Petroleum hydrocarbon degradation composite flora and application thereof

Abstract

The invention belongs to the technical field of oily sludge bioremediation, and particularly relates to a petroleum hydrocarbon degradation composite flora and application thereof, and the composite flora comprises P.megatherium OS-A1 and Bacillus tropicalis OS-D5; the P.megatherium OS-A1 is preserved in the China Center for Type Culture Collection on June 17, 2025, and the biological preservation number of the P.megatherium OS-A1 is CCTCC NO: M 20251408; the bacillus tropicalis OS-D5 is preserved in the China Center for Type Culture Collection on June 17, 2025, and the biological preservation number of the bacillus tropicalis OS-D5 is CCTCC NO: M 20251409. According to the invention, the technical problems of poor flora stability and incomplete metabolic substrate coverage in the prior art are solved, the coverage of full carbon chain degradation is realized, the limitation of a single strain on specific hydrocarbon degradation is avoided, and a breakthrough solution is provided for complex petroleum pollution remediation.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of oily sludge bioremediation, and particularly relates to a complex bacterial flora composed of specific bacterial strains and application of the complex bacterial flora in oily sludge and oil-contaminated soil remediation, and especially relates to a petroleum hydrocarbon-degrading complex bacterial flora and application thereof. BACKGROUND

[0002] Oily sludge is one of the main pollution sources in the petroleum industry, and is a kind of oily solid waste generated in the process of oil exploitation, oil refining, transportation and storage. Oily sludge belongs to a multi-emulsion system, and is mainly composed of petroleum hydrocarbons, solid particles, heavy metals and surfactants. The petroleum components can be divided into four categories: aliphatic hydrocarbons, aromatic hydrocarbons, asphaltenes and resins, and typical components include benzene series, naphthenes, polycyclic aromatic hydrocarbons and other organic matters with volatility and insolubility. If these high-concentration hydrocarbon-heavy metal complex pollutants are directly released into the environment without treatment, they will complete the cross-media diffusion of the "soil-water" system through the pathways of dissolved phase migration or particulate state transfer, and directly affect the biodiversity of aquatic organisms and the ecosystem function. Polycyclic aromatic hydrocarbons, as pollutants in oily sludge, not only have significant genetic toxicity, but also have biological accumulation characteristics, which pose a serious threat to human health. Therefore, it is urgent to develop a method for efficiently degrading oily sludge containing complex hydrocarbons to reduce the impact of oily sludge on the ecological environment.

[0003] The oily sludge treatment system follows the "reduction-recovery-disposal" three-stage strategy. Traditional oily sludge disposal technologies, such as landfill disposal, high-temperature incineration treatment and solidification stabilization, generally have technical bottlenecks such as insufficient efficiency and limited economic feasibility. Bioremediation technology has become a frontier research direction in the field of pollution control due to its environmental compatibility and ecological safety. Petroleum-degrading microorganisms in oily sludge can metabolize with petroleum hydrocarbons as the sole carbon source, and convert them into carbon dioxide, water and other non-toxic intermediate products. In addition, petroleum-degrading microorganisms can secrete biological surfactants, which can reduce the surface tension between oil and water, thereby improving the biological affinity of microorganisms to petroleum and their degradation capacity. Bioremediation technology based on microbial degradation has become the best choice for oily sludge remediation due to its high degradation degree and metabolic activity.

[0004] In the oil-contaminated environment, due to natural competition or genetic variation, the proportion of functional strains with oil degradation ability gradually increases from 0.1% to 1%~10% in the total microbial community. More than 200 kinds of known oil hydrocarbon degrading bacteria, including bacteria, fungi and algae, among which bacteria are the main hydrocarbon metabolizing microorganisms. Microorganisms show significant differences in the metabolic capacity of different hydrocarbons in oil-containing sludge. Although each type of hydrocarbon component has biodegradability, the decomposition rate shows a clear gradient characteristic, in which alkanes are the easiest to decompose, and macromolecular substances such as asphaltene are the most difficult to decompose. Current research on oil hydrocarbon biodegradation mainly uses two ways: one is the directional degradation of pure strains. However, due to the complexity of oil pollutants and the limitations of single strain degradation, no strain has been found that can completely degrade oil hydrocarbons. The other is to degrade oil hydrocarbons by constructing a complex microbial community. The complex microbial community relies on the mutual complementation of the unique metabolic characteristics of each bacterial species to effectively promote the degradation of oil hydrocarbons. This multi-strain synergistic metabolic network effectively breaks through the metabolic limitations of single strains and significantly improves the bioremediation efficiency of complex pollution systems. In addition, the complex microbial community has the advantages of stable biological community, high microbial activity, high degradation efficiency, strong adaptability to environmental changes, and more abundant enzyme system.

