is determined to be C₇H₁₅NO₅, the calculated molecular weight is 193.20, and the calculated crystal density is 1.525 g / cm³. 3 The spatial arrangement of carbon, hydrogen, oxygen, and nitrogen atoms in the test sample has been determined. The five corresponding chiral carbons correspond one-to-one with the structure: C1(S), C6(S), C5(R), C4(S), and C3(S), as shown below.

[0118]

[0119] 4L of fermentation broth from strain GZY-22 was collected. After centrifugation to remove bacterial cells, the broth was first decolorized using macroporous resin D201, and then passed through a Dowex 50W×8 (H) filter. + The amino-containing compounds were enriched using a (type) cation exchange resin. Further separation was then performed using Sephadex LH-20 molecular sieve chromatography to obtain a crude product containing the target compounds. Finally, the product was purified by Dowex 1×8 (OH) chromatography. - The product was further purified using an anion exchange resin of type (50:50, v / v), eluted with ethanol / water (50:50, v / v), and finally lyophilized to obtain a white powdery purified product.

[0120] The purified sample was subjected to structural identification. Figures 16-18 The data are as follows: HRMS m / z: [M+H]+Calcd for C7H16NO5 194.1023; Found 194.1026, indicating that the purified sample has the same molecular formula as valiolamine. Further NMR spectroscopy (1H and 1C) measurements were performed, and the results are as follows: 1HNMR(600MHz,D2O)δ3.75(t,J=9.7Hz,1H),3.49(dd,J=9.9,4.2Hz,1H),3.43(d,J=11.3Hz,1H),3.36(d,J=11.3Hz, 1H), 3.33 (d, J=9.5Hz, 1H), 3.24 (dd, J=7.1, 3.5Hz, 1H), 1.80 (dd, J=15.2, 2.9Hz, 1H), 1.60 (dd, J=15.2, 3.9Hz, 1H). 13 C NMR (150MHz, D2O) δ 75.94, 73.67, 73.67, 71.02, 65.40, 50.11, 32.44. Identification results: The purified sample has the same stereoconfiguration as valiolamine.

[0121] GZY-16 (TW102I-2503-2) was deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 35869 and classification name Streptomyces hygroscopicus.

[0122] GZY-22 (TW102I-2503-3) was deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 35870 and classification name Streptomyces hygroscopicus.

Claims

1. An engineered bacterium for producing amino sugar intermediates, wherein the engineered bacterium is based on Streptomyces hygroscopicus and its gene is knocked out to inhibit the synthesis of jinggangmycin.

2. The engineered bacteria according to claim 1, wherein the engineered bacteria overexpress valiolone synthase.

3. The engineered bacteria according to claim 1 or 2, wherein the *Streptomyces hygroscopicus* var. *Jinggangensis* (subspecies) is PY05, which was deposited on July 15, 2024, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31292.

4. The engineered bacteria according to any one of claims 1-3, wherein the knocked-out gene is selected from one or more of valA, valK and valN.

5. The engineered bacteria according to claim 4, wherein the knocked-out genes are valA, valK, and valN.

6. The engineered bacteria according to claim 4 or 5, wherein the nucleotide sequence of valA is SEQ ID NO.1, the nucleotide sequence of valK is SEQ ID NO.2, and the nucleotide sequence of valN is SEQ ID NO.

3.

7. The engineered bacteria according to any one of claims 4-6, wherein knocking out valA, valK and / or valN comprises inserting upstream and downstream homologous fragments of the gene into the free vector pJTU1278 to construct a deletion plasmid.

8. The engineered bacteria according to any one of claims 2-7, wherein the nucleotide sequence of the valiolone synthase is SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.

11.

9. The engineered bacteria according to claim 8, wherein the nucleotide sequence of the valiolone synthase is SEQ ID NO.

5.

10. The engineered bacteria according to any one of claims 2-9, wherein the overexpression of valiolone synthase comprises a pPM927 plasmid as a backbone, with the addition of a promoter P that drives valiolone synthase expression. valA Construct overexpression plasmids.

11. The engineered bacteria according to any one of claims 1-10, wherein the engineered bacteria was deposited on September 10, 2025 at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 35869.

12. The use of the engineered bacteria according to any one of claims 1-11 in the production of amino sugar intermediates.

13. The application according to claim 12, wherein the amino sugar intermediate is an effective alcohol amine.

14. The use of the engineered bacteria according to any one of claims 1-11 in the production of voglibose.

15. The application according to any one of claims 12-14, wherein the engineered bacteria are fermented to produce an amino sugar intermediate.

16. The application according to claim 15, wherein the culture medium used in the fermentation culture comprises 40-120 g / L rice flour, 5-20 g / L peanut flour, 0.5-5 g / L potassium dihydrogen phosphate, 0.5-1 g / L calcium carbonate, and 1-10 g / L sodium chloride.

17. The application according to claim 16, wherein the culture medium used in the fermentation culture comprises 90-110 g / L rice flour, 16-20 g / L peanut flour, 0.5-1 g / L potassium dihydrogen phosphate, 0.5-0.7 g / L calcium carbonate, and 1-2 g / L sodium chloride.

18. The application according to claim 17, wherein the culture medium used in the fermentation culture comprises 100 g / L rice flour, 18 g / L peanut flour, 0.7 g / L potassium dihydrogen phosphate, 0.6 g / L calcium carbonate, and 1.4 g / L sodium chloride.

19. The application according to any one of claims 15-18, wherein the engineered bacteria are inoculated into the culture medium at an inoculation rate of 1%-15% in the fermentation culture.

20. The application according to claim 19, wherein the engineered bacteria are inoculated into the culture medium at an inoculation rate of 8%-12% in the fermentation culture.

21. The application according to claim 20, wherein the engineered bacteria are inoculated into the culture medium at an inoculation rate of 10% in the fermentation culture.

22. The application according to any one of claims 15-21, wherein the fermentation culture time is 90 hours or more.

23. The application according to claim 22, wherein the fermentation time is 96-120 hours.

24. The application according to claim 23, wherein the fermentation time is 96 hours.

25. The application according to any one of claims 15-24, wherein the fermentation culture temperature is 30-40℃.

26. In the application according to claim 25, the fermentation culture temperature is 35-40℃.

27. The application according to claim 26, wherein the fermentation culture temperature is 37°C.

28. The method for constructing the engineered bacteria according to any one of claims 1-11, wherein the method comprises inhibiting jinggangmycin synthesis by gene knockout and overexpressing valiolone synthase based on Streptomyces hygroscopicus PY05.

29. The construction method according to claim 28, wherein the knocked-out genes are valA, valK, and valN.

30. The construction method according to claim 29, wherein the nucleotide sequence of valA is SEQ ID NO.1, the nucleotide sequence of valK is SEQ ID NO.2, and the nucleotide sequence of valN is SEQ ID NO.

3.

31. The construction method according to any one of claims 28-30, wherein the nucleotide sequence of the valiolone synthase is SEQ ID NO.5.

Images