Tissue sample space DNA hydroxymethylation sequencing library construction and sequencing method, kit and application

Abstract

The invention relates to the technical field of biology, in particular to a tissue sample space DNA hydroxymethylation sequencing library construction and sequencing method, a kit and application. The library construction method comprises the following steps: breaking DNA in a fixed tissue slice in situ, preparing a double-stranded DNA fragment, and adding a linker on the DNA fragment in situ; carrying out in-situ bar code coding on the DNA fragments, so that pixel points are formed in the region where the DNA fragments containing the same bar code in the tissue slice are located; separating a DNA (Deoxyribonucleic Acid) fragment; filling in the deleted nucleotide residues between the linker and the bar code of the separated DNA fragment; and converting cytosine bases in the DNA fragments into other base types by using an enzymatic reaction system. According to the construction and sequencing method of the sequencing library, high-precision detection of the 5-methylcytosine basic group and the 5-hydroxymethylcytosine basic group in the genome is realized on the premise of retaining the tissue structure and spatial information.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to methods, kits and applications for constructing and sequencing libraries of spatial DNA hydroxymethylation sequencing for tissue samples. Background Technology

[0002] DNA hydroxymethylation refers to the chemical modification of DNA by adding a hydroxymethyl group (-CH2OH) to the cytosine base, with the main product being the 5-hydroxymethylcytosine base (5hmC). As a key form of epigenetic modification, DNA hydroxymethylation plays a significant biological role in regulating gene expression, cell fate determination, embryonic development, and diseases such as tumors. It is particularly highly enriched in the nervous systems of mammals and primates, and is strongly correlated with cognitive function. Current DNA hydroxymethylation detection techniques include oxobissulfite sequencing (oxBS-seq), which uses potassium perruthenate (KRuO4) to oxidize 5hmC to 5fC. After bisulfite treatment, both 5fC and the unmodified C are converted to U, while 5mC remains unchanged. The 5hmC level was indirectly calculated by comparing the differences between standard BS-seq and oxBS-seq data. TET-assisted bisulfite sequencing (TAB-seq) first used T4 β-glucosyltransferase (βGT) to glycosylate 5hmC to 5ghmC (protected), then used TET enzyme to oxidize 5mC to 5caC, ultimately only 5ghmC was read as C. APOBEC-coupled methylation sequencing (ACE-seq) used APOBEC3A deaminase instead of bisulfite. This enzyme specifically removes the amino groups from C and 5mC, converting them to U, while the glycosylated 5hmC (5ghmC) is not recognized and is still read as C. Traditional DNA hydroxymethylation detection technologies, while providing methylation maps at the whole genome or single-cell level, cannot preserve tissue spatial information. Therefore, a method for constructing and sequencing libraries for spatial DNA hydroxymethylation in tissue samples is needed to facilitate the mapping of high-resolution spatial maps of DNA hydroxymethylation in in situ tissues. Summary of the Invention

[0003] Therefore, it is necessary to provide a method, kit, and application for constructing and sequencing spatial DNA hydroxymethylation sequencing libraries from tissue samples.

[0004] Firstly, a method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples is provided, including steps (A) to (F):

[0005] (A) DNA in fixed tissue sections is broken in situ to prepare double-stranded DNA fragments, and adapters are added to the DNA fragments in situ; the chromatin in the fixed tissue sections is dehistoned.

[0006] (B) In situ barcode encoding is performed on the DNA fragments in the tissue sections processed in step (A) so that the regions in the tissue sections containing DNA fragments with the same barcode form pixels;

[0007] (C) Separate, extract, and purify the DNA fragments treated in step (B);

[0008] (D) Fill in the missing nucleotide residues between the adapter and barcode of the DNA fragment separated in step (C);

[0009] (E) Using an enzymatic reaction system, the cytosine bases in the DNA fragment separated in step (D) are converted into other base types; and,

[0010] (F) The DNA fragments obtained in step (E) are used as a tissue sample spatial DNA hydroxymethylation sequencing library.

[0011] In an alternative implementation, a Tn5 transposase preloaded with adapters is used to break DNA in a fixed tissue section, while adapters are added to the DNA fragments under Tn5 transposase-mediated processing.

[0012] In an alternative implementation, step (A) includes adding different adapters to both ends of the DNA fragment.

[0013] In an optional embodiment, tissue sections are fixed with formaldehyde at a concentration of 0.2% w / v to 0.5% w / v.

[0014] In an optional implementation, tissue sections are fixed with formaldehyde at a concentration of 0.2% w / v.

[0015] In an optional embodiment, the decrosslinking treatment is performed at least twice using HCl with a concentration of at least 0.2 mol / L.

[0016] In an optional implementation, the cross-linking process is performed three times using 0.2 mol / L HCl.

[0017] In an optional implementation, in-situ barcoding on the DNA fragment includes two-dimensional spatial barcoding of the DNA fragment.

[0018] In an optional implementation, a microfluidic chip is used to encode DNA fragments in tissue sections in situ using two-dimensional spatial barcodes.

[0019] In an optional implementation, the encoding portion of the barcode does not contain cytosine bases.

[0020] In an optional embodiment, a first internal reference fragment and a second internal reference fragment are added to the DNA fragment separated in step (C); the first internal reference fragment is a fragment without methylated cytosine; the second internal reference fragment is a fragment of cytosine with a known site of hydroxymethylation modification.

[0021] In an optional implementation, step (D) further includes replacing the cytosine in the connector and barcode with hydroxymethylated cytosine.

[0022] In an optional embodiment, the enzymatic reaction system includes T4-BGT and APOBEC.

