Modified bacteria with anti-tumor activity and better safety
Patent Information
- Application Number
- CN202480044083.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-07-07
- Filing Date
- 2024-07-08
- Publication Date
- 2026-02-06
AI Technical Summary
Existing tumor bacterial therapies have problems with insignificant therapeutic effects and safety, and bacteria carrying intact lipopolysaccharides may lead to immune responses and side effects after administration to the patient.
Construct strictly anaerobic bacteria through synthetic biology gene circuits, delete wild-type LPS biosynthesis and transport-related genes, and conditionally express these missing genes in bacteria to achieve site-specific production of complete LPS in tumors and induce immune responses. , while avoiding immune responses from normal tissues.
It can improve the therapeutic effect while reducing side effects in tumor treatment, and enhance the reliability and safety of anti-tumor.
Smart Images

Figure 00000080_0000 
Figure 00000080_0001 
Figure 00000080_0002
Abstract
Description
Modified bacteria with anti-tumor activity and improved safety Technical Field
[0001] The present invention relates to modified bacteria with anti-tumor activity, a pharmaceutical composition comprising the modified bacteria and anti-tumor use thereof.
[0002] Background of the Invention
[0003] Cancer has become one of the most serious diseases threatening human life and health, but existing treatments (radiotherapy, chemotherapy, surgery, and targeted drugs) all have shortcomings, and there is an urgent need to develop new treatments. Traditional tumor bacterial therapy, represented by Coley toxin, has a history of 150 years, but the effect is unstable and there are safety issues. The development of genetic engineering technology has made great progress in reducing the toxicity of strains. A series of clinical trials have confirmed the safety of attenuated engineered bacteria for the treatment of human tumors, but the efficacy is poor, and it is difficult to achieve both safety and therapeutic efficacy, which cannot meet the needs of clinical tumor treatment.
[0004] In addition, after administration to patients, bacteria carrying intact lipopolysaccharide (LPS) can activate the immune response of normal tissues and organs. On the one hand, such an immune response will lead to the loss of anti-tumor bacteria during the delivery process, and on the other hand, it will cause side effects to the body, such as causing weight loss in patients. In 2016, researchers obtained an attenuated Salmonella strain by knocking out the msbB gene and the murein lipoprotein synthesis gene lppAB in the Salmonella LPS pathway, respectively, or by knocking out these two genes at the same time. However, previous studies have shown that the attenuated Salmonella strain VNP20009 (msbB-, purI-) with msbB knocked out has no obvious tumor treatment effect.
[0005] Therefore, further in-depth optimization of tumor bacterial therapy is imperative.
[0006] Summary of the Invention
[0007] This invention constructs strictly anaerobic bacteria through synthetic biology gene circuits. Upon administration to animals or humans, the bacteria demonstrate therapeutic effects against tumors and are quickly cleared from normal tissues and organs, thereby reducing the toxic side effects that can occur in animals or humans due to long-term bacterial persistence. The bacteria of this invention also lack genes associated with wild-type LPS biosynthesis and transport, and conditionally express the missing genes in the bacteria, thereby achieving site-specific production of complete LPS in tumors. This can induce an immune response within the tumor while avoiding an immune response against LPS in normal tissues, resulting in more reliable anti-tumor efficacy and safety.
[0008] The present invention provides a modified bacterium, wherein compared with an unmodified starting strain, the bacterium comprises a hypoxia-regulatable lipopolysaccharide (LPS) gene expression cassette, wherein the LPS gene expression cassette comprises a gene involved in LPS biosynthesis or transport or a gene encoding a cell wall lipoprotein under the control of a first strictly hypoxia-inducible promoter.
[0009] In one embodiment, the bacteria further comprises a hypoxia-regulatable essential gene expression cassette comprising an essential gene of the bacteria under the control of a second stringent hypoxia-inducible promoter, and the bacteria lacks at least one gene required for survival in macrophages or its functional expression product, compared to an unmodified starting strain.
[0010] In one embodiment, compared to an unmodified starting strain, the bacteria further comprises a hypoxia-regulatable essential gene expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacteria under the control of a second strict hypoxia-inducible promoter, and the bacteria lacks at least one gene involved in or regulating an endogenous anti-oxidative stress response pathway or its functional expression product.
[0011] In one embodiment, compared to an unmodified starting strain, the bacteria further comprises a hypoxia-regulatable essential gene expression cassette and a pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacteria under the control of a second strict hypoxia-inducible promoter, and the pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, and the bacteria lacks at least one gene involved in or regulating an endogenous anti-oxidative stress response pathway or a functional expression product thereof.
[0012] In one embodiment, compared to an unmodified starting strain, the bacteria further comprises a hypoxia-regulatable essential gene expression cassette comprising an essential gene of the bacteria under the control of a second strictly hypoxia-inducible promoter, and a pH-regulatable expression cassette comprising a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, wherein the bacteria expresses wild-type LPS and the bacteria lack at least one gene required for survival in macrophages or a functional expression product thereof.
[0013] The present invention provides a modified Salmonella typhimurium bacterium, wherein compared with an unmodified starting strain, the bacterium comprises a hypoxia-regulatable lipopolysaccharide (LPS) gene expression cassette, wherein the LPS gene expression cassette comprises a gene involved in LPS biosynthesis or transport or a gene encoding a cell wall lipoprotein under the control of a first strictly hypoxia-inducible promoter.
[0014] In one embodiment, the bacteria further comprise a hypoxia-regulatable essential gene expression cassette and a pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacteria under the control of a second strictly hypoxia-inducible promoter, and the pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, and the bacteria lack at least one gene involved in or regulating an endogenous anti-oxidative stress response pathway or its functional expression product.
[0015] In one embodiment, the bacteria further comprises a hypoxia-regulatable essential gene expression cassette comprising an essential gene of the bacteria under the control of a second strictly hypoxia-inducible promoter, and a pH-regulatable expression cassette comprising a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, wherein the bacteria expresses wild-type LPS and the bacteria lacks at least one gene required for survival in macrophages or a functional expression product thereof.
[0016] In one embodiment, the present invention provides a pharmaceutical composition comprising the modified bacteria of the present invention. In one embodiment, the pharmaceutical composition is used to treat a malignant tumor.
[0017] In one embodiment, the present invention provides a method for treating a malignant tumor, comprising administering a pharmaceutical composition of the present invention to a subject suffering from a malignant tumor.
[0018] In one embodiment, the present invention provides use of the modified bacteria of the present invention in the preparation of a medicament for treating a malignant tumor. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1: Schematic diagram of the DB-ZW1 strain construction scheme.
[0020] Figure 2: Changes in the distribution of DB-ZW1 in tumors and different organs over time. Figure 2A shows the changes in the density of DB-ZW1 in tumors and different organs over time; Figure 2B shows the changes in the density of DB-ZW1 in different normal organs over time.
[0021] Figure 3: Tumor inhibitory effects of DB-ZW1 on bladder cancer, melanoma, and in situ colon cancer. Figures 3A-C show the effects of DB-ZW1 on tumor volume of subcutaneous bladder cancer, in situ melanoma, and in situ colon cancer, respectively; Figure 3D shows the effect of DB-ZW1 on tumor number of in situ colon cancer.
[0022] Figure 4: Schematic diagram of the construction of DB-ZW1 variant strains. For non-essential genes, homologous recombination was used to replace the target gene with a resistance gene to knock out the endogenous gene (Figure 4A). For essential genes, essential genes were replaced with endogenous genes under the control of the aTc inducer (Figure 4B), or genes driven by hypoxia-activated promoters were replaced with endogenous genes, thereby ensuring that the bacteria express these genes only in hypoxic areas (necrotic areas of malignant solid tumors) (Figure 4C).
[0023] FIG5 : PCR detection of the construction of strains expressing various LPS-related genes or murein lipoprotein genes induced by hypoxia, wherein the lane numbers correspond to the primer numbers corresponding to the genes in Table 5 .
[0024] FIG6 : Therapeutic effects of strain ZW1(Δmsbb)-Fnr-SP-msbb-KnaR.
[0025] FIG. 7 : Therapeutic effects of strain ZW1(ΔlppAB)-Fnr-SP-lppAB-KnaR.
[0026] Detailed Description of the Invention
[0027] definition
[0028] Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are those widely used in the respective fields and are standard procedures. To facilitate a better understanding of the present invention, definitions and explanations of relevant terms are provided below.
[0029] As used herein, "lipopolysaccharide (LPS)" refers to a substance composed of lipids and polysaccharides, which is a component of the outer wall of the Gram-negative bacterial cell wall and is generally composed of O-antigen, polysaccharide core region and lipid A. The genes involved in the biosynthesis of LPS include genes involved in the synthesis of O-antigen, genes involved in the synthesis of the core region and genes involved in the synthesis of lipid A. The transport of lipopolysaccharide involves the assembly of lipid A and the core (msbA gene), the extension synthesis of the O unit (wzy gene), the turnover of the inner membrane of the O unit (wzxE gene) and the transport of LPS from the inner membrane to the outer membrane (lptA, lptB, lptC / yrbK, lptD and lptG). Examples of genes involved in the biosynthesis or transport of LPS and their DNA sequences are shown in Table 1. Those skilled in the art will understand that the genes also encompass the reverse complementary sequences of the listed sequences.
[0030] Table 1
[0031] *Essential genes
[0032] #Put the O antigen on glucose
[0033] As used herein, the term "hypoxia regulated essential gene expression cassette" refers to a segment of DNA capable of initiating expression of an essential gene under hypoxic conditions, which contains an essential gene controlled by a hypoxia-inducible promoter and, if necessary, may further contain other regulatory elements required for expression of the essential gene.
[0034] As used herein, an "essential gene" refers to a gene that plays a decisive role in the growth and / or survival of bacteria. If the bacteria lack this gene or its functional expression product, they will not be able to survive, divide, and / or grow normally. Typical examples of bacteria lacking essential genes or their functional expression products are auxotrophic strains, which, in the absence of specific exogenous supplements, cannot survive, divide, and / or grow normally under in vitro culture conditions or in vivo environments. Essential genes are typically present in a single copy on the bacterial chromosome.
[0035] As used herein, "inducible promoter" refers to a promoter that can significantly increase the transcription level of a gene under the stimulation of a specific physical or chemical signal.
[0036] As used herein, a "strictly hypoxia inducible promoter" refers to a promoter that can initiate transcription of a specific gene under anaerobic conditions but can hardly be activated and produce transcripts under aerobic conditions.
[0037] A "strictly hypoxia-inducible promoter" useful in the present invention can be identified by the following experiment:
[0038] Construct an expression strain containing the essential gene (e.g., dapA / dapE) under the control of the promoter to be tested. Streak a Luria-Bertani (LB) plate in an anaerobic incubator at 37°C for 24 hours. Under anaerobic conditions, pick a single colony and resuspend it in 20 μl of LB liquid medium. Add 20 μl of the resuspended single colony to each of the following four tubes: ABCD. Add 5 μl to each tube:
[0039] A. 2 ml LB liquid medium,
[0040] B. 2 ml LB liquid medium,
[0041] C. 2 ml LB liquid medium + DAP,
[0042] D. 2 ml LB liquid medium + DAP.
[0043] Incubate tubes AC at 37°C in an anaerobic incubator for 24 hours, and incubate tubes BD in an aerobic shaker at 37°C for 24 hours. If bacteria can grow in tubes ACD but not in tube B (OD600 value less than 0.05), the promoter is considered to be strictly hypoxia-inducible.
[0044] Table 2 lists exemplary strictly hypoxia-inducible promoters and pH-inducible promoters that were identified in the above experiments and can be used in the present invention.
[0045] Table 2
[0046] As used herein, "gene involved in or regulating the endogenous anti-oxidative stress response pathway" refers to a gene that participates in the resistance of bacteria (e.g., intracellular bacteria, such as Salmonella) to the killing effects of reactive oxygen species (ROS) in vivo or in vitro environments.
[0047] As used herein, "genes required for survival in macrophages" refer to genes involved in maintaining or enhancing the ability of intracellular bacteria to survive in macrophages. The functions of these gene products are related to resisting the killing effect of macrophages on microorganisms. Therefore, the deletion of these genes or their functional expression products can reduce the ability of bacteria (e.g., intracellular bacteria, such as Salmonella) to survive in macrophages.
[0048] In this article, "functional expression products" include RNA and protein, etc.
[0049] As used herein, "facultative anaerobic bacteria" refers to bacteria that can survive both in the presence and absence of oxygen.
[0050] As used herein, "pH regulated expression cassette" refers to a set of gene expression elements whose expression is regulated by the pH of the environment.
[0051] As used herein, "a promoter that is active under acid pH conditions" refers to a promoter that can be activated under acidic pH conditions and regulates the expression of a related gene. In some embodiments, the promoter that is active under acidic pH conditions of the present invention can be activated or still has promoter activity when the pH value is lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5. In some embodiments, the promoter that is active under acidic pH conditions also has promoter activity at neutral pH values (e.g., pH 7.0-7.4).
[0052] "Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to polymers of naturally occurring amino acids. The terms "polypeptide," "peptide," "amino acid sequence," and "protein" may also include modified forms including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.
[0053] As used herein, "polynucleotide" refers to a macromolecule composed of multiple nucleotides linked by phosphodiester bonds, wherein the nucleotides include ribonucleotides and deoxyribonucleotides. The sequences of the polynucleotides of the present invention can be codon-optimized for different host cells (e.g., E. coli) to improve polypeptide expression. Methods for codon optimization are known in the art.
[0054] "Sequence identity" between two polypeptide sequences or two polynucleotide sequences refers to the percentage of identical amino acids or nucleotides between the sequences. Methods for assessing the level of sequence identity between polypeptide or polynucleotide sequences are known in the art. Sequence identity can be assessed using various known sequence analysis software. For example, sequence identity can be assessed using the EMBL-EBI online alignment tool (https: / / www.ebi.ac.uk / Tools / psa / ). Sequence identity between two sequences can be assessed using the Needleman-Wunsch algorithm using default parameters.
[0055] As used herein, the term "live bacteria" refers to a strain that is viable, has active nutritional metabolic characteristics, and is capable of performing its own biological functions. Live bacteria may include bacterial biomass produced during the metabolic process of the strain.
[0056] In this article, term " gram-negative bacteria " refers to after carrying out the known partial program of gram staining, does not retain the bacterium of the initial basic dye staining agent (such as, crystal violet) as.In exemplary gram staining, first by heating, cell is fixed on slide and dyed with basic dye (such as, crystal violet), and described basic dye is absorbed by gram-negative bacteria and gram-positive bacteria.Then, slide is processed with mordant (such as, Gram's iodine solution), and described mordant is incorporated into basic dye (such as, crystal violet) and is trapped in cell.Then, by cell acetone or ethanol washing, then with the second dye of different colors counterstaining (such as, safranin).Gram-positive organism retains initial purple dyeing, and gram-negative organism decolours by organic washing solvent, therefore shows counterstaining. Exemplary Gram-negative bacteria include, but are not limited to, Escherichia species, Shigella species, Salmonella species, Campylobacter species, Neisseria species, Haemophilus species, Aeromonas species, Francisella species, Yersinia species, Klebsiella species, Bordetella species, Legionella species, Corynebacterium species, Citrobacter species, Chlamydia species, Brucella species, Pseudomonas species, Helicobacter species, and Vibrio species.