[0005] Currently, researchers have screened high-efficiency oil-degrading bacteria from different environments and constructed complex microbial communities with synergistic effects. However, the existing complex microbial community construction relies more on empirical combination and ignores the metabolic competition and antagonistic effects between bacterial species, resulting in unstable synergistic effects. In addition, the complex microbial community is sensitive to environmental parameters such as temperature, pH, and salinity, which can inhibit the activity of the microbial community or lead to an imbalance in the structure of the microbial community. Furthermore, traditional complex microbial communities lack molecular mechanism guidance and systematic analysis of synergistic metabolic pathways, making it difficult to achieve full carbon chain coverage. Therefore, the present application integrates antagonistic experiments, response surface optimization, and gas chromatography-mass spectrometry (GC-MS) to first realize the "functional complementation-synergistic metabolism-environment adaptation" trinity of microbial community design and achieve full carbon chain degradation coverage, avoiding the limitations of single strains on specific hydrocarbon degradation. This provides a breakthrough solution for complex oil pollution remediation. SUMMARY

[0006] In order to solve the above defects or improvement needs of the prior art, the present application provides a petroleum hydrocarbon degradation composite bacterial community and an application thereof, which aims to realize the design of a trinity of "functional complementation-metabolic synergy-environmental adaptation" through antagonistic experiments, response surface optimization and gas chromatography-mass spectrometry (GC-MS) for the first time, and to realize the coverage of full carbon chain degradation, thereby avoiding the limitation of single bacterial species on specific hydrocarbon degradation, and providing a breakthrough solution for complex petroleum pollution remediation. Thus, the technical problems of poor stability and incomplete metabolic substrate coverage of the bacterial community in the prior art are solved.

[0007] In order to achieve the above-mentioned purpose, according to one aspect of the present application, a petroleum hydrocarbon degradation composite bacterial community is provided, which comprises Priestia megaterium OS-A1 and Bacillus tropicus OS-D5; the Priestia megaterium OS-A1 has been preserved in the China Center for Type Culture Collection on June 17, 2025, located at Wuhan University, Wuhan, China, and its biological preservation number is CCTCC NO: M 20251408; the Bacillus tropicus OS-D5 has been preserved in the China Center for Type Culture Collection on June 17, 2025, located at Wuhan University, Wuhan, China, and its biological preservation number is CCTCC NO: M 20251409.

[0008] Preferably, the mass ratio of the Priestia megaterium OS-A1 and the Bacillus tropicus OS-D5 is 1.5:1-2.5:1.

[0009] According to another aspect of the present application, an application of the petroleum hydrocarbon degradation composite bacterial community in the degradation treatment of hydrocarbon-containing oily sludge is provided.

[0010] Preferably, the method comprises the following steps: (1) inoculating the composite bacterial community into a liquid culture medium for activation to prepare a bacterial suspension for use; (2) preparing an inorganic salt culture medium, adding crude oil into the inorganic salt culture medium, and then inoculating the bacterial suspension into the inorganic salt culture medium.

[0011] Preferably, in step (1), the activation time is 12-36 h. Preferably, in step (2), the mass of the crude oil to the volume of the inorganic salt culture medium is 1-4 g / L. Preferably, the volume of the bacterial suspension is 0.5-1.5% of the volume of the inorganic salt culture medium.

[0012] Preferably, the inorganic salt medium has a pH of 6.6-7.0, and the inorganic salt medium has a salinity value of 0.5-1.5%.

[0013] Preferably, the inorganic salt medium comprises K2HPO4, NH4NO3, KH2PO4, MgSO4, CaCl2, NaCl, FeCl3 and deionized water.

[0014] Compared with the prior art, the above technical scheme conceived by the present application can achieve the following beneficial effects: (1) The petroleum degradation composite bacterial community OS-AD provided by the present application combines the metabolic capacity of OS-A1 strain for medium and long chain alkanes and the degradation advantage of single bacterium OS-D5 for short chain hydrocarbons, realizes full coverage of degradation of full carbon chain petroleum hydrocarbons through the cooperative division of labor among the bacterial communities, effectively avoids the limitation of bacterial species for degradation of specific petroleum hydrocarbons, and improves the remediation capacity for petroleum pollution. In addition, the composite bacterial community OS-AD integrates the aromatic hydrocarbon metabolic capacity of strain OS-D5, especially for degradation of medium and low ring aromatic hydrocarbons such as naphthalene, acenaphthene and phenanthrene. In summary, the petroleum degradation composite bacterial community provided by the present application is suitable for remediation of complex petroleum component pollution scenes of mixed alkanes and medium and low ring aromatic hydrocarbons, has excellent degradation efficiency and good cost-effectiveness, and shows broad application potential and high economic return value.