[0023] In an optional embodiment, the unpurified DNA fragments treated with the enzymatic reaction system in step (E) are subjected to PCR amplification using a reaction system containing UDI Primer Pair and NEBNext Q5U Master Mix.

[0024] In an optional implementation, the method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples includes steps (A) to (F):

[0025] (A) Tissue sections were fixed with formaldehyde at a concentration of 0.2% w / v. After the fixation reaction was terminated, the cross-linking was decross-linked three times with 0.2 mol / L HCl. Then, Tn5 transposase with pre-loaded adapters was used to break the DNA in the fixed tissue sections. At the same time, different adapters were added in situ at both ends of the DNA fragments under the mediation of Tn5 transposase.

[0026] (B) Using a microfluidic chip to encode DNA fragments in tissue slices processed in step (A) using two-dimensional spatial barcodes to form a two-dimensional grid-like spatial barcode array;

[0027] (C) Separate the DNA fragment obtained in step (B) and add a first internal reference fragment and a second internal reference fragment to it; the first internal reference fragment is a fragment without methylated cytosine bases; the second internal reference fragment is a fragment with hydroxymethylated cytosine bases at known sites.

[0028] (D) Fill in the missing nucleotide residues between the linker and the barcode, and replace the cytosine bases in the linker and the barcode with hydroxymethylated cytosine bases;

[0029] (E) First, T4-BGT is used to convert the 5-hydroxymethylcytosine bases in the DNA fragment to 5-glucosylhydroxymethylcytosine bases. Then, APOBEC is used for deamination to convert the cytosine and 5-methylcytosine bases in the DNA fragment to uracil bases; and,

[0030] (F) The unpurified DNA fragments treated with the enzymatic reaction system in step (E) were amplified by PCR using a reaction system containing UDI PrimerPair and NEBNext Q5U Master Mix.

[0031] Secondly, a kit for constructing a spatial DNA hydroxymethylation sequencing library for tissue samples is provided. The kit contains a barcode, formaldehyde at a working concentration of 0.2% w / v to 0.5% w / v, and HCl at a working concentration of at least 0.2 mol / L.

[0032] Thirdly, a method for sequencing spatial DNA hydroxymethylation of tissue samples is provided, comprising: constructing a library using the method for constructing a spatial DNA hydroxymethylation sequencing library for tissue samples as described in the first aspect, or using the kit described in the second aspect, and sequencing the library.

[0033] In an optional implementation, the sequencing includes the use of next-generation sequencing.

[0034] In an optional embodiment, the tissue sample spatial DNA hydroxymethylation sequencing method further includes calculating the positioning information of the barcode encoding, calculating the DNA hydroxymethylation level corresponding to each spatial pixel, and generating a spatial hydroxymethylation map.

[0035] Fourthly, the library prepared by the tissue sample spatial DNA hydroxymethylation sequencing library construction method described in the first aspect, or the tissue sample spatial DNA hydroxymethylation sequencing library construction kit described in the second aspect, is provided for use in any one of (i) to (iv):

[0036] (i) Construct an in situ spatial map of DNA hydroxymethylation on tissue sections;

[0037] (ii) Prepare a kit for in situ DNA hydroxymethylation spatial mapping of tissue sections;

[0038] (iii) Screening for biomarkers of hydroxymethylation sites;

[0039] (iv) Prepare a kit for screening biomarkers of hydroxymethylation sites.

[0040] The library construction and sequencing methods provided in this application expand the application boundaries of spatial omics, incorporating the DNA hydroxymethylation dimension into spatial omics research and providing a new analytical dimension for tissue development, disease research, and other fields. In some implementations, near-single-cell level spatial resolution can be achieved on tissue sections, accurately reconstructing the correspondence between tissue morphology and epigenetic modification states. Simultaneously, the use of a sulfite-free hydroxymethylation library construction system reduces DNA damage and improves detection sensitivity and genome coverage. By integrating a spatial barcoding system and a sulfite-free hydroxymethylation library construction system, high-precision detection of 5-hydroxymethylcytosine nucleotide residues in the genome is achieved while preserving tissue structure and spatial information.

[0041] The library construction and sequencing methods provided in this application possess a high degree of multi-omics integration capability, and can be integrated and analyzed with other types of sequencing data, such as spatial transcriptomics and chromatin modification maps. They can reveal cell fate and regulatory mechanisms from spatial coordinates, support spatial identification of different cell types in tissues, inference of developmental trajectories, and analysis of epigenetic regulatory mechanisms. They are adaptable to various sample types and developmental stages, have broad applicability and expansion potential, and can provide key research tools for fields such as epigenetics, developmental biology, and tumor pathology. Attached Figure Description

[0042] To more clearly illustrate the technical solutions in the embodiments and examples of this application, and to more completely understand this application and its beneficial effects, the accompanying drawings used in the description of the embodiments or examples will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of this application. Those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0043] Figure 1 This is a schematic diagram of the library construction process in Example 1;

[0044] Figure 2 Photograph of the PDMS chip used in Example 1;

[0045] Figure 3 This is a schematic diagram illustrating the reaction principle of the joint extension and 5hmC displacement reaction in Example 1;

[0046] Figure 4 The genome coverage of the ShmC-seq libraries obtained by different decrosslinking treatment methods in Example 2 is shown. Detailed Implementation

[0047] The present application will be further described in detail below with reference to the accompanying drawings, embodiments, and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. For example, features described or illustrated as part of one embodiment can be combined in a suitable manner in another embodiment to produce new embodiments. Furthermore, numerous details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for descriptive purposes only and is not intended to be limiting of the application.