[0057] Term used herein " malignant solid tumor " refers to the abnormal mass of tissue, does not usually include cyst or liquid area. Solid tumor may be benign (non-cancer), or malignant (cancer). Different types of malignant solid tumors are named with the cell type that forms them. The example of malignant solid tumor is sarcoma, carcinoma and lymphoma. Leukemia (blood cancer) does not form malignant solid tumor (according to the definition of NIH National Cancer Institute) usually. Malignant solid tumor includes but is not limited to the abnormal cell mass that may be derived from different tissue types, described different tissue types are such as liver, colon, colorectal, skin, breast, pancreas, cervix uteri, uterine body, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testis, thyroid or lung etc., therefore malignant solid tumor includes malignant solid liver tumor, colon tumor, colorectal tumor, skin tumor, breast tumor, pancreatic tumor, cervix tumor, uterine body tumor, bladder tumor, gallbladder tumor, kidney tumor, laryngeal tumor, lip tumor, oral cavity tumor, esophageal tumor, ovarian tumor, prostate tumor, stomach tumor, testicular tumor, thyroid tumor or lung tumor etc.
[0058] As used herein, for therapeutic purposes, the term "subject" is preferably a subject in need of treatment for a target pathological condition, such as a tumor. For preventive purposes, the subject is preferably a subject at risk of developing or prone to developing a target pathological condition. The term "subject" includes living organisms, such as prokaryotes and eukaryotes. Examples of subjects include mammals, such as humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. In a specific embodiment of the present invention, the subject is a human.
[0059] As used herein, "treatment" is a process used to obtain a beneficial or desired clinical outcome. For the purposes of the present invention, a beneficial or desired clinical outcome includes, but is not limited to, one or more of the following: reducing the proliferation of neoplastic or cancerous cells (or destroying neoplastic or cancerous cells), inhibiting the metastasis of neoplastic cells, shrinking or reducing the size of a tumor, alleviating a malignant tumor, alleviating symptoms caused by a malignant tumor, improving the quality of life of a subject suffering from a malignant tumor, reducing the dosage of other drugs required to treat a malignant tumor, delaying the progression of a malignant tumor, curing a malignant tumor, and / or prolonging the survival of a patient suffering from a malignant tumor.
[0060] As used herein, an "effective amount" or "effective dose" of a bacterium, drug, or pharmaceutical composition is an amount sufficient to achieve any one or more beneficial or desired results. For prophylactic uses, beneficial or desired results include eliminating or reducing the risk of disease, reducing the severity of disease, or delaying the onset of disease, including biochemical, histological, and / or behavioral symptoms of disease, its complications, and intermediate pathological phenotypes that appear during the course of disease. For therapeutic uses, beneficial or desired results include, for example, alleviating one or more symptoms of a disease (such as a tumor), reducing the dose of other drugs required to treat the disease, enhancing the effect of another drug, prolonging the survival of the treated subject, and / or delaying the progression of cancer in the patient. For example, an "effective amount" preferably inhibits cell growth or tumor growth by at least about 10%, preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, and more preferably at least about 80%, relative to an untreated subject. The ability to inhibit tumor growth can be evaluated in an animal model system that predicts efficacy against human tumors. Alternatively, it can be evaluated by examining the ability to inhibit cell growth, which can be determined in vitro by assays well known to those skilled in the art. A therapeutically effective amount of a therapeutic compound can reduce tumor size or otherwise alleviate symptoms in a subject. Such an amount can be determined by one skilled in the art based on factors such as the size of the subject, the severity of the subject's symptoms, and the specific composition or route of administration selected.
[0061] As used herein, "pharmaceutically acceptable carrier" includes any material that allows the ingredient to retain biological activity when combined with the active ingredient and does not react with the subject's immune system, including but not limited to disintegrants, binders, fillers, buffers, tonicity agents, stabilizers, antioxidants, surfactants, or lubricants. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (such as by injection or infusion). For example, depending on the route of administration, the bacteria of the present invention can be wrapped in a material to protect the bacteria from the effects of acids and other natural conditions that can inactivate the bacteria. Pharmaceutically acceptable carriers include physiological saline, PBS buffer, sterile aqueous solutions or dispersions, and powders for the temporary preparation of injections or dispersions. The use of these media and reagents for pharmaceutically active substances is well known in the art. Conventional media or reagents, except for any incompatibility with the active compound, may be in the pharmaceutical composition of the present invention.
[0062] Modified bacteria
[0063] The present invention provides a modified bacterium having improved anti-tumor activity and / or improved safety.
[0064] In one embodiment, the modified bacteria of the present invention comprise an inducible lipopolysaccharide (LPS) gene expression cassette, which comprises a gene involved in LPS biosynthesis or transport or a gene encoding a cell wall lipoprotein under the control of an inducible promoter, compared to the unmodified starting strain.
[0065] In one embodiment, the LPS gene expression cassette is a hypoxia-regulatable lipopolysaccharide (LPS) gene expression cassette comprising a gene involved in LPS biosynthesis or transport or a gene encoding a cell wall lipoprotein under the control of a first strictly hypoxia-inducible promoter.
[0066] In one embodiment, the genes involved in LPS biosynthesis are selected from genes involved in O-antigen synthesis, genes involved in core region synthesis and genes involved in lipid A synthesis. In one embodiment, the genes involved in O-antigen synthesis are selected from rfbU, rfbN, rfbV, wzzB, gtrBb, gtrBa and rfbP / wbaP genes. In one embodiment, the genes involved in core region synthesis are selected from rfaB, rfaC / waaC, rfaF, rfaG, yibD, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaY, rfaZ, yijP, gmhA, yaeD, rfaE and rfaD genes. In one embodiment, the genes involved in lipid A synthesis are selected from the group consisting of lpxA, lpxB, lpxC, lpxD, lpxH, lpxK, htrB, msbB / lpxM, lpxO, lpxP, yeiU, kdtA, arnT, pagP, yjdB, yhjw, kdsA, kdsB, yrbI, and yrbH genes. In one embodiment, the genes involved in LPS transport are selected from the group consisting of msbA, Wzy, wzxE, lptA, lptB, lptC / yrbK, lptD, and lptG genes.
[0067] In one embodiment, the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein is functionally replaced by the inducible promoter, such as the first strictly hypoxia-inducible promoter, thereby the expression of the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein in the bacteria is completely controlled by the inducible promoter, such as the first strictly hypoxia-inducible promoter.
[0068] In one embodiment, the LPS gene expression cassette is exogenous, and the gene involved in LPS biosynthesis or transport or the gene encoding the cell wall lipoprotein naturally present in the bacterial chromosome is deleted or functionally inactivated, thereby allowing the expression of the gene involved in LPS biosynthesis or transport or the gene encoding the cell wall lipoprotein in the bacterium to be completely controlled by the inducible promoter, such as the first strictly hypoxia-inducible promoter. In one embodiment, the exogenous LPS gene expression cassette is integrated into the bacterial chromosome. In one embodiment, the exogenous LPS gene expression cassette is located outside the bacterial chromosome. In one embodiment, the exogenous LPS gene expression cassette is present in a plasmid carried by the bacterium.
[0069] In one embodiment, the bacteria further comprises a hypoxia-regulated essential gene expression cassette. In one embodiment, the essential gene expression cassette comprises an essential gene of the bacteria controlled by a second strict hypoxia-inducible promoter. In one embodiment, the bacteria lack at least one gene or its functional expression product that participates in or regulates an endogenous antioxidant stress response pathway. In one embodiment, the bacteria lack at least one gene or its functional expression product that is required for survival in macrophages. In one embodiment, the bacteria express wild-type lipopolysaccharide (LPS).
[0070] In one embodiment, the first and second strictly hypoxia-inducible promoters are each independently selected from pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA and Ptet-Fnr. Preferably, the first and second strictly hypoxia-inducible promoters are each independently selected from fnrSp and / or ssbp1 promoters.
[0071] In one embodiment, the modified bacteria of the present invention comprise a hypoxia-regulatable essential gene expression cassette compared to an unmodified starting strain, and the bacteria lack at least one non-essential gene involved in LPS biosynthesis or transport and / or a gene encoding a cell wall lipoprotein or its expression product.
[0072] In one embodiment, the genes involved in LPS biosynthesis are selected from genes involved in O-antigen synthesis, genes involved in core region synthesis and genes involved in lipid A synthesis. In one embodiment, the genes involved in O-antigen synthesis are selected from wzzB, gtrBb, gtrBa and rfbP / wbaP genes. In one embodiment, the genes involved in core region synthesis are selected from rfaB, yibD, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaZ, yijP, gmhA, yaeD, rfaE and rfaD genes. In one embodiment, the genes involved in lipid A synthesis are selected from lpxA, lpxC, lpxD, lpxH, msbB / lpxM, lpxO, lpxP, arnT, yjdB, kdsB, yrbI and yrbH genes. In one embodiment, the genes involved in LPS transport are selected from msbA, Wzy, lptA, lptB and lptG genes.
[0073] In one embodiment, the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter. In one embodiment, the bacterium lacks at least one gene involved in or regulating an endogenous anti-oxidative stress response pathway, or its functional expression product. In one embodiment, the bacterium lacks at least one gene required for survival in macrophages, or its functional expression product.
[0074] In one embodiment, the bacteria do not express wild-type lipopolysaccharide (LPS).In one embodiment, the bacteria do not express LPS or express a mutated or structurally incomplete LPS.
[0075] In one embodiment, the strict hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA and Ptet-Fnr. Preferably, the strict hypoxia-inducible promoter is ssbp1 promoter.
[0076] In one embodiment, the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacteria. In one embodiment, when cultured under aerobic conditions, the growth of the bacteria is dependent on the addition of DAP or its analogue to the culture medium. In one embodiment, the essential gene is selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof. Preferably, the essential gene is selected from dapA and dapE. Preferably, the dapE comprises a nucleotide sequence having ≥81%, preferably ≥82%, more preferably ≥83%, ≥84%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98% or most preferably ≥99% sequence identity to SEQ ID NO: 19. Preferably, the nucleotide sequence of dapE comprises SEQ ID NO: 19. Preferably, the nucleotide sequence of dapE consists of SEQ ID NO:19.
[0077] In one embodiment, the gene involved in or regulating the endogenous anti-oxidative stress response pathway is a gene of the HtrA serine protease family. In one embodiment, the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is a protein associated with the HtrA serine protease family. In one embodiment, the bacterium lacks HtrA serine protease activity. In one embodiment, the gene involved in or regulating the endogenous anti-oxidative stress response pathway is htrA. In one embodiment, the bacterium lacks htrA. Preferably, the htrA comprises a nucleotide sequence having ≥81%, preferably ≥82%, more preferably ≥83%, ≥84%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, or most preferably ≥99% sequence identity to SEQ ID NO:20. Preferably, the nucleotide sequence of htrA comprises SEQ ID NO:20. Preferably, the nucleotide sequence of htrA consists of SEQ ID NO: 20.
[0078] In one embodiment, the essential gene is a gene naturally present in the bacterial chromosome. In one embodiment, the native promoter of the essential gene is functionally replaced by the second strictly hypoxia-inducible promoter. Thus, expression of the essential gene in the bacteria is completely controlled by the second strictly hypoxia-inducible promoter.
[0079] In one embodiment, the essential gene expression cassette is exogenous. In one embodiment, the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated. Thus, the expression of the essential gene in the bacteria is completely controlled by the second strict hypoxia inducible promoter. In one embodiment, the exogenous essential gene expression cassette is integrated into the chromosome of the bacteria. In one embodiment, the exogenous essential gene expression cassette is located outside the chromosome of the bacteria. In one embodiment, the exogenous essential gene expression cassette is present in a plasmid carried by the bacteria.
[0080] In one embodiment, the modified bacteria further comprises a pH regulating expression cassette. In one embodiment, the modified bacteria comprises a hypoxia regulating essential gene expression cassette and a pH regulating expression cassette compared to the unmodified starting strain. In one embodiment, the pH regulating expression cassette comprises a gene for a hemolysin protein encoding bacteria of a promoter that is controlled by a promoter that is active under acidic pH conditions. According to some embodiments of the present invention, the promoter that is active under acidic pH conditions is active at a pH value in the range of about pH 4.0 to 7.0. In some embodiments, the promoter that is active under acidic pH conditions is active at a pH of pH 6.0 ± 1. In one embodiment, the promoter that is active under acidic pH conditions is active at a pH value lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5, or between any two pH value ranges. In one embodiment, the promoter active under acidic pH conditions is selected from sseA, ssrA, ssaB, ssaG, ssaM and ssaR. In one embodiment, the promoter active under acidic pH conditions is sseA. In one embodiment, the bacterial-derived hemolysin protein is a gram-negative bacterial hemolysin protein. In one embodiment, the gene encoding the gram-negative bacterial hemolysin protein is hlyA or hlyE. In one embodiment, the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae or Escherichia coli. Preferably, the hlyA comprises a nucleotide sequence having ≥81%, preferably ≥82%, more preferably ≥83%, ≥84%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, or most preferably ≥99% sequence identity to SEQ ID NO: 21. Preferably, the nucleotide sequence of the hlyA comprises SEQ ID NO: 21. Preferably, the nucleotide sequence of the hlyA consists of SEQ ID NO: 21.
[0081] In one embodiment, the unmodified starting bacterial strain is a facultative anaerobic bacterium. In one embodiment, the bacterium is Enterobacteriaceae (Enterobacteriaceae) bacterium. Preferably, the bacterium is Escherichia (Escherichia), Salmonella (Salmonella), Shigella (Shigella), Klebsiella (Klebsiella), Yersinia (Yersinia), Citrobacter (Citrobacter), Enterobacter (Enterobacter), Serratia (Serratia), Proteus (Proteus), Morganella (Morganella), Providencia (Providencia), Hafnia (Hafnia), Pantoea (Pantoea) bacterium. Preferably, the bacteria are selected from Escherichia coli, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, Escherichia vulneris, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis (Y.pseudotuberculosis), Yersinia aldouae, Yersinia bercov-ieri, Yersinia frederiksenii, Yersinia intermedia, Yersinia kristensii, Yersinia mollaretti, Yersinia rohdei, Yersinia ruckeri, Citrobacter freundii, Citrobacter kaseri, Citrobacter braakii, E.aerogenes, E.cloacae, E.gergoviac, E.sakazakii, E.tavlorac, E.aminigenus), E. intermedius, E. asburiac, E. cancerogenus, E. dissolvens, E. nimipressualis, S. marcescens, S. entomophila, S. ficaria, S. fonticola, S. grimesii, S. liquefaciens, S. odorifera, S. plymuthica, S. proteamaculans, Serratia rubidaea, Serratia ureilytica, P. mirabilis, P. vulgaris, P. myxofaciens, P. penneri, P. hauseri, M. morganii, P. alcalifaciens, P. rustigianii, P. stuartii, P. rettgeri, P. heimbochae, H. alvei, and P. agglomerans. Preferably, the bacterium is Salmonella typhimurium. Preferably, the starting strain is Salmonella typhimurium SL7207.
[0082] In one embodiment, when administered to a subject with a tumor, the bacteria can survive and proliferate in the tumor tissue but are rapidly cleared from normal tissue. In one embodiment, when administered to a subject with a malignant tumor, the bacteria can induce an anti-tumor specific immune response. In one embodiment, when administered to a subject with a malignant tumor, the bacteria can induce anti-tumor immune memory.