[0015] (2) The present application limits the mass of crude oil to 2-4% of the volume of the inorganic salt medium; a moderate concentration of crude oil can exert the petroleum degradation capacity of the composite bacterial community, and can avoid the toxic effects of high concentration of crude oil.

[0016] The volume of the bacterial suspension is limited to 0.5-1.5% of the volume of the inorganic salt medium; the inoculum amount of the strain can not only ensure a high biomass, but also realize efficient degradation of petroleum hydrocarbons.

[0017] The pH of the inorganic salt medium is limited to 6.6-7.0, and the salinity value of the inorganic salt medium is limited to 0.5-1.5%; a neutral and low-salt environment is most conducive to the petroleum degradation function of the composite bacterial community, not only maintaining the optimal activity of key degradation enzymes, but also promoting the synergistic metabolism of the bacterial community for complex hydrocarbons in petroleum. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 is a drive oil experiment effect diagram of 13 strains of bacteria in Example 3 of the present application.

[0019] Figure 2 is a partial result schematic diagram of constructing a composite bacterial community by antagonistic experiment in Example 4 of the present application.

[0020] Figure 3The total petroleum hydrocarbon degradation rate of the 10 groups of complex bacterial flora in Example 4 of the application.

[0021] Figure 4 The growth curve diagram of Bacillus megaterium and Bacillus tropicus and their complex bacterial flora in beef extract peptone medium in Example 5 of the application, wherein (a) is the growth curve of OS-A1; (b) is the growth curve of OS-D5; (c) is the growth curve of the complex bacterial flora OS-AD.

[0022] Figure 5 The scanning electron microscope imaging diagram of Bacillus megaterium and Bacillus tropicus and their complex bacterial flora in Example 5 of the application.

[0023] Figure 6 The infrared spectrum diagram of the surfactant of Bacillus megaterium and Bacillus tropicus and their complex bacterial flora in Example 5 of the application. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical scheme and advantages of the application more clear and explicit, the application will be further described in detail below in combination with the drawings and examples. It should be understood that the specific examples described herein are only used to explain the application and do not limit the application. In addition, the technical features involved in the various embodiments of the application described below can be combined with each other as long as they do not conflict with each other.

[0025] The purpose of the application is to provide a high-efficiency broad-spectrum petroleum-degrading complex bacterial flora, which includes Bacillus megaterium and Bacillus tropicus.

[0026] Specifically, the complex bacterial flora is composed of two functionally complementary strains, one is Bacillus megaterium OS-A1 with the ability to degrade medium-long chain alkanes. The Latin name of the bacteria is: Priestia megaterium OS-A1, the preservation unit is: China Center for Type Culture Collection, the address is: Wuhan, Wuhan University, China, the preservation date is: June 17, 2025, and the preservation number is: CCTCC NO: M 20251408. The other is Bacillus tropicus OS-D5 with the ability to degrade short-chain alkanes and medium-low ring aromatic hydrocarbons. The Latin name of the bacteria is: Bacillus tropicus OS-D5, the preservation unit is: China Center for Type Culture Collection, the address is: Wuhan, Wuhan University, China, the preservation date is: June 17, 2025, and the preservation number is: CCTCC NO: M 20251409.

[0027] In some embodiments, the mass ratio of the Bacillus megaterium and the Bacillus tropicus is 1.5:1 to 2.5:1.

[0028] This invention utilizes oil-containing sludge from an oilfield in Inner Mongolia to selectively enrich and gradually acclimate indigenous microorganisms within the sludge, progressively screening out native functional microorganisms with highly efficient crude oil degradation capabilities. The final-generation acclimatized bacterial culture was repeatedly purified by gradient dilution and streak plating until morphologically uniform pure strains with petroleum degradation potential were obtained. The screened strains were inoculated into inorganic salt media containing crude oil, with a blank control group included, and cultured for 7 days in a shaker at 30 ℃ and 150 r / min. During this period, the petroleum hydrocarbon degradation function of the strains was evaluated in multiple dimensions, including growth curve analysis, surfactant synthesis capacity characterization, and evaluation of petroleum hydrocarbon degradation efficiency and component specificity. Gas chromatography-mass spectrometry was used to determine the total petroleum hydrocarbon degradation rate, aliphatic hydrocarbon degradation rate, and aromatic hydrocarbon degradation rate, ultimately isolating five functional strains with synergistic degradation metabolic characteristics.