[0049] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0050] The terms “and / or,” “or / and,” and “and / or” as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. “Any and all combinations” includes any two related listed items, any more related listed items, or a combination of all related listed items. For example, “A and / or B” includes three parallel options: A, B, and “a combination of A and B.”

[0051] In this application, the terms "multiple", "various", "multiple times", "several", "several", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more or more.

[0052] In this application, "optionally", "optional", and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without".

[0053] In this application, the technical features or solutions described in open-ended language include both closed-ended technical features or solutions consisting of the listed contents and open-ended technical features or solutions that include the listed contents.

[0054] In this application, where the method flow involves multiple steps, unless otherwise explicitly stated herein, there is no strict order restriction on the execution of these steps; they can be executed in any order other than those described. Moreover, any step may include multiple sub-steps or multiple stages, which are not necessarily completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be performed alternately or simultaneously with other steps or parts of the sub-steps or stages of other steps.

[0055] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0056] In this application, "in situ" refers to reacting or chemically modifying DNA directly in its original spatial location without tissue lysis or DNA extraction. This process preserves the correspondence between DNA fragments and the spatial coordinates of cells / tissues.

[0057] In this article, the term "cytosine (C)" or "cytosine base" refers to 4-amino-2-hydroxypyrimidine, with the chemical structure of the molecular formula C4H5N3O. Unless otherwise specified, "cytosine" or "cytosine base" is not modified.

[0058] In this article, the terms "5-methylcytosine base", "5-methylcytosine", and "5mC" refer to the chemical structure in which a methyl group (-CH3) is covalently bonded to the 5th carbon atom of the cytosine ring.

[0059] In this article, the terms "5-hydroxymethylcytosine base", "5-hydroxymethylcytosine", and "5hmC" refer to the chemical structure in which a hydroxymethyl group (-CH2OH) is bonded to the 5th carbon atom of the cytosine ring.

[0060] In this article, the terms "5-formylcytosine base" and "5fC" refer to the chemical structure in which a formyl group (-CHO) is attached to the 5th carbon atom of the cytosine ring.

[0061] In this article, the terms "5-carboxycytosine base" and "5caC" refer to the chemical structure in which a carboxyl group (-COOH) is attached to the 5th carbon atom of the cytosine ring.

[0062] In a first aspect, some embodiments provide a method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples. This method is based on double-stranded library construction and includes steps (A) to (F):

[0063] (A) DNA in fixed tissue sections is broken in situ to prepare double-stranded DNA fragments, and adapters are added to the DNA fragments in situ; and the chromatin in the fixed tissue sections is dehistoned to stabilize the tissue structure and expose the DNA.

[0064] In an optional embodiment, tissue sections are fixed with formaldehyde at a concentration of 0.2% w / v to 0.5% w / v. The formaldehyde concentration can be, for example, but not limited to, 0.2% w / v, 0.3% w / v, 0.4% w / v, or 0.5% w / v, with a preferred concentration of 0.2% w / v. Lower formaldehyde concentrations facilitate more thorough removal of histones in subsequent steps, thereby improving genome coverage.

[0065] In an optional embodiment, after terminating the fixation reaction, the chromatin is decrosslinked at least twice using HCl at a concentration of at least 0.2 mol / L, preferably three times, to remove histones from the chromatin. Multiple rounds of hydrochloric acid treatment significantly improve genome coverage compared to a single round, and the higher concentration of hydrochloric acid helps to further remove histones, thereby enhancing DNA accessibility.

[0066] In optional embodiments, tissue sections include frozen tissue sections, paraffin sections, dewaxed paraffin samples, and stained tissues, such as tissues stained with hematoxylin and eosin (HE) and tissues stained with immunofluorescence. There are no restrictions on the biological source of the tissues, which includes, but is not limited to, plants or animals. Examples of animals include, but are not limited to, optional tissue portions from, but are not limited to, mice, rats, humans, dogs, monkeys, pigs, goats, cattle, horses, chickens, ducks, fish, and camels.

[0067] In an alternative implementation, a Tn5 transposase preloaded with adapters is used to break DNA in a fixed tissue section, while adapters are added to the DNA fragments under Tn5 transposase-mediated processing.

[0068] In an optional implementation, step (A) involves adding different adapters to both ends of the DNA fragment, obtaining the following structural fragment in situ in a fixed tissue section: adapter A - double-stranded DNA fragment - adapter B. When the adapters inserted at both ends of the genomic DNA (gDNA) are the same, both ends of the DNA fragment need to be successfully linked to two rounds of barcodes during subsequent two-dimensional barcoding, thus requiring high reaction efficiency. In contrast, when the adapters inserted at both ends of the DNA fragment are different, only one adapter needs to be used to complete two rounds of barcode linking. This design not only reduces the requirements for reaction efficiency but also effectively saves reagents and reduces experimental costs.

[0069] (B) Adding barcodes, including in-situ barcoding of DNA fragments in the tissue sections processed in step (A), that is, marking the DNA fragments by adding different barcodes, so that different barcodes mark the spatial location, and the areas of DNA fragments containing the same barcode in the tissue section form pixels. When multiple barcodes are used for encoding, the same barcode includes combinations of the same barcode.

[0070] In an optional implementation, in situ barcoding on the DNA fragment includes two-dimensional spatial barcoding of the DNA fragment, that is, marking the DNA fragment by adding two barcodes, so as to mark the spatial location by using different barcode combinations, forming spatial uniqueness, and making the regions of the tissue slice containing the same barcode combination form pixels.

[0071] In an optional implementation, a microfluidic chip is used to encode DNA fragments in tissue sections in situ using two-dimensional spatial barcodes.