[0083] In one embodiment, the bacteria does not express wild-type flagellin. In one embodiment, the modified bacteria lacks the fliC gene.
[0084] In one embodiment, the bacteria survive in macrophages at a level of about 50% to about 30% of the unmodified starting strain's survival level. In one embodiment, the bacteria survive in macrophages at a level of about 30% to about 10% of the unmodified starting strain's survival level. Preferably, the bacteria survive in macrophages at a level of about 10% to about 1% of the unmodified starting strain's survival level.
[0085] Pharmaceutical composition
[0086] The present invention provides a pharmaceutical composition comprising an effective amount of the modified bacteria of the present invention. In one embodiment, the modified bacteria are live bacteria.
[0087] In one embodiment, the pharmaceutical composition is used to treat a malignant tumor. In one embodiment, the pharmaceutical composition is used to induce an anti-tumor specific immune response in a subject suffering from a malignant tumor. In one embodiment, the pharmaceutical composition is used to induce anti-tumor immune memory in a subject suffering from a malignant tumor. In one embodiment, the pharmaceutical composition is used to prevent or treat metastasis or recurrence of a malignant tumor. In one embodiment, the pharmaceutical composition is used to treat a malignant tumor that has become resistant to or failed previous anti-tumor therapy.
[0088] In one embodiment, the malignant tumor is a malignant tumor of the nervous system, respiratory system, digestive system, urinary system, reproductive system, hematopoietic system, lymphatic system, endocrine system or skin mucosa. In one embodiment, the malignant tumor is a sarcoma or cancer. In one embodiment, the malignant tumor is a solid tumor. In one embodiment, the malignant tumor is selected from glioma, neuroblastoma, retinoblastoma, nasopharyngeal cancer, oral cancer, tongue cancer, laryngeal cancer, head and neck cancer, melanoma, bronchial cancer, lung cancer, pleural cancer, esophageal cancer, gastric cancer, liver cancer, pancreatic cancer, bile duct cancer, colon cancer, rectal cancer, renal cell carcinoma, bladder cancer, prostate cancer, adrenal tumor, thyroid cancer, parathyroid cancer, pituitary tumor, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, cervical cancer, ovarian cancer, endometrial cancer, breast cancer, bone cancer and osteosarcoma.
[0089] In one embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
[0090] Treatment methods and uses
[0091] The present invention provides a method for treating malignant tumors, comprising administering an effective amount of the modified bacteria of the present invention or the pharmaceutical composition of the present invention to a subject suffering from a malignant tumor.
[0092] The present invention provides a method for inducing an anti-tumor specific immune response in a subject having a malignant tumor, comprising administering an effective amount of the modified bacteria of the present invention or the pharmaceutical composition of the present invention to the subject having a malignant tumor.
[0093] The present invention provides a method for inducing anti-tumor immune memory in a subject having a malignant tumor, comprising administering an effective amount of the modified bacteria of the present invention or the pharmaceutical composition of the present invention to the subject having the malignant tumor.
[0094] The present invention provides a method for preventing or treating metastasis or recurrence of a malignant tumor, comprising administering an effective amount of the modified bacteria of the present invention or the pharmaceutical composition of the present invention to a subject suffering from a malignant tumor.
[0095] The present invention provides a method for preventing or treating metastasis or recurrence of a malignant tumor, comprising administering an effective amount of the modified bacteria of the present invention or the pharmaceutical composition of the present invention to a subject suffering from metastasis or recurrence of a malignant tumor or a subject at high risk of metastasis or recurrence of a malignant tumor.
[0096] The present invention provides a method for treating a malignant tumor that has become resistant to or failed to be treated with previous anti-tumor therapy, comprising administering an effective amount of the modified bacteria of the present invention or the pharmaceutical composition of the present invention to a subject suffering from a malignant tumor that has become resistant to or failed to be treated with previous anti-tumor therapy.
[0097] The present invention provides use of the modified bacteria of the present invention in preparing a medicament for treating malignant tumors.
[0098] The present invention provides use of the modified bacteria of the present invention in the preparation of a medicament for inducing an anti-tumor specific immune response in a subject suffering from a malignant tumor.
[0099] The present invention provides use of the modified bacteria of the present invention in the preparation of a medicament for inducing anti-tumor immune memory in a subject suffering from a malignant tumor.
[0100] The present invention provides use of the modified bacteria of the present invention in preparing a medicament for preventing or treating metastasis or recurrence of malignant tumors.
[0101] The present invention provides use of the modified bacteria of the present invention in the preparation of a medicament for treating malignant tumors that have become resistant to or failed to be treated with previous anti-tumor therapies.
[0102] In one embodiment, the modified bacteria are live bacteria.
[0103] In one embodiment, the malignant tumor is a malignant tumor of the nervous system, respiratory system, digestive system, urinary system, reproductive system, hematopoietic system, lymphatic system, endocrine system or skin mucosa. In one embodiment, the malignant tumor is a sarcoma or cancer. In one embodiment, the malignant tumor is a solid tumor. In one embodiment, the malignant tumor is selected from glioma, neuroblastoma, retinoblastoma, nasopharyngeal cancer, oral cancer, tongue cancer, laryngeal cancer, head and neck cancer, melanoma, bronchial cancer, lung cancer, pleural cancer, esophageal cancer, gastric cancer, liver cancer, pancreatic cancer, bile duct cancer, colon cancer, rectal cancer, renal cell carcinoma, bladder cancer, prostate cancer, adrenal tumor, thyroid cancer, parathyroid cancer, pituitary tumor, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, cervical cancer, ovarian cancer, endometrial cancer, breast cancer, bone cancer and osteosarcoma.
[0104] In one embodiment, the bacteria, drugs or pharmaceutical compositions of the present invention are administered by intravenous injection, intratumoral injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, intracerebral administration, gastrointestinal administration, topical administration, oral mucosal administration, nasal administration, rectal administration, or vaginal administration. In one embodiment, the bacteria, drugs or pharmaceutical compositions of the present invention can be formulated into a form for administration by intravenous injection, intratumoral injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, intracerebral administration, gastrointestinal administration, topical administration, oral mucosal administration, nasal administration, rectal administration, or vaginal administration.
[0105] In one embodiment, the dosage form of the drug or pharmaceutical composition of the present invention can be, for example, in the form of a solution, emulsion, freeze-dried preparation or suspension; for oral administration, the dosage form can be in the form of a tablet or capsule; for intranasal dosage form, the dosage form can be in the form of a powder, nasal drops or aerosol; for topical administration, the dosage form can be an aqueous solution, suspension, ointment, cream or gel; for rectal or vaginal administration, the dosage form can be a suppository, enema or delivered as part of an endoscopic or colonoscopy procedure. In one embodiment, the drug or pharmaceutical composition is formulated as a solution, emulsion, freeze-dried preparation or suspension; for oral administration, it can be formulated as a tablet or capsule; for intranasal dosage form, it can be formulated as a powder, nasal drops or aerosol; for topical administration, it can be formulated as an aqueous solution, suspension, ointment, cream or gel; for rectal or vaginal administration, it can be formulated as a suppository, enema or delivered as part of an endoscopic or colonoscopy procedure. Methods well known in the art for preparing dosage forms are described, for example, in "Remington's Pharmaceutical Sciences" (20th ed.), ed. A. Gennaro, 2000, Mack Publishing Company, Easton, PA.
[0106] In some embodiments, the bacteria, drugs, or pharmaceutical compositions of the invention can be administered, for example, at intervals of about 1 minute, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes, 1 hour, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 hours, 1 day, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days, including ranges between any two of the listed values, e.g., 1 minute to 10 minutes, 1 minute to 30 minutes, 1 minute to 1 hour, 1 minute to 2 hours, 1 minute to 4 hours, 1 minute to 12 hours, 1 minute to 18 hours, 1 minute to 1 day, 10 minutes to In some embodiments, the present invention provides the following types of time intervals: 1 hour - 30 minutes, 10 minutes - 1 hour, 10 minutes - 2 hours, 10 minutes - 4 hours, 10 minutes - 12 hours, 10 minutes - 18 hours, 10 minutes - 1 day, 30 minutes - 1 hour, 30 minutes - 2 hours, 30 minutes - 4 hours, 30 minutes - 12 hours, 30 minutes - 18 hours, 30 minutes - 1 day, 30 minutes - 2 days, 1 hour - 2 hours, 1 hour - 4 hours, 1 hour - 12 hours, 1 hour - 18 hours, 1 hour - 1 day, 4 hours - 12 hours, 4 hours - 18 hours, 4 hours - 1 day, 1 day - 2 days, 1 day - 3 days, 1 day - 4 days, 1 day - 5 days, 1 day - 7 days, 1 day - 10 days, 2 days - 3 days, 2 days - 4 days, 2 days - 5 days, 2 days - 7 days, 2 days - 10 days or 5 days - 10 days. In some embodiments, the bacteria, drug, or pharmaceutical composition is administered once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every fifteen weeks, once every twenty weeks, once every twenty-five weeks, or once every twenty-six weeks.In some embodiments, the bacteria, drug, or pharmaceutical composition is formulated to be administered, for example, at intervals of about 1 minute, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes, 1 hour, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 hours, 1 day, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days, including ranges between any two of the listed values, e.g., 1 minute to 10 minutes, 1 minute to 30 minutes, 1 minute to 1 hour, 1 minute to 2 hours, 1 minute to 4 hours, 1 minute to 12 hours, 1 minute to 18 hours, 1 minute to 1 day, 1 minute to 2 0 min - 30 min, 10 min - 1 hour, 10 min - 2 hours, 10 min - 4 hours, 10 min - 12 hours, 10 min - 18 hours, 10 min - 1 day, 30 min - 1 hour, 30 min - 2 hours, 30 min - 4 hours, 30 min - 12 hours, 30 min - 18 hours, 30 min - 1 day, 30 min - 2 days, 1 hour - 2 hours, 1 hour - 4 hours, 1 hour - 12 hours, 1 hour - 18 hours, 1 hour - 1 day, 4 hours - 12 hours, 4 hours - 18 hours, 4 hours - 1 day, 1 day - 2 days, 1 day - 3 days, 1 day - 4 days, 1 day - 5 days, 1 day - 7 days, 1 day - 10 days, 2 days - 3 days, 2 days - 4 days, 2 days - 5 days, 2 days - 7 days, 2 days - 10 days, or 5 days - 10 days. In some embodiments, the bacteria, drug or pharmaceutical composition is formulated to be administered once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every fifteen weeks, once every twenty weeks, once every twenty-five weeks or once every twenty-six weeks. The dosage regimen may depend on the pattern of pharmacokinetic decay that the practitioner expects to achieve. The progress of the therapy can be monitored by conventional techniques and assays. The dosage regimen can vary over time.
[0107] In some embodiments, the effective amount of bacteria in the medicament or pharmaceutical composition comprises at least about 10 4 colony forming units (cfu), for example at least about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 or 10 13 cfu, including any ranges between listed values, such as 10 4-10 8 cfu, 10 4 -10 9 cfu, 10 4 -10 10 cfu, 10 4 -10 11 cfu, 10 4 -10 12 cfu, 10 4 -10 12 cfu, 10 5 -10 8 cfu, 10 5 -10 9 cfu, 10 5 -10 10 cfu, 10 5 -10 11 cfu, 10 5 -10 12 cfu, 10 5 -10 12 cfu, 10 6 -10 8 cfu, 10 6 -10 9 cfu, 10 6 -10
[0108] In some embodiments, the volume of an effective dose of the bacterium, medicament, or pharmaceutical composition of the invention is less than or equal to about 3 ml, about 2.5 ml, about 2 ml, about 1.5 ml, about 1 ml, about 0.75 ml, about 0.5 ml, about 0.25 ml, or about 0.1 ml. In some embodiments, the volume of an effective dose of the bacterium, medicament, or pharmaceutical composition is about 20 ml, about 19 ml, about 18 ml, about 17 ml, about 16 ml, about 15 ml, about 14 ml, about 13 ml, about 12 ml, about 11 ml, about 10 ml, about 9 ml, about 8 ml, about 7 ml, about 6 ml, about 5 ml, about 4 ml, about 3 ml, about 2 ml, or about 1 ml. Optionally, the volume of the effective dose of the bacteria, drug or pharmaceutical composition is about 20.5 ml, about 19.5 ml, about 18.5 ml, about 17.5 ml, about 16.5 ml, about 15.5 ml, about 14.5 ml, about 13.5 ml, about 12.5 ml, about 11.5 ml, about 10.5 ml, about 9.5 ml, about 8.5 ml, about 7.5 ml, about 6.5 ml, about 5.5 ml, about 4.5 ml, about 3.5 ml, about 2.5 ml, about 1.5 ml, or about 0.5 ml. In some embodiments, the volume of an effective dose of the bacteria, drug or pharmaceutical composition is about 200 ml, about 190 ml, about 180 ml, about 170 ml, about 160 ml, about 150 ml, about 140 ml, about 130 ml, about 120 ml, about 110 ml, about 100 ml, about 90 ml, about 80 ml, about 70 ml, about 60 ml, about 50 ml, about 40 ml or about 30 ml, as well as ranges between any of the listed values, for example, 100 ml-110 ml, 100 ml-120 ml, 90 ml-120 ml, 90 ml-130 ml, etc. Optionally, the volume of the effective dose of the bacteria, drug or pharmaceutical composition is about 205 ml, about 195 ml, about 185 ml, about 175 ml, about 165 ml, about 155 ml, about 145 ml, about 135 ml, about 125 ml, about 115 ml, about 105 ml, about 95 ml, about 85 ml, about 75 ml, about 65 ml, about 55 ml, about 45 ml, about 35 ml or about 25 ml, and ranges between any of the listed values, such as 105 ml-115 ml, 105 ml-125 ml, 95 ml-125 ml, 95 ml-135 ml, etc.Alternatively, the volume of the effective dose of the bacterium, drug or pharmaceutical composition is about 900 microliters, about 800 microliters, about 700 microliters, about 600 microliters, about 500 microliters, about 400 microliters, about 300 microliters, about 200 microliters or about 100 microliters, alternatively about 950 microliters, about 850 microliters, about 750 microliters, about 650 microliters, about 550 microliters, about 450 microliters, about 350 microliters, about 250 microliters, about 150 microliters or about 50 microliters. In some embodiments, the volume of the effective dose of the bacterium, drug or pharmaceutical composition is less than or equal to about 2.0 ml.