[0029] In some embodiments, the antagonistic effect among five functional bacterial strains was analyzed using the agar-Oxford cup diffusion method. By continuously adjusting the ratio of the bacterial strains, a total of 10 complex bacterial groups with different ratios and no antagonistic effect were screened. Based on the growth capacity and total petroleum hydrocarbon degradation rate of the bacterial groups in crude oil culture medium, a complex bacterial group consisting of two strains that can secrete biosurfactants and efficiently degrade petroleum hydrocarbons was finally screened.

[0030] In some embodiments, *Priscilla megaterium* OS-A1 was isolated from beef extract peptone medium. The colonies were oval or round, milky white, with a raised center, a smooth and bright surface, a moist texture, and were easily picked up. Under a scanning electron microscope, they appeared as rod-shaped cells, arranged singly or in pairs. Take 3.0 mL of OD... 600 The OS-A1 bacterial suspension with a pH of 1.0 was inoculated into 100 mL of crude oil inorganic salt medium with a pH of 6.80 and a salinity of 1.0%. After being cultured in a shaker at 30 ℃ and 150 r / min for 7 days, the degradation rate of total petroleum hydrocarbons, as well as the degradation rate of each carbon chain of n-alkanes and aromatic hydrocarbons, was determined by GC-MS. In some embodiments, *Bacillus tropicalis* OS-D5 was isolated from beef extract peptone medium. The colonies were oval, pale yellow, with a raised center and regularly rounded edges, appearing rod-shaped under a scanning electron microscope. Take 3.0 mL of OD... 600 The OS-D5 bacterial suspension with a pH of 1.0 was inoculated into 100 mL of crude oil inorganic salt medium with a pH of 6.80 and a salinity of 1.0%. After being cultured in a shaker at 30 ℃ and 150 r / min for 7 days, the degradation rate of total petroleum hydrocarbons, as well as the degradation rate of each carbon chain of n-alkanes and aromatic hydrocarbons, was determined by GC-MS.

[0031] In some embodiments, the complex bacterial community OS-AD is screened by antagonism, the mass ratio of the bacterial community OS-A1:OS-D5 is determined to be 2:1, and the growth curve of the complex bacterial community is further determined. It is found that the lag phase is shortened and the adaptability to the external environment is stronger. The scanning electron microscope results of the complex bacterial community show that the two bacterial communities can be aggregated without difference, further revealing the synergistic cooperation ability between the complex bacterial communities. 2.0 mL of OS-A1 bacterial suspension with OD 600 value of 1.0 and 1.0 mL of OS-D5 bacterial suspension with OD 600 value of 1.0 are inoculated into 100 mL of crude oil inorganic salt medium with pH=6.80 and salinity value of 1.0%, and then placed in a shaking table at 30°C and 150 r / min for 7 days. The total petroleum hydrocarbon degradation rate and the degradation rates of n-alkanes of each carbon chain and aromatic hydrocarbons are determined by GC-MS.

[0032] Example 1: Enrichment and domestication of petroleum degrading functional strains The sample is collected from oil sludge in an oilfield in Inner Mongolia, packaged in a sterile centrifuge tube, and stored in a 4°C low-temperature refrigerator. 10.0 g of oil-containing sludge sample is accurately weighed and added to 100 mL of sterilized crude oil inorganic salt medium (crude oil concentration 1.0 g / L) to preliminarily construct an enrichment system of petroleum degrading functional strains, and then placed in a constant temperature shaking incubator at 30°C and 150 rpm for 24 h. After the preliminary culture is completed, 3 mL of culture solution is taken to fresh crude oil inorganic salt medium for further enrichment culture, and the strains with petroleum degrading ability are gradually enriched. In order to further screen strains with high degradation capacity, the supernatant after multiple enrichment is inoculated into a medium with a petroleum concentration of 1000 mg / L for domestication. The emulsification of the medium is observed and recorded during the domestication process, and the petroleum concentration is gradually increased to promote the adaptation of the strains to high-concentration petroleum environment and optimize the degradation capacity of the strains, so as to screen the local petroleum degrading functional strains.

[0033] Inorganic salt liquid medium: K2HPO4 1.0 g, NH4NO3 2.0 g, KH2PO4 0.5 g, MgSO4·7H2O 0.5 g, anhydrous CaCl2 0.02 g, NaCl 5.0 g, FeCl3 0.01 g, deionized water 1000 mL, pH 7.0.

[0034] Crude oil liquid medium, 1.0 g of crude oil is added to the above 1000 mL inorganic salt medium.

[0035] Example 2: Purification and identification of petroleum degrading functional strains.