[0072] In an optional implementation, using a microfluidic chip to encode two-dimensional spatial barcodes for tissue slices includes: encoding m distinct barcodes A... i The Ath group of barcodes is introduced into the surface of the tissue slice along the X direction through the channel of the microfluidic chip, forming m bands M. i Each stripe M contains a barcode A. i ; the barcode A in stripe M i In situ ligation to one end of any adapter of a double-stranded DNA fragment;

[0073] Then, B contains n distinct barcodes. j The B group of barcodes is introduced into the surface of the tissue slice along the Y direction through the channel of the microfluidic chip, forming n bands N. j Furthermore, the X and Y directions are not parallel, resulting in m strips M1~M m and n stripes N1~N nAt least partially intersecting regions form pixels; strip N j Barcode B in j The barcode A is connected in situ to the several pixels formed by its intersection. i The tail end, so that the double-stranded DNA fragment in each pixel carries the barcode A. i -Barcode B j It is different from all other pixels, thus realizing two-dimensional spatial barcode encoding.

[0074] Where m and n are independent positive integers selected from >1, 0 < i < m, 0 < j < n.

[0075] It is understandable that this contains several distinct barcodes A. i Group A of barcodes and Group B containing several distinct barcodes. j The B group of barcodes can be two different groups of barcodes, either the same or different. When the A group and the B group of barcodes are the same group, it is sufficient to make the combined barcode A appear in each pixel. i -Barcode B j The two segments can be different from each other. For example, but not limited to, linking either end of a double-stranded DNA fragment to form the following combinations: barcode A1-barcode A1, barcode A1-barcode A2, barcode A1-barcode A3, barcode A2-barcode A1, barcode A2-barcode A2, barcode A2-barcode A3, etc.

[0076] In an optional implementation, the X and Y directions are perpendicular.

[0077] In an optional implementation, the encoding portion of the barcode does not contain cytosine bases. During the subsequent deamination reaction, if the cytosine bases (C) in the spatial positioning barcode are not completely converted, it will lead to reading errors. Considering the deamination reaction efficiency is approximately 99%, probabilistically, a small number of cytosine bases (C) will inevitably remain unconverted, resulting in the loss of valid data. Using a barcode whose encoding portion does not contain cytosine bases avoids this problem.

[0078] In an optional implementation, barcode A i and barcode B j It is a double-stranded 5'-phosphorylated oligonucleotide with complementary sticky ends at both ends, that is, it contains the following structure: 5' sticky end - coding part - 3' sticky end.

[0079] Barcode A i The 5' adhesive end is complementary to the 3' end of the Tn5 insert connector, barcode B. j 5' Adhesive end and barcode A iThe 3' end adhesive ends are complementary to achieve barcode A. i First, connect the Tn5 transposase adapter within the channel of the microfluidic chip in the X direction, barcode B. j The 5' end adhesive tip then interacts with the barcode A within the channel of the microfluidic chip in the Y direction. i The 3' end of the sticky end encodes each pixel into a unique coordinate.

[0080] In an optional implementation, step (B) further includes immediately blocking the free barcode A with a blocking oligonucleotide after linking the A group of barcodes. i Blocked oligonucleotides and barcode A i The 5' ends are complementary to prevent cross-connection when connecting the second round of the B group barcode.

[0081] In an optional implementation, step (B) uses a 96-channel microfluidic chip, which enables the construction of a larger-area tissue sample spatial DNA hydroxymethylation sequencing library.

[0082] In an optional implementation, step (B) uses a 10 μm resolution microfluidic chip, which can achieve a spatial resolution of 10 μm and accurately restore the correspondence between tissue morphology and appearance modification state.

[0083] (C) Isolate, extract and purify DNA fragments encoded by in situ barcodes.

[0084] In an optional embodiment, after isolating the DNA fragment encoded by in-situ barcodes, a first internal reference fragment and a second internal reference fragment are added to it; the first internal reference fragment is a fragment without methylated cytosine bases; the second internal reference fragment is a fragment with cytosine bases known to be hydroxymethylated. The addition of the internal reference fragments is used to evaluate and verify the fidelity and protective efficiency of subsequent steps against hydroxymethylation modifications.

[0085] In an optional embodiment, the first internal control fragment is Lambda DNA (CpG methylated λ-DNA internal control). Lambda DNA is λ phage DNA that has been treated with M.SssI methyltransferase and has all CpG sites methylated. It is used to quantify APOBEC deamination efficiency and overall conversion rate.

[0086] In an optional embodiment, the second internal reference fragment is SP64 DNA, which is a synthetic DNA fragment in which cytosine bases at positions 7, 11, 16, 27, 324, 335, 340, and 344 are hydroxymethylated, and is used to verify the sensitivity of hydroxymethylation detection.

[0087] (D) Fill in the missing nucleotide residues between the adapter and barcode of the DNA fragment separated in step (C).

[0088] In an optional implementation, after filling in the missing nucleotide residues between the linker and the barcode, the CTP (cytosine triphosphate residue) in the linker and the barcode is replaced with hmCTP (hydroxymethylated cytosine triphosphate residue) to prevent subsequent deamination reactions from causing sequence changes.

[0089] (E) Using an enzymatic reaction system to convert cytosine bases into other base types. The enzymatic reaction system only needs to be able to achieve base type conversion, and this application does not impose any restrictions on this. Other base types refer to base types that are not read as cytosine bases in the sequencing step.

[0090] In an optional embodiment, the enzymatic reaction system includes T4-BGT (T4 β-glucosyltransferase, T4 phage β-glucosyltransferase) and APOBEC (cytidine deaminase).