[0109] The concentration of the bacteria of the present invention in, for example, a medicament or pharmaceutical composition may be at least about 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 or 10 13 cfu / ml, including any ranges between the listed values, e.g. 10 3 -10 8 cfu / ml, 10 3 -10 9 cfu / ml, 10 3 -10 10 cfu / ml, 10 3 -10 11 cfu / ml, 10 3 -10 12 cfu / ml, 10 3 -10 13 cfu / ml, 10 4 -10 8 cfu / ml, 10 4 -10 9 cfu / ml, 10 4 -10 10 cfu / ml, 10 4 -10 11 cfu / ml, 10 4 -10 12 cfu / ml, 10 4 -10 13 cfu / ml, 10 5 -10 8 cfu / ml, 10 5 -10 9 cfu / ml, 105 -10 10 cfu / ml, 10 5 -10 11 cfu / ml, 10 5 -10 12 cfu / ml, 10 5 -10 13 cfu / ml, 10 6 -10 8 cfu / ml, 10 6 -10 9 cfu / ml, 10 6 -10 10 cfu / ml, 10 6 -10 11 cfu / ml, 10 6 -10 12 cfu / ml, 10 6 -10 13 cfu / ml, 10 7 -10 8 cfu / ml, 10 7 -10 9 cfu / ml, 10 7 -10 10 cfu / ml, 10 7 -10 11 cfu / ml, 10 7 -10 12 cfu / ml, 10 7 -10 13 cfu / ml, 10 8 -10 9 cfu / ml, 10 8 -10 10 cfu / ml, 10 8 -10 11 cfu / ml, 10 8 -10 12 cfu / ml or 10 8 -10 13 cfu / ml. In, for example, a medicament or pharmaceutical composition, the concentration of the bacteria of the present invention may be at least about 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 or 10 13cfu / g, including ranges between any of the listed values, such as 10 3 -10 8 cfu / g, 10 3 -10 9 cfu / g, 10 3 -10 10 cfu / g, 10 3 -10 11 cfu / g, 10 3 -10 12 cfu / g, 10 3 -10 13 cfu / g, 10 4 -10 8 cfu / g, 10 4 -10 9 cfu / g, 10 4 -10 10 cfu / g, 10 4 -10 11 cfu / g, 10 4 -10 12 cfu / g, 10 4 -10 13 cfu / g, 10 5 -10 8 cfu / g, 10 5 [[ID=%54]]-10 9 cfu / g, 10 5 -10 10 cfu / g, 10 5 -10 11 cfu / g, 10 5 -10 12 cfu / g, 10 5 -10 13 cfu / g, 10 6 -10 8 cfu / g, 10 6 -10 9 cfu / g, 10 6 [[ID=%82]]-10 10 cfu / g, 10 6 -10 11 cfu / g, 10 6 -10 12 cfu / g, 10 6 -10 13 cfu / g, 10 7 -10 8 cfu / g, 10 7 -10 9 cfu / g, 10 7 Note: There seems to be a duplication in line numbers 82 and 54 where it says '-10' in a way that might be unexpected format-wise in the original. Also, the translation is done as per the rules but the original text structure seems a bit repetitive and might need further clarification in its intended meaning.-10 10 cfu / g, 10 7 -10 11 cfu / g, 10 7 -10 12 cfu / g, 10 7 -10 13 cfu / g, 10 8 -10 9 cfu / g, 10 8 -10 10 cfu / g, 10 8 -10 11 cfu / g, 10 8 -10 12 cfu / g or 10 8 -10 13 cfu / g.
[0110] The dosage ranges mentioned herein are merely exemplary and do not limit the dosage ranges that can be selected by a physician. The amount of the active ingredient (e.g., the bacteria of the present invention) in the pharmaceutical compositions of the present invention can vary according to factors such as the individual's disease state, age, sex, and weight, including the presence or absence of a malignancy, the type of malignancy being treated, the severity of the malignancy, the activity or viability of the bacteria, drug, or pharmaceutical composition, the route of administration, the duration of treatment, the drugs used in combination with the bacteria, drug, or pharmaceutical composition (if any), the diet and general health of the subject, and similar factors well known in the art. The dosage regimen can be adjusted to provide the optimal therapeutic response. For example, a single dose can be administered, several divided doses can be administered over time, or the dosage can be proportionally reduced or increased depending on the urgency of the therapeutic situation.
[0111] Bacteria, medicine or pharmaceutical compositions of the present invention can be manufactured by methods well known in the art, such as growing the microorganisms in a fermentation tank, followed by centrifugal concentration and washing, filtering or dialysis, conventional granulation, mixing, dissolving, encapsulating, lyophilizing or emulsifying processes and other methods. Bacteria, medicine or pharmaceutical compositions of the present invention can be produced in various forms, including particles, precipitations or microparticles, powders, including freeze-dried, rotary-dried or spray-dried powders, amorphous powders, injections, emulsions, elixirs, suspensions or solutions. Preparations can optionally contain stabilizers, pH adjusting agents, surfactants, bioavailability regulators and combinations thereof.
[0112] In one embodiment, the bacterium of the present invention, medicine or pharmaceutical composition can be used alone, or in the presence of a carrier with other compounds or composition combination administration. In one embodiment, the bacterium, medicine or pharmaceutical composition can be used in combination with other malignant tumor therapies (including but not limited to, radiotherapy, chemotherapy and surgical operation). The bacterium, medicine or pharmaceutical composition can be used as the adjuvant in therapy in such a case. Therefore, another aspect of the embodiment relates to a kind of bacterium, medicine or pharmaceutical composition, which is used for being used as an adjuvant in a malignant tumor therapy selected from radiotherapy and chemotherapy.
[0113] Example Implementation
[0114] Embodiment 1. A modified bacterium, wherein compared to an unmodified starting strain, the bacterium comprises an inducible lipopolysaccharide (LPS) gene expression cassette, which comprises a gene involved in LPS biosynthesis or transport or a gene encoding a cell wall lipoprotein under the control of an inducible promoter, for example, the LPS gene expression cassette is a hypoxia-regulatable LPS gene expression cassette, which comprises a gene involved in LPS biosynthesis or transport or a gene encoding a cell wall lipoprotein under the control of a first strictly hypoxia-inducible promoter.
[0115] Embodiment 2: The modified bacterium of embodiment 1, wherein the gene involved in LPS biosynthesis is selected from the group consisting of a gene involved in O-antigen synthesis, a gene involved in core region synthesis, and a gene involved in lipid A synthesis.
[0116] Embodiment 3. The modified bacterium of embodiment 2, wherein the gene involved in O-antigen synthesis is selected from the group consisting of rfbN, rfbV, wzzB, gtrBb, gtrBa and rfbP / wbaP genes.
[0117] Embodiment 4. The modified bacterium of embodiment 2, wherein the genes involved in core region synthesis are selected from rfaB, rfaC / waaC, rfaF, rfaG, yibD, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaY, rfaZ, yijP, gmhA, yaeD, rfaE and rfaD genes.
[0118] Embodiment 5. The modified bacterium of embodiment 2, wherein the gene involved in lipid A synthesis is selected from the group consisting of lpxA, lpxB, lpxC, lpxD, lpxH, lpxK, htrB, msbB / lpxM, lpxO, lpxP, yeiU, kdtA, arnT, pagP, yjdB, yhjw, kdsA, kdsB, yrbI, and yrbH genes.
[0119] Embodiment 6. The modified bacterium of embodiment 1, wherein the gene involved in LPS transport is selected from the group consisting of msbA, Wzy, wzxE, lptA, lptB, lptC / yrbK, lptD and lptG genes.
[0120] Embodiment 7, the modified bacteria of any one of embodiments 1-6, wherein the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein is functionally replaced by the inducible promoter, such as the first strict hypoxia-inducible promoter, thereby the expression of the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein in the bacteria is completely controlled by the inducible promoter, such as the first strict hypoxia-inducible promoter.
[0121] Embodiment 8. The modified bacterium of any one of embodiments 1-6, wherein the LPS gene expression cassette is exogenous, and the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein naturally present in the bacterial chromosome is deleted or functionally inactivated, thereby the expression of the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein in the bacterium is completely controlled by the inducible promoter, such as the first strictly hypoxia-inducible promoter.
[0122] Embodiment 9. The modified bacterium of embodiment 8, wherein the exogenous LPS gene expression cassette is integrated into the chromosome of the bacterium.
[0123] Embodiment 10. The modified bacterium of embodiment 8, wherein the exogenous LPS gene expression cassette is located outside the chromosome of the bacterium.
[0124] Embodiment 11. The modified bacterium of embodiment 10, wherein the exogenous LPS gene expression cassette is present in a plasmid carried by the bacterium.
[0125] Embodiment 12. The modified bacterium of any one of embodiments 1-11, wherein the first strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0126] Embodiment 13: The modified bacterium of any one of Embodiments 1-12, wherein the first strictly hypoxia-inducible promoter is the fnrSp promoter.
[0127] Implementation Plan A
[0128] Embodiment A1: The modified bacterium of any one of Embodiments 1-13, wherein the bacterium comprises a hypoxia-regulatable essential gene expression cassette, the essential gene expression cassette comprising an essential gene of the bacterium controlled by a second strict hypoxia-inducible promoter, and the bacterium lacks at least one gene involved in or regulating an endogenous anti-oxidative stress response pathway or a functional expression product thereof.
[0129] Embodiment A2: The modified bacterium of embodiment A1, wherein the second strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0130] Embodiment A3: The modified bacterium of Embodiment A1, wherein the second strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0131] Embodiment A4: The modified bacterium of any one of the preceding embodiments A, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0132] Embodiment A5. The modified bacterium of Embodiment A4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0133] Embodiment A6. The modified bacterium of Embodiment A4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0134] Embodiment A7: The modified bacterium of any one of the preceding Embodiments A, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family gene.
[0135] Embodiment A8: The modified bacterium of any one of the preceding embodiments A, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0136] Embodiment A9: The modified bacterium of any preceding Embodiment A, wherein the bacterium lacks HtrA serine protease activity.
[0137] Embodiment A10: The modified bacterium of any preceding embodiment A, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0138] Embodiment A11. The modified bacterium of any preceding Embodiment A, wherein the bacterium is deficient in htrA.
[0139] Embodiment A12: The modified bacterium of any one of Embodiments A1-A11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the second strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0140] Embodiment A13: The modified bacterium of any one of Embodiments A1-A11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0141] Embodiment A14: The modified bacterium of Embodiment A13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0142] Embodiment A15: The modified bacterium of Embodiment A13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0143] Embodiment A16: The modified bacterium of Embodiment A15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0144] Embodiment A17: The modified bacterium of any one of the preceding Embodiments A, further comprising a pH-regulatable expression cassette comprising a gene encoding a bacterially derived hemolysin protein controlled by a promoter active under acidic pH conditions.
[0145] Embodiment A18: The modified bacterium of Embodiment A17, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0146] Embodiment A19: The modified bacterium of Embodiment A18, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0147] Embodiment A20. The modified bacterium of Embodiment A19, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0148] Embodiment A21: The modified bacterium of any one of Embodiments A17-A20, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5.
[0149] Embodiment A22: The modified bacterium of any one of Embodiments A17-A21, wherein the promoter active under acidic pH conditions is selected from sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0150] Embodiment A23: The modified bacterium of any one of Embodiments A17-A21, wherein the promoter active under acidic pH conditions is sseA.
[0151] Embodiment A24: The modified bacterium of any preceding Embodiment A, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0152] Embodiment A25: The modified bacterium of any preceding Embodiment A, wherein the bacterium is an Enterobacteriaceae bacterium.
[0153] Embodiment A26: The modified bacterium of any of the preceding embodiments A, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0154] Embodiment A27: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is selected from Escherichia coli, E. blattae, E. fergusonii, E. hermannii, E. vulneris, S. enterica, S. bongori, S. typhi, S. choleraesuis, S. typhimurium, S. dysenteriae, S. flexneri, S. botulinum, S. Shigella boydii, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia aldouae, Yersinia bercovi, Yersinia frederiksenii, Yersinia intermedia, Yersinia kristensii ), Yersinia mollaretti, Yersinia rohdei, Yersinia ruckeri, Citrobacter freundii, Citrobacter kaseri, Citrobacter braakii, E. aerogenes, E. cloacae, E. gergoviac, E. sakazakii, E. tavlorac, E. aminigenus, E. intermedius , E. asburiac, E. cancerogenus, E. dissolvens, E. nimipressualis, S. marcescens, S. entomophila, S. ficaria, S. fonticola, S. grimesii, S. liquefaciens, S. odorifera, S. plymuthica, S. longyan spot (S.proteamaculans), Serratia rubidaea, Serratia ureilytica, P. mirabilis, P. vulgaris, P. myxofaciens, P. penneri, P. hauseri, M. morganii, P. alcalifaciens, P. rustigianii, P. stuartii, P. rettgeri, P. heimbochae, H. alvei, and P. agglomerans.
[0155] Embodiment A28. The modified bacterium of any preceding Embodiment A, wherein the bacterium is Salmonella typhimurium.
[0156] Embodiment A29. The modified bacterium of Embodiment A28, wherein the starting strain is Salmonella typhimurium SL7207.
[0157] Embodiment A30. The modified bacterium of any preceding Embodiment A, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).
[0158] Embodiment A31: The modified bacterium of any preceding Embodiment A, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0159] Embodiment A32. The modified bacterium of any preceding Embodiment A, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0160] Embodiment A33: The modified bacterium of any preceding Embodiment A, wherein said bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0161] Embodiment A34. The modified bacterium of any preceding Embodiment A, wherein said bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0162] Embodiment A35: The modified bacterium of any preceding Embodiment A, which does not express wild-type flagellin.
[0163] Embodiment A36: The modified bacterium of any one of the preceding Embodiments A, which lacks the fliC gene.
[0164] Embodiment A37. The modified bacterium of any preceding Embodiment A, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0165] Embodiment A38. The modified bacterium of any one of Embodiments A1-A36, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0166] Embodiment A39. The modified bacterium of any one of Embodiments A1-A36, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0167] Implementation Plan B
[0168] Embodiment B1: The modified bacterium of any one of Embodiments 1-13, wherein the bacterium further comprises a hypoxia-regulatable essential gene expression cassette and a pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a second strict hypoxia-inducible promoter, and the pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, and the bacterium lacks at least one gene involved in or regulating an endogenous antioxidant stress response pathway or a functional expression product thereof.
[0169] Embodiment B2: The modified bacterium of Embodiment B1, wherein the second strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0170] Embodiment B3: The modified bacterium of Embodiment B1, wherein the second strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0171] Embodiment B4: The modified bacterium of any one of the preceding embodiments B, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0172] Embodiment B5. The modified bacterium of Embodiment B4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0173] Embodiment B6. The modified bacterium of Embodiment B4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0174] Embodiment B7: The modified bacterium of any preceding Embodiment B, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family gene.
[0175] Embodiment B8: The modified bacterium of any one of the preceding embodiments B, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0176] Embodiment B9: The modified bacterium of any preceding Embodiment B, wherein the bacterium lacks HtrA serine protease activity.
[0177] Embodiment B10: The modified bacterium of any preceding Embodiment B, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0178] Embodiment B11. The modified bacterium of any preceding Embodiment B, wherein the bacterium is deficient in htrA.
[0179] Embodiment B12: The modified bacterium of any one of Embodiments B1 to B11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the second strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0180] Embodiment B13: The modified bacterium of any one of Embodiments B1-B11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0181] Embodiment B14: The modified bacterium of Embodiment B13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0182] Embodiment B15. The modified bacterium of Embodiment B13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0183] Embodiment B16. The modified bacterium of Embodiment B15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0184] Embodiment B17: The modified bacterium of any preceding Embodiment B, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0185] Embodiment B18: The modified bacterium of Embodiment B17, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0186] Embodiment B19. The modified bacterium of Embodiment B18, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0187] Embodiment B20. The modified bacterium of any preceding embodiment B, wherein the promoter active under acidic pH conditions is active at a pH of less than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.
[0188] Embodiment B21. The modified bacterium of any preceding Embodiment B, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0189] Embodiment B22. The modified bacterium of any preceding Embodiment B, wherein the promoter active under acidic pH conditions is sseA.