[0036] Take the acclimated culture solution 1 mL in the test tube with 9 mL sterile water, mix evenly, and prepare 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 different dilution concentrations of bacterial suspension by ten-fold dilution method. Under aseptic operation environment, take 0.1 mL of bacterial suspension of 10 -3 ~10 -7 dilution gradient and evenly spread on the surface of crude oil solid culture medium, set 3 parallel experiments for each gradient, and after cooling, invert in 30 ℃ constant temperature incubator overnight culture.

[0037] After the plate colonies grow vigorously, pick the colonies with different morphological characteristics (such as color, size, and colony surface elevation) and inoculate them into LB solid culture medium for continuous culture, and use the partitioned streak method to purify the separated colonies on the plate for three generations, until a pure strain with uniform morphology is obtained. To maintain the metabolic activity of the strain, inoculate the pure strain with uniform morphology into 100 mL of LB liquid culture medium, and shake culture at 30 ℃, 150 rpm until the logarithmic growth phase. After enrichment culture, take 1 mL of bacterial suspension in a cryotube, and add an equal volume of sterilized 60% (v / v) glycerol, and freeze at -80 ℃ until use.

[0038] The purified strain after isolation and screening is identified by PCR technology and 16S rRNA gene sequencing, and universal primers 27F and 1492R are used for PCR amplification. The relevant primer sequences are as follows: 27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT. The 50.0 microliter reaction system of PCR amplification includes 25.0 microliters of 2x Taq MasterMix (Day), 2.0 microliters of universal primers 27F and 1492R, 1.0 microliter of sample DNA template, and ddH2O to make up the system to 50.0 microliters. The PCR reaction program of 16S rRNA is as follows: 94 ℃ pre-denaturation for 2 min, 94 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 30 cycles, then 72 ℃ final extension for 2 min, and finally 4 ℃ preservation.

[0039] PCR was detected by agarose gel electrophoresis, and the bands with the length of the gene sequencing fragments were sent to the sequencing company for sequencing. The related sequencing results were compared by Blast sequence in the NCBI database. A total of 13 strains of petroleum degrading functional bacteria were screened, which belonged to the genera of Priestia Pristinia, Bacillus Bacillus, Lysinibacillus Lysinibacillus, Chryseobacterium Chryseobacterium, Thauera Tewa, Staphylococcus Staphylococcus, Ciceribacter Aeromonas, Achromobacter Achromobacter and Pseudomonas Pseudomonas, and the similarity rate was more than 98%.

[0040] Example 3: Determination and screening of the degradation performance of the petroleum degrading functional strains.

[0041] To characterize the degradation performance of the 13 strains of petroleum degrading functional strains, the strain biosurfactant synthesis ability and petroleum hydrocarbon degradation efficiency and component specificity were determined to further screen the high-efficiency petroleum degrading bacteria. The obtained strains were inoculated into LB liquid medium and activated for 24 h, and then the OD 600 value of the bacteria was adjusted to 0.8-1.0 by ultraviolet spectrophotometry, and the bacterial suspension was prepared for use. 100 mL of inorganic salt medium was prepared, 3.0% (m / v) of crude oil was added, 1.0% (v / v) of bacterial suspension was inoculated, and a blank control group was set. The culture was incubated at 30°C and 150 rpm for 7 days, and the growth and petroleum degradation of the 13 strains of petroleum degrading bacteria in the crude oil culture medium were observed and recorded. After the degradation was completed, dichloromethane was used to extract the crude oil, Agilent gas chromatograph mass spectrometer GC-MS 7890B was used to determine the remaining total petroleum hydrocarbon content, and the degradation rates of petroleum carbon chains and polycyclic aromatic hydrocarbons were calculated.

[0042] The emulsification method can be used to characterize the stability of the biosurfactant to petroleum hydrocarbon emulsion. 5 mL of the supernatant after degradation was taken, the bacteria were removed by high-speed centrifugation, and an equal volume of n-hexadecane was mixed to form an emulsion system by vortex oscillation. After standing for 24 h, the emulsion layer stability height was determined, and the emulsification index was calculated. The oil displacement experiment can evaluate the biosurfactant production ability of the strain by observing the change of the crude oil film. The strain was inoculated into LB liquid medium and cultured at 30°C for 3 days, and then centrifuged to obtain cell-free supernatant. 20 mL of deionized water was added to a culture dish, 10 μL of crude oil was added dropwise to form a uniform oil film, 10 μL of cell-free supernatant was added, and a positive control group (equal amount of Tween 80) and a blank control group (sterile H2O) were set. The oil film was observed and the transparent circle of the oil film was measured to characterize the biosurfactant production ability of the strain. Figure 1The diagram shows the oil displacement experiment results of 13 petroleum-degrading bacteria (OS-A1, OS-A2, OS-A3, OS-A4, OS-A5, OS-B3, OS-B4, OS-B5, OS-C2, OS-C3, OS-C5, OS-D2, OS-D5) and the control group (con) without the strains.