[0091] T4-BGT converts 5hmC to 5ghmC (5-glucosylhydroxymethylcytosine base), preventing 5hmC from being deamination by APOBEC, thus accurately distinguishing 5mC (5-methylcytosine base) from 5hmC. APOBEC deamination converts C (cytosine base) and 5mC to uracil base (U). This step first uses T4-BGT to convert 5hmC to 5ghmC, and then uses APOBEC for deamination to convert C (cytosine base) and 5mC to U (uracil base).

[0092] (F) The DNA fragments obtained in step (E) are used as a tissue sample spatial DNA hydroxymethylation sequencing library.

[0093] In an optional embodiment, the unpurified DNA fragments treated with the enzymatic reaction system in step (E) are subjected to PCR amplification using a reaction system containing UDI Primer Pair and NEBNext Q5U Master Mix.

[0094] In traditional methods, DNA purification is required after enzymatic reaction, followed by the introduction of a new reaction system for PCR. While purification helps ensure reaction specificity and efficiency, it also leads to significant DNA loss. To maximize sample integrity, the aforementioned purification-free reaction system, which allows for direct PCR, has been introduced into space sequencing, effectively reducing DNA loss and improving overall reaction efficiency.

[0095] In an optional implementation, the method for constructing a tissue sample spatial DNA hydroxymethylation sequencing library in the first aspect includes the following steps:

[0096] (A) Tissue sections were fixed with formaldehyde at a concentration of 0.2% w / v. After the fixation reaction was terminated, the cross-linking was decross-linked three times with 0.2 mol / L HCl. Then, Tn5 transposase with pre-loaded adapters was used to break the DNA in the fixed tissue sections. At the same time, different adapters were added in situ at both ends of the DNA fragments under the mediation of Tn5 transposase.

[0097] (B) Using a microfluidic chip to encode DNA fragments in tissue slices processed in step (A) using two-dimensional spatial barcodes to form a two-dimensional grid-like spatial barcode array;

[0098] (C) Separate the DNA fragment obtained in step (B) and add a first internal reference fragment and a second internal reference fragment to it; the first internal reference fragment is a fragment without methylated cytosine bases; the second internal reference fragment is a fragment with hydroxymethylated cytosine bases at known sites.

[0099] (D) Fill in the missing nucleotide residues between the linker and the barcode, and replace the cytosine bases in the linker and the barcode with hydroxymethylated cytosine bases;

[0100] (E) First, T4-BGT is used to convert the 5-hydroxymethylcytosine bases in the DNA fragment to 5-glucosylhydroxymethylcytosine bases. Then, APOBEC is used for deamination to convert the cytosine and 5-methylcytosine bases in the DNA fragment to uracil bases; and,

[0101] (F) The unpurified DNA fragments treated with the enzymatic reaction system in step (E) were amplified by PCR using a reaction system containing UDI PrimerPair and NEBNext Q5U Master Mix.

[0102] Secondly, some embodiments provide a tissue sample spatial DNA hydroxymethylation sequencing library construction kit, which includes barcodes, formaldehyde at a working concentration of 0.2% w / v to 0.5% w / v, and HCl at a working concentration of at least 0.2 mol / L; wherein the encoded portion of the barcode does not contain cytosine bases. In this kit, the barcode is used for in-situ two-dimensional spatial barcoding of DNA fragments, the formaldehyde at a working concentration of 0.2% w / v to 0.5% w / v is used for fixing tissue sections, and the HCl at a working concentration of at least 0.2 mol / L is used for decrosslinking.

[0103] In an optional implementation, the kit also contains Tn5 transposase.

[0104] In an optional implementation, the kit may also contain an internal control fragment, which may further optionally include, but is not limited to, Lambda DNA and SP64 DNA.

[0105] In an optional embodiment, the kit further includes an enzyme for converting cytosine bases to other base types. More optionally, the kit includes T4-BGT and APOBEC enzymes.

[0106] In an optional implementation, the kit may also include one or more reagents and consumables for library construction or library construction assistance. Examples of reagents include, but are not limited to, cryoemulation agents, buffer reagents, T4 ligases, adapters, cell lysis reagents, proteases, dNTPs containing hmCTP, Bst DNA polymerase, primers, microfluidic chips, glass slides, and magnetic beads.

[0107] Thirdly, some embodiments provide a method for sequencing spatial DNA hydroxymethylation of tissue samples, comprising: constructing a library using the method for constructing spatial DNA hydroxymethylation sequencing library of tissue samples in the first aspect, or using a kit in the second aspect, and sequencing the prepared library.

[0108] In an optional implementation, sequencing includes sequencing a library obtained by the tissue sample spatial DNA hydroxymethylation sequencing library construction method of the first aspect using next-generation sequencing.

[0109] In an optional implementation, the spatial DNA hydroxymethylation sequencing method for tissue samples further includes calculating the positioning information of the barcode encoding, calculating the DNA hydroxymethylation level corresponding to each spatial pixel, and generating a spatial hydroxymethylation map.

[0110] Fourthly, some embodiments provide the application of libraries prepared using the tissue sample spatial DNA hydroxymethylation sequencing library construction method of the first aspect, or the tissue sample spatial DNA hydroxymethylation sequencing library construction kit of the second aspect, in any one of (i) to (iv):

[0111] (i) Construct an in situ spatial map of DNA hydroxymethylation on tissue sections;

[0112] (ii) Prepare a kit for in situ DNA hydroxymethylation spatial mapping of tissue sections;

[0113] (iii) Screening for biomarkers of hydroxymethylation sites;

[0114] (iv) Prepare a kit for screening biomarkers of hydroxymethylation sites.