[0190] Embodiment B23. The modified bacterium of any preceding Embodiment B, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0191] Embodiment B24. The modified bacterium of any preceding Embodiment B, wherein the bacterium is an Enterobacteriaceae.
[0192] Embodiment B25: The modified bacterium of any of the preceding Embodiments B, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0193] Embodiment B26: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is selected from Escherichia coli, Escherichia roach, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella boutei, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia ostreatus, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia korsei, Yersinia moorei, Yersinia rosenbergii, Yersinia ruckeri, Citrobacter freundii, Citrobacter kozei, Citrobacter braque, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter japonici, Enterobacter sakazakii, Enterobacter tyrosine, Enterobacter rivulosa, Enterobacter intermedia, Enterobacter afseri, Enterobacter spp. Enterobacter carcinoma, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figis, Serratia izumi, Serratia grazie, Serratia liquefaciens, Serratia aromatica, Serratia puchengensis, Serratia longyanmao, Serratia crimson, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus pannei, Proteus houe, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei and Pantoea agglomerans.
[0194] Embodiment B27. The modified bacterium of any preceding Embodiment B, wherein the bacterium is Salmonella typhimurium.
[0195] Embodiment B28. The modified bacterium of Embodiment B27, wherein the starting strain is Salmonella typhimurium SL7207.
[0196] Embodiment B29. The modified bacterium of any preceding Embodiment B, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).
[0197] Embodiment B30: The modified bacterium of any preceding Embodiment B, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0198] Embodiment B31. The modified bacterium of any preceding Embodiment B, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0199] Embodiment B32. The modified bacterium of any preceding Embodiment B, wherein said bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0200] Embodiment B33. The modified bacterium of any preceding Embodiment B, wherein said bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0201] Embodiment B34: The modified bacterium of any preceding Embodiment B, which does not express wild-type flagellin.
[0202] Embodiment B35: The modified bacterium of any preceding Embodiment B, which lacks the fliC gene.
[0203] Embodiment B36. The modified bacterium of any preceding Embodiment B, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0204] Embodiment B37. The modified bacterium of any one of Embodiments B1-B35, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0205] Embodiment B38. The modified bacterium of any one of Embodiments B1-B35, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0206] Implementation Plan C
[0207] Embodiment C1: The modified bacterium of any one of Embodiments 1-13, which is Salmonella typhimurium, wherein the bacterium further comprises a hypoxia-regulatable essential gene expression cassette and a pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a second strict hypoxia-inducible promoter, and the pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, and the bacterium lacks at least one gene involved in or regulating an endogenous antioxidant stress response pathway or a functional expression product thereof.
[0208] Embodiment C2: The modified bacterium of Embodiment C1, wherein the second strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0209] Embodiment C3: The modified bacterium of Embodiment C1, wherein the second strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0210] Embodiment C4: The modified bacterium of any one of the preceding embodiments C, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0211] Embodiment C5. The modified bacterium of Embodiment C4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0212] Embodiment C6. The modified bacterium of Embodiment C4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0213] Embodiment C7: The modified bacterium of any one of the preceding Embodiments C, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family gene.
[0214] Embodiment C8: The modified bacterium of any one of the preceding embodiments C, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0215] Embodiment C9: The modified bacterium of any preceding Embodiment C, wherein the bacterium lacks HtrA serine protease activity.
[0216] Embodiment C10: The modified bacterium of any preceding Embodiment C, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0217] Embodiment C11. The modified bacterium of any preceding Embodiment C, wherein the bacterium is deficient in htrA.
[0218] Embodiment C12: The modified bacterium of any one of Embodiments C1 to C11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the second strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0219] Embodiment C13: The modified bacterium of any one of Embodiments C1-C11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0220] Embodiment C14: The modified bacterium of Embodiment C13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0221] Embodiment C15: The modified bacterium of Embodiment C13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0222] Embodiment C16: The modified bacterium of Embodiment C15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0223] Embodiment C17: The modified bacterium of any one of the preceding Embodiments C, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0224] Embodiment C18: The modified bacterium of Embodiment C17, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0225] Embodiment C19: The modified bacterium of Embodiment C18, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0226] Embodiment C20: The modified bacterium of any one of the preceding embodiments C, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5.
[0227] Embodiment C21. The modified bacterium of any preceding Embodiment C, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0228] Embodiment C22: The modified bacterium of any preceding Embodiment C, wherein the promoter active under acidic pH conditions is sseA.
[0229] Embodiment C23. The modified bacterium of any preceding Embodiment C, wherein the unmodified starting strain is a facultative anaerobic Salmonella typhimurium.
[0230] Embodiment C24: The modified bacterium of any one of the preceding Embodiments C, wherein the starting strain is Salmonella typhimurium SL7207.
[0231] Embodiment C25. The modified bacterium of any one of Embodiments C1-C24, wherein said bacterium expresses wild-type lipopolysaccharide (LPS).
[0232] Embodiment C26: The modified bacterium of any preceding Embodiment C, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0233] Embodiment C27. The modified bacterium of any preceding Embodiment C, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0234] Embodiment C28: The modified bacterium of any preceding Embodiment C, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0235] Embodiment C29: The modified bacterium of any preceding Embodiment C, wherein said bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0236] Embodiment C30: The modified bacterium of any preceding Embodiment C, which does not express wild-type flagellin.
[0237] Embodiment C31: The modified bacterium of any one of the preceding Embodiments C, which lacks the fliC gene.
[0238] Embodiment C32: The modified bacterium of any preceding Embodiment C, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0239] Embodiment C33: The modified bacterium of any one of Embodiments C1-C31, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0240] Embodiment C34: The modified bacterium of any one of Embodiments C1-C31, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0241] Implementation Plan D
[0242] Embodiment D1: The modified bacterium of any one of Embodiments 1-13, wherein the bacterium comprises a hypoxia-regulatable essential gene expression cassette compared to the unmodified starting strain, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a second stringent hypoxia-inducible promoter, and the bacterium lacks at least one gene required for survival in macrophages or its functional expression product.
[0243] Embodiment D2: The modified bacterium of embodiment D1, wherein the second strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0244] Embodiment D3: The modified bacterium of Embodiment D1, wherein the second strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0245] Embodiment D4: The modified bacterium of any one of the preceding embodiments D, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0246] Embodiment D5. The modified bacterium of Embodiment D4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0247] Embodiment D6. The modified bacterium of Embodiment D4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0248] Embodiment D7: The modified bacterium of any one of the preceding Embodiments D, wherein the gene required for survival in macrophages is the STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.
[0249] Embodiment D8: The modified bacterium of any one of the preceding Embodiments D, wherein the functional expression product of the gene required for survival in macrophages is an HtrA serine protease family-related protein.
[0250] Embodiment D9: The modified bacterium of any preceding Embodiment D, wherein the bacterium lacks HtrA serine protease activity.
[0251] Embodiment D10: The modified bacterium of any preceding Embodiment D, wherein the gene required for survival in macrophages is htrA.
[0252] Embodiment D11: The modified bacterium of any preceding Embodiment D, wherein the bacterium is deficient in htrA.
[0253] Embodiment D12: The modified bacterium of any one of Embodiments D1-D11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the second strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0254] Embodiment D13: The modified bacterium of any one of Embodiments D1-D11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0255] Embodiment D14: The modified bacterium of Embodiment D13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0256] Embodiment D15: The modified bacterium of Embodiment D13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0257] Embodiment D16: The modified bacterium of Embodiment D15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0258] Embodiment D17: The modified bacterium of any one of the preceding Embodiments D, further comprising a pH-regulatable expression cassette comprising a gene encoding a bacterially derived hemolysin protein controlled by a promoter active under acidic pH conditions.
[0259] Embodiment D18: The modified bacterium of Embodiment D17, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0260] Embodiment D19: The modified bacterium of Embodiment D18, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0261] Embodiment D20: The modified bacterium of Embodiment D19, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0262] Embodiment D21: The modified bacterium of any one of Embodiments D17-D20, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5.
[0263] Embodiment D22: The modified bacterium of any one of Embodiments D17-D21, wherein the promoter active under acidic pH conditions is selected from sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0264] Embodiment D23: The modified bacterium of any one of Embodiments D17-D21, wherein the promoter active under acidic pH conditions is sseA.
[0265] Embodiment D24: The modified bacterium of any preceding Embodiment D, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0266] Embodiment D25: The modified bacterium of any one of the preceding Embodiments D, wherein the bacterium is an Enterobacteriaceae bacterium.
[0267] Embodiment D26: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0268] Embodiment D27: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium is selected from Escherichia coli, Escherichia roach, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella bodega, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia auverii, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia kurzewi, Yersinia moorei, Yersinia rosea, Yersinia ruckeri, Citrobacter freundii, Citrobacter kozei, and Boula Citrobacter glumene, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter japonici, Enterobacter sakazakii, Enterobacter tylosus, Enterobacter rivulosa, Enterobacter intermedia, Enterobacter agglomerans, Enterobacter carcinogenes, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figi, Serratia izumi, Serratia glumae, Serratia liquefaciens, Serratia aromatica, Serratia puchengensis, Serratia longyanmao, Serratia rubrum, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus pannei, Proteus housiei, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei and Pantoea agglomerans.
[0269] Embodiment D28: The modified bacterium of any preceding Embodiment D, wherein the bacterium is Salmonella typhimurium.
[0270] Embodiment D29: The modified bacterium of Embodiment D28, wherein the starting strain is Salmonella typhimurium SL7207.
[0271] Embodiment D30: The modified bacterium of any preceding Embodiment D, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).
[0272] Embodiment D31: The modified bacterium of any one of the preceding Embodiments D, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0273] Embodiment D32: The modified bacterium of any preceding Embodiment D, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0274] Embodiment D33: The modified bacterium of any preceding Embodiment D, wherein said bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0275] Embodiment D34: The modified bacterium of any preceding Embodiment D, wherein said bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0276] Embodiment D35: The modified bacterium of any preceding Embodiment D, which does not express wild-type flagellin.
[0277] Embodiment D36: The modified bacterium of any one of the preceding Embodiments D, which lacks the fliC gene.
[0278] Embodiment D37: The modified bacterium of any one of the preceding Embodiments D, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0279] Embodiment D38: The modified bacterium of any one of Embodiments D1-D36, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0280] Embodiment D39: The modified bacterium of any one of Embodiments D1-D36, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0281] Implementation Plan E
[0282] Embodiment E1: The modified bacterium of any one of Embodiments 1-13, wherein compared to the unmodified starting strain, the bacterium comprises a hypoxia-regulatable essential gene expression cassette and a pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a second strict hypoxia-inducible promoter, and the pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, wherein the bacterium expresses wild-type lipopolysaccharide (LPS), and the bacterium lacks at least one gene required for survival in macrophages or its functional expression product.
[0283] Embodiment E2: The modified bacterium of Embodiment El, wherein the second strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0284] Embodiment E3: The modified bacterium of Embodiment El, wherein the second strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0285] Embodiment E4: The modified bacterium of any one of the preceding embodiments E, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0286] Embodiment E5. The modified bacterium of Embodiment E4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0287] Embodiment E6. The modified bacterium of Embodiment E4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0288] Embodiment E7: The modified bacterium of any preceding Embodiment E, wherein the gene required for survival in macrophages is the STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.
[0289] Embodiment E8: The modified bacterium of any preceding embodiment E, wherein the functional expression product of the gene required for survival in macrophages is an HtrA serine protease family-related protein.
[0290] Embodiment E9: The modified bacterium of any preceding Embodiment E, wherein the bacterium lacks HtrA serine protease activity.
[0291] Embodiment E10: The modified bacterium of any preceding Embodiment E, wherein the gene required for survival in macrophages is htrA.
[0292] Embodiment E11: The modified bacterium of any preceding Embodiment E, wherein the bacterium is deficient in htrA.
[0293] Embodiment E12: The modified bacterium of any one of Embodiments E1 to E11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the second strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0294] Embodiment E13: The modified bacterium of any one of Embodiments E1-E11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0295] Embodiment E14: The modified bacterium of Embodiment E13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0296] Embodiment E15: The modified bacterium of Embodiment E13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0297] Embodiment E16: The modified bacterium of Embodiment E15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0298] Embodiment E17: The modified bacterium of any one of the preceding Embodiments E, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0299] Embodiment E18: The modified bacterium of Embodiment E17, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0300] Embodiment E19: The modified bacterium of Embodiment E18, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0301] Embodiment E20: The modified bacterium of any preceding embodiment E, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5.
[0302] Embodiment E21. The modified bacterium of any preceding Embodiment E, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0303] Embodiment E22. The modified bacterium of any preceding Embodiment E, wherein the promoter active under acidic pH conditions is sseA.
[0304] Embodiment E23: The modified bacterium of any preceding Embodiment E, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0305] Embodiment E24: The modified bacterium of any preceding Embodiment E, wherein the bacterium is an Enterobacteriaceae bacterium.
[0306] Embodiment E25: The modified bacterium of any one of the preceding Embodiments E, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0307] Embodiment E26: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium is selected from the group consisting of Escherichia coli, Escherichia roach, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella bodega, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia auverii, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia kurzewi, Yersinia moorei, Yersinia rosea, Yersinia ruckeri, Citrobacter freudii, Citrobacter kozei, and B. Citrobacter glumene, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter japonici, Enterobacter sakazakii, Enterobacter tylosus, Enterobacter rivulosa, Enterobacter intermedia, Enterobacter agglomerans, Enterobacter carcinogenes, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figi, Serratia izumi, Serratia glumae, Serratia liquefaciens, Serratia aromatica, Serratia puchengensis, Serratia longyanmao, Serratia rubrum, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus pannei, Proteus housiei, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei and Pantoea agglomerans.
[0308] Embodiment E27. The modified bacterium of any preceding Embodiment E, wherein the bacterium is Salmonella typhimurium.
[0309] Embodiment E28. The modified bacterium of Embodiment E27, wherein the starting strain is Salmonella typhimurium SL7207.
[0310] Embodiment E29: The modified bacterium of any preceding Embodiment E, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0311] Embodiment E30: The modified bacterium of any preceding Embodiment E, wherein said bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0312] Embodiment E31 : The modified bacterium of any preceding Embodiment E, wherein said bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0313] Embodiment E32: The modified bacterium of any preceding Embodiment E, wherein said bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0314] Embodiment E33: The modified bacterium of any preceding Embodiment E, which does not express wild-type flagellin.
[0315] Embodiment E34: The modified bacterium of any preceding Embodiment E, which lacks the fliC gene.
[0316] Embodiment E35. The modified bacterium of any preceding Embodiment E, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0317] Embodiment E36. The modified bacterium of any one of Embodiments E1-E34, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0318] Embodiment E37. The modified bacterium of any one of Embodiments E1-E34, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0319] Implementation Plan F
[0320] Embodiment F1: The modified bacterium of any one of Embodiments 1-13, which is Salmonella typhimurium, wherein compared to the unmodified starting strain, the bacterium comprises a hypoxia-regulatable essential gene expression cassette and a pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a second strict hypoxia-inducible promoter, and the pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, wherein the bacterium expresses wild-type lipopolysaccharide (LPS), and the bacterium lacks at least one gene required for survival in macrophages or its functional expression product.
[0321] Embodiment F2: The modified bacterium of Embodiment F1, wherein the second strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0322] Embodiment F3. The modified bacterium of Embodiment F1, wherein the second strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0323] Embodiment F4: The modified bacterium of any one of the preceding embodiments F, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or an analog thereof to the culture medium.