[0043] The degradation characteristics of petroleum components and the production of surfactants by the strains were determined by shaking incubator degradation experiments. The synergistic potential and metabolic characteristics of the strains were systematically analyzed, and five strains were selected as the main functional strains for constructing the complex microbial community. Strain OS-A1 ( Priestia megaterium OS-A3 Chryseobacterium gambrini OS-B4 Lysinibacillus fusiformis OS-D2 Priestia flexa ) and OS-D5 ( Bacillus tropicus Furthermore, it is necessary to further screen for synergistic complex bacterial groups through antagonistic experiments.

[0044] Example 4: Screening of complex bacterial community antagonism.

[0045] The Oxford agar cup co-culture plate spreading method was used to evaluate the antagonistic effects among five functional strains and to optimize the strain ratio to avoid interspecific inhibition. At the same time, degradation experiments were used to screen out the most efficient complex bacterial group with the best synergistic effect.

[0046] Five bacterial strains were inoculated into LB liquid medium for activation, the bacterial cells were washed with sterile PBS buffer, and OD was prepared. 600 The bacterial suspension concentration was 0.08–0.10. 20 mL of molten LB agar medium was mixed thoroughly with 200 μL of the bacterial suspension and added to a 9 cm diameter sterile petri dish as the baseline bacterial layer. Then, a sterile Oxford cup (6 mm inner diameter, 8 mm outer diameter) was vertically inserted into the surface of this layer using sterile forceps, and 200 μL of the test strain was added. An equal volume of sterile water was used as a blank control. Each experiment was repeated in triplicate. Figure 2 The partial composite bacterial groups (A1-A3, A1-B4, A1-D2, A1-D5, A3-B4, A3-D2) shown are compared with the blank control group (con). After incubation at 30 ℃ for 24 h, the presence of inhibition zones around the Oxford cups was observed. For bacterial combinations exhibiting antagonistic effects, the amount of background bacteria added was gradually changed until a bacterial group combination with disappearing or negligible inhibition zones was selected. A total of 10 composite bacterial group combinations without antagonistic effects or with negligible effects were screened (A1-A3, A1-B4, A1-D2, A1-D5, A3-B4, A3-D2, A3-D5, B4-D2, B4-D5, D2-D5), and the total petroleum hydrocarbon degradation rate was further determined through petroleum degradation experiments.Figure 3 As shown, the degradation rates of 10 groups without antagonistic complex bacteria were determined by the shaking degradation experiment, and finally the strain OS-A1 Priestia megaterium ) and OS-D5 (Bacillus tropicus ) combination of the highest degradation rate, and the ratio of the bacterial community is OS-A1:OS-D5=2:1, and it is named as OS-AD.

[0047] The 16S rRNA gene sequence of the strain OS-A1 is as follows:

[0048] 16S rRNA gene sequence of strain OS-D5:

[0049] Example 5: Functional characterization of high-efficiency composite bacterial flora

[0050] (1) Growth curve determination Single bacteria OS-A1 and OS-D5 were inoculated into LB liquid medium for activation, and centrifuged and resuspended in sterile PBS buffer, and adjusted OD 600 to 0.1 as inoculum. Single bacteria were inoculated into fresh medium at 2% (v / v) of bacterial liquid inoculum, and composite bacterial flora was inoculated at 2:1 of OS-A1:OS-D5, and incubated at 30 °C, 150 rpm. Samples were taken every 2 h, and OD 600 was determined to draw the bacterial growth curve, and the Logistic function was used for fitting, as shown in Figure 4 The results showed that the growth curves of single bacteria OS-A1, OS-D5 and composite bacterial flora OS-AD were highly similar, entered the exponential growth phase after 4 h, and the lag phase of the composite bacterial flora was shortened, and its ability to adapt to changes in the external environment was stronger.