[0115] The libraries obtained using the library construction methods described above are sequenced. The results can be used to construct in situ spatial maps of DNA hydroxymethylation in tissue sections, or to screen hydroxymethylation sites that can serve as biomarkers based on sequencing results from multiple samples. The sequencing methods described above can be implemented using the kits provided in the second aspect.

[0116] In an optional implementation, the application of aspect (i) is for non-diagnostic and non-therapeutic purposes.

[0117] In optional implementations, the application of aspect (iii) is for non-diagnostic and non-therapeutic purposes. Some examples are provided below.

[0118] The embodiments of this application will be described in detail below with reference to some examples. It should be understood that these embodiments are only for illustrating this application and are not intended to limit the scope of this application. For experimental methods in the following embodiments where conditions are not specified, please refer to the guidelines given in this application first, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0119] In the following examples, the measurement parameters of the raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0120] Example 1

[0121] This embodiment provides a method for constructing a ShmC-seq library (tissue sample spatial DNA hydroxymethylation sequencing library), the flowchart of which is shown below. Figure 1 As shown. This embodiment is based on a 10 μm resolution PDMS chip (polydimethylsiloxane microfluidic chip), which has 96 channels, as shown. Figure 2 As shown, the ShmC-seq library was constructed on E5.5 cerebral cortex tissue sections of C57BL / 6J mouse embryos at 8 weeks of age (P56). The procedure is as follows:

[0122] 1. Tissue fixation and pretreatment

[0123] Freshly frozen tissue sections (7 μm thick) embedded in OCT (Optimal Cutting Temperature compound) were attached to poly-L-lysine-coated slides. The poly-L-lysine-coated slides have a positively charged surface, preventing tissue detachment during subsequent washing steps. The sections were then allowed to dry at room temperature for 30 min. Tissue fixation was then performed: 50 μL of 0.2% formaldehyde (freshly prepared from 184 μL PBS and 1 μL 37% formaldehyde) was added to the tissue area, and the tissue was incubated at room temperature for 10 min.

[0124] After fixation, 12 μL of 1.25 M glycine was added, and the fixation reaction was terminated by incubation at room temperature for 5 min. The slide was then rinsed in enzyme-free water (DEPC water) for 3 min and allowed to air dry.

[0125] The tissue was then decrosslinked using 0.2 N hydrochloric acid (HCl) solution, 50 μL each time, incubated at room temperature for 5 min, and repeated 3 times. After completion, the tissue was washed twice with 1×PBS / 0.2% BSA solution.

[0126] 2. In situ transposition (Tn5 transposase-mediated adapter insertion)

[0127] Prepare the tagmentation mixture: 35 μL of 2× tagmentation buffer (66 mM Tris-Ac, 132 mM Kac, 20 mM MgAc, 32% DMF, 0.02% Digitonin), 31 μL of water, 2 μL of Tn5 transposase embedded with Adaptor A, and 2 μL of Tn5 transposase embedded with Adaptor B, for a total volume of 70 μL. Add to the target region and incubate at 37 ℃ for 90 min.

[0128] After the reaction was complete, 4 μL of 0.5 M EDTA was added to terminate the reaction. The slide was allowed to stand at room temperature for 5 min, then immersed in DEPC water for 3 min to clean it, and finally air-dried.

[0129] 3. First round of spatial barcode connection (Barcode A)

[0130] A PDMS chip with a horizontal channel spacing of 10 μm was placed over the tissue slice, and the fixture was assembled. Each channel was injected with a barcode mixture: 3 μL Ligation mix (1x T4 Ligase Buffer (NEB M0202M), 100 U / μL T4 DNA Ligase (NEB M0202M), 0.1% Trition-X100) + 1 μL of the first round barcode (Barcode A) (per well).

[0131] The barcode linking reaction was carried out by incubation at 37 °C for 1 hour. After the reaction, the barcode was sealed with BlockingOligo, which is complementary to Barcode A, to prevent any unreacted barcodes from spreading and continuing to react. The barcode was then thoroughly washed with DEPC water and allowed to air dry.

[0132] An exemplary portion of the nucleotide sequence of Barcode A is shown below, using a double-stranded structure formed by annealing with Barcode A linker CAAGTATGCAGCGCGCTCAAGCACGTGGAT (SEQ ID NO.11). The underlined portion is the coding portion, used to distinguish it from other Barcodes and to represent different spatial locations. This region does not contain cytosine.

[0133] DNA_barcode_A1 (SEQ ID NO.1):

[0134] 5'P-CGCGCTGCATACTTG GTTAAGAGGAA CCCATGATCGTCCGA;

[0135] DNA_barcode_A2 (SEQ ID NO.2):

[0136] 5'P-CGCGCTGCATACTTG AGTAGGAAGAT CCCATGATCGTCCGA;

[0137] DNA_barcode_A3 (SEQ ID NO.3):

[0138] 5'P-CGCGCTGCATACTTG GAATTAGGTGT CCCATGATCGTCCGA;

[0139] DNA_barcode_A4 (SEQ ID NO.4):

[0140] 5'P-CGCGCTGCATACTTG GGAGATTAATG CCCATGATCGTCCGA;

[0141] DNA_barcode_A5 (SEQ ID NO.5):

[0142] 5'P-CGCGCTGCATACTTG TATTGTGGAAT CCCATGATCGTCCGA.

[0143] 4. Second-round spatial barcode connection (Barcode B)

[0144] Replace the vertical PDMS chip and perform the second round of barcode connection. Inject 3 μL of Ligationmix + 1 μL of the second round of barcode (Barcode B) into each channel (per well).