[0324] Embodiment F5. The modified bacterium of Embodiment F4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0325] Embodiment F6. The modified bacterium of Embodiment F4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0326] Embodiment F7: The modified bacterium of any preceding Embodiment F, wherein the gene required for survival in macrophages is the STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.
[0327] Embodiment F8: The modified bacterium of any preceding Embodiment F, wherein the gene required for survival in macrophages is a gene involved in or regulating an endogenous anti-oxidative stress response pathway.
[0328] Embodiment F9: The modified bacterium of Embodiment F8, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family gene.
[0329] Embodiment F10: The modified bacterium of embodiment F9, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0330] Embodiment F11. The modified bacterium of Embodiment F9, wherein said bacterium lacks HtrA serine protease activity.
[0331] Embodiment F12: The modified bacterium of Embodiment F9, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0332] Embodiment F13. The modified bacterium of Embodiment F9, wherein said bacterium is deficient in htrA.
[0333] Embodiment F14: The modified bacterium of any one of Embodiments F1 to F13, wherein the essential gene is a gene naturally present in the chromosome of the bacterium, wherein the natural promoter of the essential gene is functionally replaced by the second strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
[0334] Embodiment F15: The modified bacterium of any one of Embodiments F1-F13, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is fully controlled by the second strict hypoxia-inducible promoter.
[0335] Embodiment F16: The modified bacterium of Embodiment F15, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0336] Embodiment F17. The modified bacterium of Embodiment F15, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0337] Embodiment F18. The modified bacterium of Embodiment F17, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0338] Embodiment F19: The modified bacterium of any preceding Embodiment F, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0339] Embodiment F20: The modified bacterium of Embodiment F19, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0340] Embodiment F21. The modified bacterium of Embodiment F20, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0341] Embodiment F22. The modified bacterium of any preceding embodiment F, wherein the promoter active under acidic pH conditions is active at a pH of less than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.
[0342] Embodiment F23. The modified bacterium of any preceding Embodiment F, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0343] Embodiment F24. The modified bacterium of any preceding Embodiment F, wherein the promoter active under acidic pH conditions is sseA.
[0344] Embodiment F25. The modified bacterium of any preceding Embodiment F, wherein the starting strain is Salmonella typhimurium SL7207.
[0345] Embodiment F26: The modified bacterium of any preceding Embodiment F, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0346] Embodiment F27. The modified bacterium of any preceding Embodiment F, wherein said bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0347] Embodiment F28: The modified bacterium of any preceding Embodiment F, wherein said bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0348] Embodiment F29: The modified bacterium of any preceding Embodiment F, wherein said bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0349] Embodiment F30: The modified bacterium of any preceding Embodiment F, which does not express wild-type flagellin.
[0350] Embodiment F31: The modified bacterium of any preceding Embodiment F, which lacks the fliC gene.
[0351] Embodiment F32: The modified bacterium of any preceding Embodiment F, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0352] Embodiment F33: The modified bacterium of any one of Embodiments F1-F31, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0353] Embodiment F34: The modified bacterium of any one of Embodiments F1-F31, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0354] Implementation Plan AA
[0355] Embodiment AA1: A modified bacterium, wherein compared to an unmodified starting strain, the bacterium comprises a hypoxia-regulatable essential gene expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter, the bacterium lacks at least one non-essential gene involved in LPS biosynthesis or transport and / or a gene encoding a cell wall lipoprotein or its expression product, and the bacterium lacks at least one gene involved in or regulating an endogenous antioxidant stress response pathway or its functional expression product, wherein the deleted gene involved in LPS biosynthesis or transport is a non-essential gene.
[0356] Embodiment AA2: The modified bacterium of embodiment AA1, wherein the gene involved in LPS biosynthesis is selected from the group consisting of a gene involved in O-antigen synthesis, a gene involved in core region synthesis, and a gene involved in lipid A synthesis.
[0357] Embodiment AA3: The modified bacterium of embodiment AA2, wherein the gene involved in O-antigen synthesis is selected from the group consisting of wzzB, gtrBb, gtrBa and rfbP / wbaP genes, the gene involved in core region synthesis is selected from the group consisting of rfaB, yibD, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaZ, yijP, gmhA, yaeD, rfaE and rfaD genes, and the gene involved in lipid A synthesis is selected from the group consisting of lpxA, lpxC, lpxD, lpxH, msbB / lpxM, lpxO, lpxP, arnT, yjdB, kdsB, yrbI and yrbH genes.
[0358] Embodiment AA4: The modified bacterium of embodiment AA1, wherein the gene involved in LPS transport is selected from the group consisting of msbA, Wzy, lptA, lptB and lptG genes.
[0359] Embodiment AA5: The modified bacterium of embodiment AA1, wherein the bacterium does not express wild-type lipopolysaccharide (LPS). In one embodiment, the bacterium does not express LPS or expresses a mutated or structurally incomplete LPS.
[0360] Embodiment AA6: The modified bacterium of any one of the preceding embodiments AA, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0361] Embodiment AA7: The modified bacterium of any preceding Embodiment AA, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0362] Embodiment AA8: The modified bacterium of any of the preceding embodiments AA, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0363] Embodiment AA9. The modified bacterium of Embodiment AA8, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0364] Embodiment AA10. The modified bacterium of Embodiment AA8, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0365] Embodiment AA11: The modified bacterium of any of the preceding Embodiments AA, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is an HtrA serine protease family gene.
[0366] Embodiment AA12: The modified bacterium of any of the preceding embodiments AA, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0367] Embodiment AA13. The modified bacterium of any preceding Embodiment AA, wherein the bacterium lacks HtrA serine protease activity.
[0368] Embodiment AA14: The modified bacterium of any preceding Embodiment AA, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0369] Embodiment AA15. The modified bacterium of any preceding Embodiment AA, wherein the bacterium is deficient in htrA.
[0370] Embodiment AA16: The modified bacterium of any one of Embodiments AA1-AA15, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0371] Embodiment AA17: The modified bacterium of any one of Embodiments AA1-AA15, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0372] Embodiment AA18: The modified bacterium of Embodiment AA17, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0373] Embodiment AA19. The modified bacterium of Embodiment AA17, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0374] Embodiment AA20. The modified bacterium of Embodiment AA19, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0375] Embodiment AA21: The modified bacterium of any of the preceding Embodiments AA, further comprising a pH-regulatable expression cassette comprising a gene encoding a bacterially derived hemolysin protein under the control of a promoter active under acidic pH conditions.
[0376] Embodiment AA22: The modified bacterium of Embodiment AA21, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0377] Embodiment AA23: The modified bacterium of Embodiment AA22, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0378] Embodiment AA24. The modified bacterium of Embodiment AA23, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0379] Embodiment AA25: The modified bacterium of any one of Embodiments AA21-AA24, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5.
[0380] Embodiment AA26: The modified bacterium of any one of Embodiments AA21-AA25, wherein the promoter active under acidic pH conditions is selected from sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0381] Embodiment AA27: The modified bacterium of any one of Embodiments AA21-AA25, wherein the promoter active under acidic pH conditions is sseA.
[0382] Embodiment AA28. The modified bacterium of any preceding Embodiment AA, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0383] Embodiment AA29. The modified bacterium of any preceding Embodiment AA, wherein the bacterium is an Enterobacteriaceae.
[0384] Embodiment AA30: The modified bacterium of any of the preceding embodiments AA, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0385] Embodiment AA31: The modified bacterium of any of the preceding embodiments AA, wherein the bacterium is selected from the group consisting of Escherichia coli, Escherichia roach, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella bodega, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia auverii, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia kurzewi, Yersinia moorei, Yersinia rosea, Yersinia ruckeri, Citrobacter freundii, Citrobacter kozei, and B. Citrobacter lakke, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter japonicus, Enterobacter sakazakii, Enterobacter tylosus, Enterobacter rivulosa, Enterobacter intermedia, Enterobacter agglomerans, Enterobacter carcinogenes, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figi, Serratia izumi, Serratia gassini, Serratia liquefaciens, Serratia aromatica, Serratia plymouthsiella, Serratia longyanmao, Serratia crimson, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus pannei, Proteus housiei, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei, and Pantoea agglomerans.
[0386] Embodiment AA32. The modified bacterium of any preceding Embodiment AA, wherein the bacterium is Salmonella typhimurium.
[0387] Embodiment AA33. The modified bacterium of Embodiment AA32, wherein the starting strain is Salmonella typhimurium SL7207.
[0388] Embodiment AA34: The modified bacterium of any of the preceding Embodiments AA, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0389] Embodiment AA35. The modified bacterium of any of the preceding Embodiments AA, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0390] Embodiment AA36: The modified bacterium of any of the preceding Embodiments AA, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0391] Embodiment AA37. The modified bacterium of any of the preceding Embodiments AA, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0392] Embodiment AA38: The modified bacterium of any preceding Embodiment AA, which does not express wild-type flagellin.
[0393] Embodiment AA39: The modified bacterium of any preceding Embodiment AA, which lacks the fliC gene.
[0394] Embodiment AA40: The modified bacterium of any of the preceding Embodiments AA, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0395] Embodiment AA41. The modified bacterium of any one of Embodiments AA1-AA39, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0396] Embodiment AA42. The modified bacterium of any one of Embodiments AA1-AA39, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0397] Implementation Plan BB
[0398] Embodiment BB1: A modified bacterium, wherein compared with an unmodified starting strain, the bacterium comprises a hypoxia-regulatable essential gene expression cassette and a pH-regulatable expression cassette, the essential gene expression cassette comprises the essential gene of the bacterium controlled by a strictly hypoxia-inducible promoter, the pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions, the bacterium lacks at least one non-essential gene involved in LPS biosynthesis or transport and / or a gene encoding a cell wall lipoprotein or its expression product, and the bacterium lacks at least one gene involved in or regulating an endogenous antioxidant stress response pathway or its functional expression product.
[0399] Embodiment BB2: The modified bacterium of embodiment BB1, wherein the gene involved in LPS biosynthesis is selected from the group consisting of a gene involved in O-antigen synthesis, a gene involved in core region synthesis, and a gene involved in lipid A synthesis.
[0400] Embodiment BB3: The modified bacterium of embodiment BB2, wherein the gene involved in O-antigen synthesis is selected from the group consisting of wzzB, gtrBb, gtrBa and rfbP / wbaP genes, the gene involved in core region synthesis is selected from the group consisting of rfaB, yibD, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaZ, yijP, gmhA, yaeD, rfaE and rfaD genes, and the gene involved in lipid A synthesis is selected from the group consisting of lpxA, lpxC, lpxD, lpxH, msbB / lpxM, lpxO, lpxP, arnT, yjdB, kdsB, yrbI and yrbH genes.
[0401] Embodiment BB4: The modified bacterium of Embodiment BB1, wherein the gene involved in LPS transport is selected from the group consisting of msbA, Wzy, lptA, lptB and lptG genes.
[0402] Embodiment BB5: The modified bacterium of embodiment BB1, wherein the bacterium does not express wild-type lipopolysaccharide (LPS). In one embodiment, the bacterium does not express LPS or expresses a mutated or structurally incomplete LPS.
[0403] Embodiment BB6: The modified bacterium of any preceding Embodiment BB, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0404] Embodiment BB7: The modified bacterium of any preceding Embodiment BB, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0405] Embodiment BB8: The modified bacterium of any of the preceding embodiments BB, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0406] Embodiment BB9: The modified bacterium of Embodiment BB8, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0407] Embodiment BB10. The modified bacterium of Embodiment BB8, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0408] Embodiment BB11: The modified bacterium of any preceding Embodiment BB, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family gene.
[0409] Embodiment BB12: The modified bacterium of any one of the preceding Embodiments BB, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0410] Embodiment BB13. The modified bacterium of any preceding Embodiment BB, wherein the bacterium lacks HtrA serine protease activity.
[0411] Embodiment BB14: The modified bacterium of any preceding Embodiment BB, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0412] Embodiment BB15. The modified bacterium of any preceding Embodiment BB, wherein the bacterium is deficient in htrA.
[0413] Embodiment BB16: The modified bacterium of any one of Embodiments BB1-BB15, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0414] Embodiment BB17: The modified bacterium of any one of Embodiments BB1-BB15, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0415] Embodiment BB18: The modified bacterium of Embodiment BB13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0416] Embodiment BB19: The modified bacterium of Embodiment BB13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0417] Embodiment BB20: The modified bacterium of Embodiment BB15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0418] Embodiment BB21: The modified bacterium of any preceding Embodiment BB, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0419] Embodiment BB22: The modified bacterium of Embodiment BB21, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0420] Embodiment BB23: The modified bacterium of Embodiment BB22, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0421] Embodiment BB24: The modified bacterium of any preceding embodiment BB, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5.
[0422] Embodiment BB25. The modified bacterium of any preceding Embodiment BB, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0423] Embodiment BB26. The modified bacterium of any preceding Embodiment BB, wherein the promoter active under acidic pH conditions is sseA.
[0424] Embodiment BB27: The modified bacterium of any preceding Embodiment BB, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0425] Embodiment BB28. The modified bacterium of any preceding Embodiment BB, wherein the bacterium is an Enterobacteriaceae.
[0426] Embodiment BB29: The modified bacterium of any of the preceding Embodiments BB, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0427] Embodiment BB30: The modified bacterium of any of the preceding embodiments AA, wherein the bacterium is selected from the group consisting of Escherichia coli, Escherichia roach, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella bodni, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia auverii, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia kurzewi, Yersinia moorei, Yersinia rosea, Yersinia ruckeri, Citrobacter freundii, Citrobacter kozei, and B. Citrobacter lakke, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter japonicus, Enterobacter sakazakii, Enterobacter tylosus, Enterobacter rivulosa, Enterobacter intermedia, Enterobacter agglomerans, Enterobacter carcinogenes, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figi, Serratia izumi, Serratia gassini, Serratia liquefaciens, Serratia aromatica, Serratia plymouthsiella, Serratia longyanmao, Serratia crimson, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus pannei, Proteus housiei, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei, and Pantoea agglomerans.
[0428] Embodiment BB31 . The modified bacterium of any preceding Embodiment BB, wherein the bacterium is Salmonella typhimurium.
[0429] Embodiment BB32. The modified bacterium of Embodiment BB31, wherein the starting strain is Salmonella typhimurium SL7207.
[0430] Embodiment BB33: The modified bacterium of any of the preceding Embodiments BB, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0431] Embodiment BB34: The modified bacterium of any preceding Embodiment BB, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0432] Embodiment BB35: The modified bacterium of any preceding Embodiment BB, wherein said bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0433] Embodiment BB36: The modified bacterium of any preceding Embodiment BB, wherein said bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0434] Embodiment BB37: The modified bacterium of any preceding Embodiment BB, which does not express wild-type flagellin.
[0435] Embodiment BB38: The modified bacterium of any preceding Embodiment BB, which lacks the fliC gene.