[0051] (2) Scanning electron microscopy experiment Strains OS-A1 and OS-D5 were inoculated into LB liquid medium for activation, and then the samples were rinsed with sterile PBS (pH=7.4) buffer for 2-3 times, 15 min each time, and centrifuged at 5 000 rpm for three minutes to remove the supernatant, and then 2.5% (w / v) glutaraldehyde solution was added, and the bacterial pellet was fixed at 4 °C for 12 h. After fixation, PBS was used to rinse three times to remove the glutaraldehyde fixing solution, and then gradient dehydration was performed by using ethanol solution (30%, 50%, 70% and 90%, v / v) in turn, 15 min each time, and finally anhydrous ethanol was used for dehydration twice (20 min each time) to completely replace the water in the cells. After dehydration, the samples were treated with isoamyl acetate twice to remove ethanol interference, and finally the samples were freeze-dried, sputtered, and observed by scanning electron microscopy, and the morphological characteristics of the bacterial cells were observed and photographed, as shown in Figure 5 Both functional strains were rod-shaped, arranged singly or in pairs, and had obvious extracellular polymers on the surface.

[0052] (3) Infrared spectroscopy characterization The single bacteria was inoculated into 150 mL of LB liquid medium and cultured at 30 °C and 150 rpm for 72 h. The culture was centrifuged at 9,000 rpm for 15 min to remove the bacterial bodies, and the filtrate was adjusted to pH = 2.0 with 6 mol / L hydrochloric acid. After being placed at 4 °C for 24 h, an equal volume of ethyl acetate was added to extract the organic phase twice. Then, anhydrous sodium sulfate was added for dehydration and drying. After removing the organic solvent by rotary evaporation at 40 °C, the crude surfactant product was obtained. The crude extract was dissolved in a 0.05 mol / L NaHCO3 solution, centrifuged at 4 °C and 9,000 rpm for 15 min, and the precipitate was collected and dried for infrared spectrum analysis. The results are shown in Figure 6 It was found that both functional strains could secrete lipopeptide surfactants by comparing the spectrum with the library.

[0053] Example 6: Optimization of crude oil degradation experiment conditions of high-efficiency composite bacterial community.

[0054] The strains OS-A1 and OS-D5 stored at -80 °C were activated by inoculating into LB liquid medium, and 1.0% of bacterial liquid was inoculated into the petroleum medium according to the ratio of the composite bacterial community (2:1). The blank control group was not inoculated with bacterial community. Single-factor experiments were conducted to explore the best experimental conditions of the composite bacterial community according to the following experimental settings, and the total petroleum hydrocarbon degradation rate was determined by GC-MS.

[0055] (1) The pH gradient of the petroleum medium was set to 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0, and the OD600 of the medium was measured on the 4th and 7th days. After 7 days of complete degradation, the change trend of the crude oil degradation rate was analyzed.

[0056] (2) The inoculation amount of bacterial liquid (i.e. the volume ratio of bacterial liquid to inorganic salt medium) was set to 1.0%, 2.0%, 3.0%, 5.0%, 10.0%, and 20.0%, and the OD600 of the medium was measured on the 4th and 7th days. After 7 days of complete degradation, the change trend of the crude oil degradation rate was analyzed.

[0057] (3) The salinity gradient of the petroleum medium was set to 0%, 0.5%, 1.0%, 2.0%, 3.0%, and 5.0%, and the OD600 of the medium was measured on the 4th and 7th days. After 7 days of complete degradation, the change trend of the crude oil degradation rate was analyzed.

[0058] The GC-MS determination of the total petroleum hydrocarbon degradation rate of each group found that the complex bacterial community OS-AD not only maintained a high growth activity at pH = 7.0, bacterial liquid inoculation amount 3.0%, and salinity 1.0%, but also had the highest total petroleum hydrocarbon degradation rate. At the same time, the interaction between pH, bacterial liquid inoculation amount, and salinity was analyzed using response surface, and the optimal experimental range was determined as pH value 6.80, salinity value 1.0%, and bacterial liquid inoculation amount value 3.0%. Under this condition, the highest total petroleum hydrocarbon degradation rate was 73.46%.

[0059] Example 7: Analysis of crude oil degradation components of high-efficiency complex bacterial community.

[0060] According to the optimal degradation experiment conditions of the complex bacterial community determined in Experiment 6, the n-alkane and aromatic hydrocarbon degradation rates of single bacteria OS-A1, OS-D5, and complex bacterial community OS-AD under these conditions were determined by GC-MS. The known internal standard concentration (hexadecane-D34 and phenanthrene-D10) was added for quantitative analysis of n-alkane and polycyclic aromatic hydrocarbon, respectively. As shown in Table 1, the degradation rates of each carbon chain n-alkane and total petroleum hydrocarbon (TPH) in the experimental group.