[0145] After incubation at 37 °C for 1 hour, the chip was removed, rinsed with DEPC water for 5 min, and air-dried. The single-well chip and clamp were then reassembled, and 50 μL of cell lysis buffer + 10 μL of Proteinase K was added. The tissue was digested at 55 °C for 2 hours. The lysed solution was collected into a 1.5 mL EP tube. DNA was purified using 1.4× SPRI beads and finally eluted with 37 μL of enzyme-free water.

[0146] An exemplary portion of the nucleotide sequence of Barcode B is shown below, using a double-stranded structure formed by annealing with Barcode B_linkerCAAGTATGCAGCGCGCTCAAGCACGTGGAT (SEQ ID NO.12). The underlined portion is the coding portion, used to distinguish it from other Barcode Bs and to represent different spatial locations. This region does not contain cytosine.

[0147] DNA_barcode_B1 (SEQ ID NO.6):

[0148] AGGGTGTAGTGGGTTTGGAGG GTTAAGAGGAA ATCCACGTGCTTGAG;

[0149] DNA_barcode_B2 (SEQ ID NO.7):

[0150] AGGGTGTAGTGGGTTTGGAGG AGTAGGAAGAT ATCCACGTGCTTGAG;

[0151] DNA_barcode_B3 (SEQ ID NO.8):

[0152] AGGGTGTAGTGGGTTTGGAGG GAATTAGGTGTATCCACGTGCTTGAG;

[0153] DNA_barcode_B4 (SEQ ID NO.9):

[0154] AGGGTGTAGTGGGTTTGGAGG GGAGATTAATG ATCCACGTGCTTGAG;

[0155] DNA_barcode_B5 (SEQ ID NO.10):

[0156] AGGGTGTAGTGGGTTTGGAGG TATTGTGGAAT ATCCACGTGCTTGAG.

[0157] 5. Joint extension and hmC displacement reaction

[0158] 1 μL of pre-prepared fully CpG-methylated Spike-in λ-DNA (CpG-methylated λ-DNA internal reference) and SP64 DNA modified with hydroxymethylation at specific sites were added to purified DNA to evaluate glycosylation protection and deamination efficiency.

[0159] Next, a mixture of DNA polymerase with strand displacement activity and dNTPs (dCTP replaced with dhmCTP) is used to fill the gap between the adapter and the barcode, and to replace CTP in both the adapter and the barcode with hmCTP to prevent sequence changes caused by subsequent deamination reactions and ensure sequence fidelity. The reaction principle is as follows (see schematic diagram). Figure 3 After Tn5 is interrupted and a connector is added, a 9bp single-chain region will appear, such as... Figure 3 The blue area is shown in the diagram. During strand amplification, the double-stranded portion of the genomic DNA can be considered as a primer, and amplification proceeds along the direction of the thick red arrow. A DNA polymerase with strand displacement activity is used here, causing the adapters and barcodes to be replaced by the newly synthesized strands. In this replacement process, the C in the adapters and barcodes is replaced with 5hmC, while the original genomic DNA remains unaffected.

[0160] The specific preparation method of the reaction system is shown in Table 1:

[0161] Table 1

[0162]

[0163] Reaction procedure: react at 65 ℃ for 45 min, then incubate at 4 ℃. The DNA was purified again using 1.4×SPRI beads and eluted with 25 μL of enzyme-free water.

[0164] 6. T4-BGT-catalyzed glycosylation modification, the reaction system is shown in the table below, with a total volume of 40 μL:

[0165] Table 2

[0166]

[0167] Incubate at 37 ℃ for more than 3 hours; then add 1 μL of stop solution and continue incubating at 37 ℃ for 30 min.

[0168] Purified using 1.4×SPRI beads (Solid Phase Reversible Immobilization) and dissolved in 17 μL of enzyme-free water.

[0169] 7. Deamination reaction (reagents from NEB EM-seq kit)

[0170] Add 16 μL of sample to 4 μL of freshly prepared 0.1 mol / L NaOH, mix well, and incubate in a 50°C thermal cycler for 10 min, then immediately place on ice. Prepare a deamination reaction mixture on ice, with a total volume of 40 μL.

[0171] Table 3

[0172]

[0173] 8. PCR Amplification and Library Construction: Prepare a 90 μL PCR reaction system, as shown in the table below:

[0174] Table 4

[0175]

[0176] PCR reaction conditions:

[0177] Table 5

[0178]

[0179] The PCR products were purified using 0.8× SPRI beads, and the recovered libraries were used for sequencing.

[0180] 9. Sequencing: Llumina NovaSeq 6000, PE150 (paired-end 150 bp).

[0181] 10. Quality Control: Use UMI-tools to remove barcode mismatched reads; use Trim Galorev 0.6.6 to remove connectors and filter low-quality reads.

[0182] 11. Sequence Alignment: Barcodes A and B were extracted from Read 2; alignment was performed using Bismark; the sequence was split into a 9216 (96×96) pixel BAM subset based on the two rounds of barcode combination. Sequencing Results:

[0183] The average genome coverage per pixel is approximately 1.8%. The deamination efficiency exceeds 98%, and the glycosylation protection efficiency exceeds 98%.

[0184] Example 2

[0185] To compare the effects of different HCl treatment methods on genome coverage during the tissue fixation and pretreatment steps, the ShmC-seq library construction method of Example 1 was used. In the "tissue fixation and pretreatment" step, decrosslinking was performed without HCl solution, once with 0.2 mol / L HCl solution, and three times with 0.2 mol / L HCl solution. In situ transposition was then performed, and primers were designed based on the adapter sequence inserted by transposition for PCR amplification and sequencing. The genome coverage of the obtained libraries was then compared. The results are as follows: Figure 3 As shown, the genome coverage of the obtained library increases with the number of decrosslinking treatments performed with 0.2 mol / L HCl solution.