[0436] Embodiment BB39: The modified bacterium of any preceding Embodiment BB, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0437] Embodiment BB40: The modified bacterium of any one of Embodiments BB1-BB38, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0438] Embodiment BB41. The modified bacterium of any one of Embodiments BB1-BB38, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0439] Implementation Plan CC
[0440] Embodiment CC1: A modified Salmonella typhimurium bacterium, wherein compared to an unmodified starting strain, the bacterium comprises a hypoxia-regulatable essential gene expression cassette and a pH-regulatable expression cassette, the essential gene expression cassette comprising an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter, the pH-regulatable expression cassette comprising a gene encoding a bacterial-derived hemolysin protein under the control of a promoter active under acidic pH conditions, the bacterium lacks at least one non-essential gene involved in LPS biosynthesis or transport and / or a gene encoding a cell wall lipoprotein or its expression product, and the bacterium lacks at least one gene involved in or regulating an endogenous antioxidant stress response pathway or its functional expression product.
[0441] Embodiment CC2: The modified bacterium of embodiment CC1, wherein the gene involved in LPS biosynthesis is selected from the group consisting of a gene involved in O-antigen synthesis, a gene involved in core region synthesis, and a gene involved in lipid A synthesis.
[0442] Embodiment CC3: The modified bacterium of embodiment CC2, wherein the gene involved in O-antigen synthesis is selected from the group consisting of wzzB, gtrBb, gtrBa and rfbP / wbaP genes, the gene involved in core region synthesis is selected from the group consisting of rfaB, yibD, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaZ, yijP, gmhA, yaeD, rfaE and rfaD genes, and the gene involved in lipid A synthesis is selected from the group consisting of lpxA, lpxC, lpxD, lpxH, msbB / lpxM, lpxO, lpxP, arnT, yjdB, kdsB, yrbI and yrbH genes.
[0443] Embodiment CC4: The modified bacterium of embodiment CC1, wherein the gene involved in LPS transport is selected from the group consisting of msbA, Wzy, lptA, lptB and lptG genes.
[0444] Embodiment CC5: The modified bacterium of embodiment CC1, wherein the bacterium does not express wild-type lipopolysaccharide (LPS). In one embodiment, the bacterium does not express LPS or expresses a mutated or structurally incomplete LPS.
[0445] Embodiment CC6: The modified bacterium of any one of the preceding embodiments CC, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0446] Embodiment CC7: The modified bacterium of Embodiment CC1 of any one of the preceding Embodiments CC, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0447] Embodiment CC8: The modified bacterium of any one of the preceding embodiments CC, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or an analog thereof to the culture medium.
[0448] Embodiment CC9: The modified bacterium of Embodiment CC8, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0449] Embodiment CC10: The modified bacterium of Embodiment CC8, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0450] Embodiment CC11: The modified bacterium of any one of the preceding Embodiments CC, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is an HtrA serine protease family gene.
[0451] Embodiment CC12: The modified bacterium of any one of the preceding embodiments CC, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0452] Embodiment CC13: The modified bacterium of any of the preceding Embodiments CC, wherein the bacterium lacks HtrA serine protease activity.
[0453] Embodiment CC14: The modified bacterium of any one of the preceding Embodiments CC, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0454] Embodiment CC15: The modified bacterium of any one of the preceding Embodiments CC, wherein the bacterium is deficient in htrA.
[0455] Embodiment CC16: The modified bacterium of any one of Embodiments CC1-CC15, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0456] Embodiment CC17: The modified bacterium of any one of Embodiments CC1-CC15, wherein the essential gene expression cassette is exogenous, and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0457] Embodiment CC18: The modified bacterium of Embodiment CC17, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0458] Embodiment CC19: The modified bacterium of Embodiment CC17, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0459] Embodiment CC20: The modified bacterium of Embodiment CC19, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0460] Embodiment CC21: The modified bacterium of any one of the preceding Embodiments CC, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0461] Embodiment CC22: The modified bacterium of Embodiment CC21, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0462] Embodiment CC23: The modified bacterium of Embodiment CC22, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0463] Embodiment CC24: The modified bacterium of any of the preceding embodiments CC, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5.
[0464] Embodiment CC25: The modified bacterium of any one of the preceding Embodiments CC, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0465] Embodiment CC26: The modified bacterium of any one of the preceding Embodiments CC, wherein the promoter active under acidic pH conditions is sseA.
[0466] Embodiment CC27: The modified bacterium of any of the preceding Embodiments CC, wherein the unmodified starting strain is a facultative anaerobic Salmonella typhimurium.
[0467] Embodiment CC28: The modified bacterium of any of the preceding Embodiments CC, wherein the starting strain is Salmonella typhimurium SL7207.
[0468] Embodiment CC29: The modified bacterium of any of the preceding Embodiments CC, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0469] Embodiment CC30: The modified bacterium of any of the preceding Embodiments CC, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0470] Embodiment CC31: The modified bacterium of any of the preceding Embodiments CC, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0471] Embodiment CC32: The modified bacterium of any of the preceding Embodiments CC, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0472] Embodiment CC33: The modified bacterium of any of the preceding Embodiments CC, which does not express wild-type flagellin.
[0473] Embodiment CC34: The modified bacterium of any one of the preceding Embodiments CC, which lacks the fliC gene.
[0474] Embodiment CC35: The modified bacterium of any of the preceding Embodiments CC, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0475] Embodiment CC36: The modified bacterium of any one of Embodiments CC1-CC34, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0476] Embodiment CC37: The modified bacterium of any one of Embodiments CC1-CC34, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0477] Implementation Plan DD
[0478] Embodiment DD1: A modified bacterium, wherein compared to an unmodified starting strain, the bacterium comprises a hypoxia-regulatable essential gene expression cassette, the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter, the bacterium lacks at least one non-essential gene involved in LPS biosynthesis or transport and / or a gene encoding a cell wall lipoprotein or its expression product, and the bacterium lacks at least one gene required for survival in macrophages or its functional expression product.
[0479] Embodiment DD2: The modified bacterium of embodiment DD1, wherein the gene involved in LPS biosynthesis is selected from the group consisting of a gene involved in O-antigen synthesis, a gene involved in core region synthesis, and a gene involved in lipid A synthesis.
[0480] Embodiment DD3: The modified bacterium of embodiment DD2, wherein the gene involved in O-antigen synthesis is selected from the group consisting of wzzB, gtrBb, gtrBa and rfbP / wbaP genes, the gene involved in core region synthesis is selected from the group consisting of rfaB, yibD, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaZ, yijP, gmhA, yaeD, rfaE and rfaD genes, and the gene involved in lipid A synthesis is selected from the group consisting of lpxA, lpxC, lpxD, lpxH, msbB / lpxM, lpxO, lpxP, arnT, yjdB, kdsB, yrbI and yrbH genes.
[0481] Embodiment DD4: The modified bacterium of embodiment DD1, wherein the gene involved in LPS transport is selected from the group consisting of msbA, Wzy, lptA, lptB and lptG genes.
[0482] Embodiment DD5: The modified bacterium of embodiment DD1, wherein the bacterium does not express wild-type lipopolysaccharide (LPS). In one embodiment, the bacterium does not express LPS or expresses a mutated or structurally incomplete LPS.
[0483] Embodiment DD6: The modified bacterium of any one of the preceding embodiments DD, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0484] Embodiment DD7: The modified bacterium of any one of the preceding Embodiments DD, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0485] Embodiment DD8: The modified bacterium of any one of the preceding embodiments DD, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0486] Embodiment DD9: The modified bacterium of embodiment DD8, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0487] Embodiment DD10: The modified bacterium of Embodiment DD8, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0488] Embodiment DD11: The modified bacterium of any one of the preceding Embodiments DD, wherein the gene required for survival in macrophages is the STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.
[0489] Embodiment DD12: The modified bacterium of any one of the preceding Embodiments DD, wherein the functional expression product of the gene required for survival in macrophages is an HtrA serine protease family-related protein.
[0490] Embodiment DD13: The modified bacterium of any one of the preceding Embodiments DD, wherein the bacterium lacks HtrA serine protease activity.
[0491] Embodiment DD14: The modified bacterium of any one of the preceding Embodiments DD, wherein the gene required for survival in macrophages is htrA.
[0492] Embodiment DD15: The modified bacterium of any one of the preceding Embodiments DD, wherein the bacterium is deficient in htrA.
[0493] Embodiment DD16: The modified bacterium of any one of embodiments DD1-DD15, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0494] Embodiment DD17: The modified bacterium of any one of Embodiments DD1-DD15, wherein the essential gene expression cassette is exogenous, and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0495] Embodiment DD18: The modified bacterium of Embodiment DD17, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
[0496] Embodiment DD19: The modified bacterium of Embodiment DD17, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
[0497] Embodiment DD20: The modified bacterium of Embodiment DD19, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
[0498] Embodiment DD21: The modified bacterium of any one of the preceding Embodiments DD, further comprising a pH-regulatable expression cassette comprising a gene encoding a bacterially derived hemolysin protein controlled by a promoter active under acidic pH conditions.
[0499] Embodiment DD22: The modified bacterium of Embodiment DD21, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0500] Embodiment DD23: The modified bacterium of embodiment DD22, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0501] Embodiment DD24: The modified bacterium of Embodiment DD23, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0502] Embodiment DD25: The modified bacterium of any one of Embodiments DD21-DD24, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5.
[0503] Embodiment DD26: The modified bacterium of any one of Embodiments DD21-DD24, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0504] Embodiment DD27: The modified bacterium of any one of Embodiments DD21-DD24, wherein the promoter active under acidic pH conditions is sseA.
[0505] Embodiment DD28: The modified bacterium of any one of the preceding Embodiments DD, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0506] Embodiment DD29: The modified bacterium of any one of the preceding Embodiments DD, wherein the bacterium is an Enterobacteriaceae bacterium.
[0507] Embodiment DD30: The modified bacterium of any one of the preceding embodiments DD, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0508] Embodiment DD31: The modified bacterium of any one of the preceding embodiments DD, wherein the bacterium is selected from Escherichia coli, Escherichia roach, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica , Yersinia pseudotuberculosis, Yersinia ostreatus, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia krusei, Yersinia mossei, Yersinia rosenbergii, Yersinia ruckeri, Citrobacter freudii, Citrobacter kozei, Citrobacter blak, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter jagouwei, Enterobacter sakazakii, Enterobacter tylosus, Enterobacter riveris, Enterobacter intermedia, Enterobacter agglomerans, Enterobacter cancerogens, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figi, Serratia izumi, Serratia grazie, Serratia liquefaciens, Serratia aromatica, Serratia puchengensis, Serratia longyanmao, Serratia crimson, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus panthera, Proteus housiei, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei and Pantoea agglomerans.
[0509] Embodiment DD32: The modified bacterium of any one of the preceding Embodiments DD, wherein the bacterium is Salmonella typhimurium.
[0510] Embodiment DD33: The modified bacterium of Embodiment DD32, wherein the starting strain is Salmonella typhimurium SL7207.
[0511] Embodiment DD34: The modified bacterium of any of the preceding Embodiments DD, wherein upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0512] Embodiment DD35: The modified bacterium of any of the preceding Embodiments DD, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0513] Embodiment DD36: The modified bacterium of any of the preceding Embodiments DD, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0514] Embodiment DD37: The modified bacterium of any of the preceding Embodiments DD, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0515] Embodiment DD38: The modified bacterium of any of the preceding Embodiments DD, which does not express wild-type flagellin.
[0516] Embodiment DD39: The modified bacterium of any one of the preceding Embodiments DD, which lacks the fliC gene.
[0517] Embodiment DD40: The modified bacterium of any of the preceding Embodiments DD, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0518] Embodiment DD41: The modified bacterium of any one of Embodiments DD1-DD39, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0519] Embodiment DD42: The modified bacterium of any one of Embodiments DD1-DD39, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0520] Implementation Plan K
[0521] Embodiment K1: A pharmaceutical composition comprising an effective amount of the modified bacterium of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD.
[0522] Embodiment K2: The pharmaceutical composition of Embodiment K1, which is used for treating malignant tumors.
[0523] Embodiment K3: The pharmaceutical composition of Embodiment K1, for inducing an anti-tumor specific immune response in a subject suffering from a malignant tumor.
[0524] Embodiment K4: The pharmaceutical composition of Embodiment K1, for inducing anti-tumor immune memory in a subject suffering from a malignant tumor.
[0525] Embodiment K5: The pharmaceutical composition of Embodiment K1, which is used for preventing or treating metastasis or recurrence of malignant tumors.
[0526] Embodiment K6: The pharmaceutical composition of Embodiment K1, which is used for treating malignant tumors that are resistant to or have failed to respond to previous anti-tumor therapies.
[0527] Embodiment K7: The pharmaceutical composition of Embodiments K1-K6, wherein the modified bacterium is a live bacterium.
[0528] Implementation Plan L
[0529] Embodiment L1: A method for treating a malignant tumor, comprising administering to a subject suffering from a malignant tumor an effective amount of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD, or the pharmaceutical composition of any one of embodiment K.
[0530] Embodiment L2: A method for inducing an anti-tumor specific immune response in a subject having a malignant tumor, comprising administering to the subject an effective amount of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD, or the pharmaceutical composition of any one of embodiment K.
[0531] Embodiment L3: A method for inducing anti-tumor immune memory in a subject having a malignant tumor, comprising administering to the subject an effective amount of the modified bacteria of any one of the foregoing embodiments A, B, C, D, E, F, AA, BB, CC and DD or the pharmaceutical composition of any one of embodiment K.
[0532] Embodiment L4: A method for preventing or treating metastasis or recurrence of a malignant tumor, comprising administering to a subject suffering from a malignant tumor an effective amount of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD, or the pharmaceutical composition of any one of embodiment K.
[0533] Embodiment L5: A method for preventing or treating metastasis or recurrence of a malignant tumor, comprising administering an effective amount of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD, or the pharmaceutical composition of any one of embodiment K to a subject suffering from metastasis or recurrence of a malignant tumor or a subject at high risk of metastasis or recurrence of a malignant tumor.
[0534] Embodiment L6: A method for treating a malignant tumor that has become resistant to or has failed treatment with previous anti-tumor therapy, comprising administering an effective amount of the modified bacteria of any one of Embodiments A, B, C, D, E, F, AA, BB, CC, and DD, or the pharmaceutical composition of any one of Embodiments K to a subject suffering from a malignant tumor that has become resistant to or has failed treatment with previous anti-tumor therapy.
[0535] Embodiment L7. The method of Embodiments L1-L6, wherein the modified bacterium is a live bacterium.
[0536] Implementation Plan M
[0537] Embodiment M1: Use of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD in the preparation of a medicament for treating malignant tumors.
[0538] Embodiment M2: Use of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD in the preparation of a medicament for inducing an anti-tumor specific immune response in a subject with a malignant tumor.
[0539] Embodiment M3: Use of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD in the preparation of a medicament for inducing anti-tumor immune memory in a subject with a malignant tumor.
[0540] Embodiment M4: Use of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD in the preparation of a medicament for preventing or treating metastasis or recurrence of malignant tumors.
[0541] Embodiment M5: Use of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, F, AA, BB, CC and DD in the preparation of a medicament for treating a malignant tumor that has become resistant to or has failed treatment with previous anti-tumor therapy.
[0542] Embodiment M6: The use of Embodiments M1-M5, wherein the modified bacterium is a live bacterium.
[0543] Implementation Plan N
[0544] Embodiment N1: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the malignant tumor is a malignant tumor of the nervous system, respiratory system, digestive system, urinary system, reproductive system, hematopoietic system, lymphatic system, endocrine system, or skin and mucosa.
[0545] Embodiment N2: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the malignancy is a sarcoma or a carcinoma.