[0061] Table 1 n-alkane and TPH degradation rates in samples

[0062] After 7 d of degradation experiment, strain OS-A1 had high degradation capacity for medium and long chain alkanes (C15~C36), and strain OS-D5 had significant degradation advantage for short chain alkanes (C8~C14). The degradation rate of complex bacterial community OS-AD for short chain alkanes was significantly higher than that of single bacteria OS-A1 and OS-D5, indicating that single bacteria OS-D5 played a key role in the degradation of short chain alkanes in the complex bacterial community, and the degradation of short chain alkanes by the two strains had synergistic effect; the degradation rate of complex bacterial community OS-AD for long chain alkanes was significantly higher than that of single bacteria OS-D5 and lower than that of single bacteria OS-A1, indicating that the oxidation capacity of medium and long chain alkanes of strain OS-A1 played a leading role in the complex bacterial community. Comprehensive analysis of the degradation rates of n-alkanes of each carbon chain found that single bacteria OS-A1 in the complex bacterial community degraded medium and short chain alkanes, and single bacteria OS-D5 further mineralized, realizing the synergistic effect of petroleum degradation. This synergistic division between bacterial communities realizes the coverage of petroleum degradation for all carbon chains, avoids the limitation of single strain degrading specific hydrocarbons, and is especially suitable for the bioremediation of complex petroleum components with mixed alkanes.

[0063] Table 2 degradation rates of each PAH in the experimental group

[0064] Ten polycyclic aromatic hydrocarbons (PAHs) with 2-5 rings were detected by solid phase extraction, GC-MS qualitative and quantitative analysis. The complex bacterial community OS-AD retained the degradation characteristics of strain OS-D5 for medium and low ring aromatic hydrocarbons, and the degradation rates of naphthalene, phenanthrene and chrysene were all more than 50%. In particular, the biological toxicity of naphthalene was significantly reduced. In addition, the degradation rate of acenaphthylene by the complex bacterial community OS-AD was significantly higher than that by the single strain, indicating that the biological oxidation pathway of acenaphthylene was activated through the synergistic complementary metabolic pathway between strains OS-A1 and OS-D5. In summary, the complex bacterial community improves the broad-spectrum degradation ability of polycyclic aromatic hydrocarbons by integrating the aromatic hydrocarbon metabolic ability of strain OS-D5.

[0065] Those skilled in the art will readily understand that the above description is only preferred embodiments of the present application, and is not intended to limit the present application. Any modifications, equivalent replacements and improvements made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A petroleum hydrocarbon-degrading complex bacterial flora, characterized by, Including *Priscilla megaterium* OS-A1 and *Bacillus tropicalis* OS-D5; the biological preservation number of *Priscilla megaterium* OS-A1 is: CCTCC NO: M 20251408; the biological preservation number of *Bacillus tropicalis* OS-D5 is: CCTCC NO: M 20251409.

2. The petroleum hydrocarbon-degrading complex microbial community as described in claim 1, characterized in that, The mass ratio of *Priestella megaterium* OS-A1 to *Bacillus tropicalis* OS-D5 is 1.5:1 to 2.5:

1.

3. The application of the petroleum hydrocarbon degradation complex microbial community as described in claim 1 or 2 in the degradation treatment of hydrocarbon-containing oily sludge.

4. The application of the petroleum hydrocarbon-degrading composite microbial community as described in claim 3 in the degradation treatment of hydrocarbon-containing oily sludge, characterized in that, Includes the following steps: (1) The composite microbial community described in claim 1 or 2 is inoculated into a liquid culture medium for activation, and a bacterial suspension is prepared for later use; (2) Prepare an inorganic salt culture medium, add crude oil to the inorganic salt culture medium, and then inoculate the bacterial suspension into the inorganic salt culture medium.

5. The application of the petroleum hydrocarbon-degrading composite microbial community as described in claim 4 in the degradation treatment of hydrocarbon-containing oily sludge, characterized in that, In step (1), the activation time is 12~36 h.

6. The application of the petroleum hydrocarbon-degrading complex microbial community as described in claim 4 in the degradation treatment of hydrocarbon-containing oily sludge, characterized in that, In step (2), the ratio of the mass of the crude oil to the volume of the inorganic salt culture medium is 1~4 g / L; The volume of the bacterial suspension is 0.5% to 1.5% of the volume of the inorganic salt culture medium.

7. The application of the petroleum hydrocarbon-degrading composite microbial community as described in claim 4 in the degradation treatment of hydrocarbon-containing oily sludge, characterized in that, The inorganic salt culture medium has a pH of 6.6 to 7.0 and a salinity of 0.5% to 1.5%.

8. The application of the petroleum hydrocarbon-degrading composite microbial community as described in claim 7 in the degradation treatment of hydrocarbon-containing oily sludge, characterized in that, The inorganic salt culture medium includes K2HPO4, NH4NO3, KH2PO4, MgSO4, CaCl2, NaCl, FeCl3, and deionized water.

Images