[0186] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0187] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples, characterized in that, Including steps (A) to (F): (A) DNA in fixed tissue sections is broken in situ to prepare double-stranded DNA fragments, and adapters are added to the DNA fragments in situ; the chromatin in the fixed tissue sections is dehistoned. (B) In situ barcode encoding is performed on the DNA fragments in the tissue sections processed in step (A) so that the regions in the tissue sections containing DNA fragments with the same barcode form pixels; (C) Separate, extract, and purify the DNA fragments treated in step (B); (D) Fill in the missing nucleotide residues between the adapter and barcode of the DNA fragment separated in step (C); (E) Using an enzymatic reaction system, the cytosine bases in the DNA fragment separated in step (D) are converted into other base types; and, (F) The DNA fragments obtained in step (E) are used as a tissue sample spatial DNA hydroxymethylation sequencing library.

2. The method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples according to claim 1, characterized in that, DNA in fixed tissue sections was broken using Tn5 transposase with pre-loaded adapters, while adapters were added to the DNA fragments in a Tn5 transposase-mediated manner. Optionally, step (A) includes adding different adapters to both ends of the DNA fragment.

3. The method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples according to claim 1, characterized in that, Tissue sections were fixed with formaldehyde at concentrations of 0.2% w / v to 0.5% w / v; Optionally, tissue sections were fixed with formaldehyde at a concentration of 0.2% w / v; Optionally, the cross-linking treatment may be performed at least twice using HCl with a concentration of at least 0.2 mol / L; Optionally, the cross-linking process can be performed three times using 0.2 mol / L HCl.

4. The method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples according to claim 1, characterized in that, In-situ barcoding on DNA fragments includes two-dimensional spatial barcoding of DNA fragments; Optionally, a microfluidic chip can be used to encode DNA fragments in tissue sections in situ using two-dimensional spatial barcodes. Optionally, the coded portion of the barcode does not contain cytosine bases.

5. The method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples according to claim 1, characterized in that, A first internal reference fragment and a second internal reference fragment are added to the DNA fragment separated in step (C); the first internal reference fragment is a fragment without methylated cytosine; the second internal reference fragment is a fragment of cytosine with known hydroxymethylation modification at a specific site. Optionally, step (D) further includes replacing the cytosine in the connector and barcode with hydroxymethylated cytosine.

6. The method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples according to claim 1, characterized in that, The enzyme-catalyzed reaction system includes T4-BGT and APOBEC; Optionally, the unpurified DNA fragments treated with the enzymatic reaction system in step (E) can be amplified by PCR using a reaction system containing UDI PrimerPair and NEBNext Q5U Master Mix.

7. The method for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples according to any one of claims 1 to 6, characterized in that, Including steps (A) to (F): (A) Tissue sections were fixed with formaldehyde at a concentration of 0.2% w / v. After the fixation reaction was terminated, the cross-linking was decross-linked three times with 0.2 mol / L HCl. Then, Tn5 transposase with pre-loaded adapters was used to break the DNA in the fixed tissue sections. At the same time, different adapters were added in situ at both ends of the DNA fragments under the mediation of Tn5 transposase. (B) Using a microfluidic chip to encode DNA fragments in tissue slices processed in step (A) using two-dimensional spatial barcodes to form a two-dimensional grid-like spatial barcode array; (C) Separate the DNA fragment obtained in step (B) and add a first internal reference fragment and a second internal reference fragment to it; the first internal reference fragment is a fragment without methylated cytosine bases; the second internal reference fragment is a fragment with hydroxymethylated cytosine bases at known sites. (D) Fill in the missing nucleotide residues between the linker and the barcode, and replace the cytosine bases in the linker and the barcode with hydroxymethylated cytosine bases; (E) First, T4-BGT is used to convert the 5-hydroxymethylcytosine bases in the DNA fragment to 5-glucosylhydroxymethylcytosine bases. Then, APOBEC is used for deamination to convert the cytosine and 5-methylcytosine bases in the DNA fragment to uracil bases; and, (F) The unpurified DNA fragments treated with the enzymatic reaction system in step (E) were amplified by PCR using a reaction system containing UDI Primer Pair and NEBNext Q5U Master Mix.

8. A kit for constructing a spatial DNA hydroxymethylation sequencing library from tissue samples, characterized in that... Includes a barcode, formaldehyde at a working concentration of 0.2% w / v to 0.5% w / v, and HCl at a working concentration of at least 0.2 mol / L.

9. A method for sequencing spatial DNA hydroxymethylation in tissue samples, characterized in that, include: The method for constructing a tissue sample spatial DNA hydroxymethylation sequencing library according to any one of claims 1 to 7, or the kit according to claim 8, is used to construct the library, and the library is then sequenced. Optionally, the sequencing includes the use of next-generation sequencing; Optionally, the tissue sample spatial DNA hydroxymethylation sequencing method further includes calculating the positioning information of the barcode encoding, calculating the DNA hydroxymethylation level corresponding to each spatial pixel, and generating a spatial hydroxymethylation map.

10. The library prepared using the tissue sample spatial DNA hydroxymethylation sequencing library construction method according to any one of claims 1 to 7, or the tissue sample spatial DNA hydroxymethylation sequencing library construction kit according to claim 8, in any one of (i) to (iv): (i) Construct an in situ spatial map of DNA hydroxymethylation on tissue sections; (ii) Prepare a kit for in situ DNA hydroxymethylation spatial mapping of tissue sections; (iii) Screening for biomarkers of hydroxymethylation sites; (iv) Prepare a kit for screening biomarkers of hydroxymethylation sites.

Images