[0546] Embodiment N3: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the malignant tumor is a solid tumor.
[0547] Embodiment N4: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the malignant tumor is selected from glioma, neuroblastoma, retinoblastoma, nasopharyngeal cancer, oral cancer, tongue cancer, laryngeal cancer, head and neck cancer, melanoma, bronchial cancer, lung cancer, pleural cancer, esophageal cancer, gastric cancer, liver cancer, pancreatic cancer, bile duct cancer, colon cancer, rectal cancer, renal cell carcinoma, bladder cancer, prostate cancer, adrenal tumor, thyroid cancer, parathyroid cancer, pituitary tumor, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, cervical cancer, ovarian cancer, endometrial cancer, breast cancer, bone cancer, and osteosarcoma.
[0548] Embodiment N5: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the bacteria, drug, or pharmaceutical composition is administered by intravenous injection, intratumoral injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, intracerebral administration, gastrointestinal administration, topical administration, oral mucosal administration, nasal administration, rectal administration, or vaginal administration. Example
[0549] The following examples are provided to illustrate certain specific features and / or embodiments of the present invention. These examples should not be construed as limiting the present invention to the specific features or embodiments described.
[0550] Example 1: Construction of variant strains of Salmonella typhimurium SL7207
[0551] 1.1 Using the PsseA-hlyA-loxp-KnaR-loxp plasmid (SEQ ID NO: 3) and the Pssbp1-dapE-Cm plasmid (SEQ ID NO: 4) as templates, the target fragments were amplified by PCR. For PsseA-hlyA-loxp-KnaR-loxp, the following primer sequences were used: forward primer (SEQ ID NO: 5) and reverse primer (SEQ ID NO: 6); for Pssbp1-dapE-Cm, the following primer sequences were used: forward primer (SEQ ID NO: 7) and reverse primer (SEQ ID NO: 8). The annealing temperature was 55°C. Target fragment 1 was PsseA-hlyA-loxp-KnaR-loxp (SEQ ID NO: 1), and target fragment 2 was Pssbp1-dapE-Cm (SEQ ID NO: 2).
[0552] 1.2 The pSim6 plasmid containing λ phage Red recombinase (BioVector NTCC Inc.: 3574840) was introduced into the facultative anaerobic Salmonella SL7207 strain (NCBI: ASM1320710v1) to prepare the SL7207 strain containing the pSim6 plasmid and electroporated competent cells SL7207 (pSim6).
[0553] 1.3 The target fragment 1 was introduced into SL7207 (pSim6) competent cells via electroporation (E = 18 kV / cm). The dapE gene (which regulates the synthesis of diaminopimelane, essential for cell wall synthesis) in the SL7207 genome was replaced with the target fragment 1 using λ-red homologous recombination technology. Specifically, the target strain containing the pSim6 plasmid was cultured at 30°C and the recombinase expression conditions were 42°C for 15 minutes. Homologous arms containing 50 bp upstream and downstream of the target gene site were added to the PCR primers. Under the action of the homologous recombinase, the homologous recombination process was completed, resulting in the SL7207 (ΔdapE::PsseA-hlyA-KnaR) strain.
[0554] 1.4 The Cre plasmid containing the P1 phage Cre recombinase (Gene Bridges: A112) was introduced into the SL7207 (ΔdapE::PsseA-hlyA-KnaR) strain to remove kanamycin resistance by recombination, thereby obtaining the SL7207 (ΔdapE::PsseA-hlyA) strain.
[0555] 1.5 Introduce the pSim6 plasmid into the SL7207 (ΔdapE::PsseA-hlyA) strain; prepare SL7207 (ΔdapE::PsseA-hlyA) (pSim6) electroporation competent cells.
[0556] 1.6 Target fragment 2 was introduced into SL7207(ΔdapE::PsseA-hlyA)(pSim6) competent cells by electroporation (E=18 kV / cm). Lambda-red homologous recombination was used to replace the htrA gene (encoding a serine protease) in the SL7207(ΔdapE::PsseA-hlyA) genome with target fragment 2, generating the DB-ZW1 strain, an SL7207 strain lacking the htrA gene and possessing the hlyA gene under the control of PsseA and the dapE gene under the strict hypoxia-inducible promoter Pssbp1 (ΔdapE::PsseA-hlyA; ΔhtrA::Pssbp1-dapE-Cm).
[0557] The strain construction scheme is shown in Figure 1.
[0558] Example 2: DB-ZW1 has tumor inhibitory effects on various tumor models
[0559] 2.1 Establishment of tumor model
[0560] C57BL / 6 mice (purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., weighing about 18 g, raised in an SPF environment) were subcutaneously inoculated with 1×10 6 MB49 mouse bladder cancer cells / B16 melanoma cells (ATCC:CRL-6475) were used to establish a mouse bladder cancer / melanoma subcutaneous tumor model. 14-18 days after inoculation, the tumor volume was 100 mm 3 The experiment was conducted around 4:00 p.m. An orthotopic colorectal cancer model was induced using DSS / AOM: a single intraperitoneal injection of 10 mg / kg AOM was administered. One week later, mice were fed 2.5% DSS-containing water for 7 days, followed by normal drinking water for 14 days. This constituted one DSS treatment cycle. Three additional cycles of DSS treatment were performed to establish a mouse model with colorectal cancer.
[0561] 2.2 Distribution changes of DB-ZW1 in tumors and different organs
[0562] 1×10 7 CFU, 125 μL of DB-ZW1 was injected into MB49 bladder cancer-bearing mice via the tail vein, with 3 mice per group. Approximately 90% of DB-ZW1 was observed to reside in the tumor 1 day after injection (dpi). Over the next 2 days, the density of DB-ZW1 in the tumor increased further by 100-fold (reaching 10 8 CFU / g) and remained at a high level for the next two weeks. In contrast, the density of DB-ZW1 in normal organs steadily decreased to <10 CFU / g within two weeks. 2 CFU / g (Figure 2A).
[0563] To further determine whether DB-ZW1 preferentially proliferates in tumors, 1×10 7 The number of DB-ZW1 cells in different organs was measured within 24 hours after injection of 125 μL of DB-ZW1 bacteria (CFU). Three mice were included in each group (Figure 2B). The results showed that DB-ZW1 rapidly spread throughout the mouse body within 30 minutes after injection, and the vast majority of DB-ZW1 cells (about 99.9%) were distributed in the liver, spleen, and blood. However, within 4 hours after injection, their number decreased significantly, and the total number of DB-ZW1 cells decreased by about 90%. Subsequently, DB-ZW1 cells in the tumor were detected at a rate of 0.7 h. -1 The growth rate of DB-ZW1 cells was exponential, reaching saturation within 3 days. In contrast, the number of DB-ZW1 cells steadily decreased in normal organs. This unique tumor growth characteristic of DB-ZW1 cells is key to the validity of the following research results.
[0564] 2.3 Antitumor effect of DB-ZW1 on bladder cancer, melanoma and colon cancer
[0565] DB-ZW1 was used to treat mice with subcutaneous bladder cancer, orthotopic melanoma, and subcutaneous and orthotopic colon cancer. 1×10 7 CFU, 125 μL of DB-ZW1 was injected into tumor-bearing mice via the tail vein, with five mice per group. As shown in Figures 3A-C, DB-ZW1 significantly reduced tumor volume. Furthermore, treatment of mice with orthotopic colon cancer with DB-ZW1 significantly reduced the number of tumors in the colon (Figure 3D).
[0566] Example 3: Construction of variant strains of DB-ZW1
[0567] Using the pTargetF plasmid (SEQ ID NO: 22) as a template, PCR was performed using PrimeSTAR Max DNA Polymerase (Takara #R054A) and the primer pair msbb-HR-Upper / msbb-HR-Down or the primer pair lppAB-HR-Upper / lppAB-HR-Down (see Table 3) to obtain homologous recombinant fragments 3 and 4, respectively. The PCR system (total volume 50 μL) contained 1× PrimeSTAR Max Premix, 0.2-0.3 μM of each primer, 200 ng of template, and water.
[0568] The PCR reaction conditions were as follows: denaturation at 98°C for 10 sec, annealing at 55°C for 10 sec, and extension at 72°C for 5 sec / kb, with 30 cycles of denaturation-annealing-extension.
[0569] Homologous recombination fragments 3 and 4 were integrated into the original msbb gene and lppAB gene of the ZW1 strain respectively by the λ-red homologous recombination method to obtain strains ZW1(Δmsbb)-aadA and ZW1(ΔlppAB)-aadA.
[0570] Furthermore, in a similar manner, different primer pairs XXX-HR-Upper / XXX-HR-Down were used to amplify the corresponding homologous recombination fragments, and homologous recombination was performed to obtain the corresponding strain ZW1(ΔXXX)-aadA (see Table 3, where XXX represents the corresponding gene).
[0571] Table 3
[0572] The identification primers are shown in Table 4 (primer iden-XXX-F / R and primer iden-KanR-KI-R were used, XXX is the gene name).
[0573] Table 4
[0574] Example 4: Construction of aTc-induced DB-ZW1 strain expressing essential LPS-related genes
[0575] Using the ptet-tetR-aaad plasmid (SEQ ID NO: 23) as a template and the primer pair reverse primer 1 / forward primer 1 (see Table 3), PCR was performed using the PCR reaction system and conditions described in Example 3 to obtain the fragment Backbone-ptet-tetR-aaad.
[0576] Using DB-ZW1 genomic DNA as a template, the primer pair XXX-OS-Upper / XXX-OS-Down (see Table 3, where XXX represents the corresponding gene) and the fragment Backbone-ptet-tetR-aaad were cloned in one step using the ClonExpressⅡ One Step Cloning Kit (Vazyme#C112) to construct the plasmid ptet-tetR-XXX-aaad.
[0577] Using the plasmid ptet-tetR-XXX-aaad as a template and the primer pair XXX-HR-Upper / XXX-HR-Down (see Table 3, where XXX represents the corresponding gene), PCR was performed using the PCR reaction system and conditions described in Example 3 to obtain the corresponding homologous recombinant fragment.
[0578] The homologous recombination fragment was integrated into the original gene position of the ZW1 strain by the λ-red homologous recombination method to obtain the strain ZW1(ΔXXX::ptet-tetR-XXX)-aadA. The identification primers are shown in Appendix Table 4 (using primers iden-KO-XXX-F or iden-XXX-KO and primer iden-KanR-KI-R, XXX is the gene name).
[0579] Example 5: Construction of strains expressing bacterial LPS-related genes or murein lipoproteins induced by hypoxia
[0580] 5.1 Construction of a strain expressing the msbb gene induced by hypoxia
[0581] Using the Psc101-Fnr-SP-msbb-KnaR plasmid (SEQ ID NO: 24) as a template, forward primer 2 and reverse primer 2, PCR was performed using the PCR reaction system and conditions described in Example 3 to obtain homologous recombinant fragment 5;
[0582] The homologous recombination fragment 3 was integrated into the position of the homologous recombination fragment 3 in the strain ZW1 (Δmsbb)-aadA by the λ-red homologous recombination method to obtain the strain ZW1 (Δmsbb)-Fnr-SP-msbb-KnaR.
[0583] 5.2 Construction of hypoxia-induced lppAB gene expression strains
[0584] Using the Psc101-Fnr-SP-lppAB-KnaR plasmid (SEQ ID NO: 25) as a template, forward primer 3 and reverse primer 3, PCR was performed using the PCR reaction system and conditions described in Example 3 to obtain homologous recombinant fragment 6;
[0585] The homologous recombination fragment 6 was integrated into the homologous recombination fragment 6 position in the strain ZW1(ΔlppAB)-aadA by the λ-red homologous recombination method to obtain the strain ZW1(ΔlppAB)-Fnr-SP-lppAB-KnaR.
[0586] 5.3 Construction of plasmids for hypoxia-induced expression of bacterial LPS-related genes
[0587] Using the genome of strain DB-ZW1 as a template, PCR was performed using the primer pair **F / **R (see Table 5) using the PCR reaction system and conditions described in Example 3 to obtain the homologous recombination target fragments. Using psc101-FNR-sp-msbb-KanR as a template, PCR was performed using the primer pair P-backbone-R1101 / P-backbone-SC101-F1130 (P-R1101 / P-F1130) using the PCR reaction system and conditions described in Example 3 to obtain the linear vector backbone fragment for homologous recombination.
[0588] The PCR system (total volume 50 μL) contained 1× PrimeSTAR Max Premix, 0.2-0.3 μM of each primer, 200 ng of template and water.
[0589] PCR reaction conditions were: denaturation: 98°C 10 sec, annealing: 55°C 10 sec, extension: 72°C 5 sec / kb, Table 5
[0590] The vector fragment and target gene fragment were recombined using the ClonExpress II One Step Cloning Kit (Vazyme#C112) and chemically transformed into cloning competent cells (DH5α Competent E. coli Strain, Vazyme#C502). The recombinant plasmid was named: psc101-FNR-sp-###-KanR, where ### corresponds to the gene name listed in Table 5.
[0591] 5.4 Construction of strains expressing bacterial LPS-related genes induced by hypoxia:
[0592] Using the above-constructed anaerobic expression plasmid psc101-FNR-sp-###-KanR as a template, PCR was performed using the primer pair **F-in / **R-in shown in Table 6 using the PCR reaction system and conditions described in Example 3 to obtain a fragment for homologous recombination knock-in, i.e., a fragment that anaerobically expresses LPS-related genes and carries the kanamycin resistance gene.
[0593] Table 6
[0594] The constructed target gene fragments were introduced into competent cells of strain DB-ZW1 via λ-red homologous recombination using electroporation (E = 18 kV / cm), resulting in a ZW1 (Δlps gene)-Fnr-SP-lps gene-KanR strain library. This library replaced the genes at their original loci on the bacterial genome with hypoxia-inducible expression cassettes. PCR was performed using the identification primers iden-bb-fnr-F (CGAAATAGACAGATCGCTGA) / iden-bb-fnr-R (CTTCCCAACCTTACCAGAGG) using the PCR system and conditions described in Example 3. Successful strain construction was confirmed by amplification of the corresponding loci. As shown in Figure 5, strains expressing hypoxia-induced LPS-related genes or murein lipoprotein genes were successfully constructed.
[0595] Example 6: Therapeutic Effects of Hypoxia-Induced Strains Expressing LPS-Related Genes or Murine Lipoprotein Genes
[0596] 6.1. The strains ZW1(Δmsbb)-Fnr-SP-msbb-KnaR and ZW1(ΔlppAB)-Fnr-SP-lppAB-KnaR obtained in Example 5.2 were used to treat the MB49 subcutaneous tumor-bearing mouse model (1×10 6 MB49 bladder cancer cells were injected subcutaneously into mice (C57BL / 6 purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., weighing approximately 18 g) and the mice were raised until the tumor volume reached 150-200 mm. 3 ).
[0597] Specifically, the strain was cultured overnight in a shaker at 37°C at 150 rpm, and then transferred to fresh LB medium at a ratio of 1:100 and cultured until OD600 = 0.4-0.5. The cells were collected and counted by flow cytometry. 7 CFU of bacteria were suspended in 125 μL of PBS and injected into mice via the tail vein. Mice injected with ZW1(Δmsbb)-Fnr-SP-msbb-KnaR and ZW1(ΔlppAB)-Fnr-SP-lppAB-KnaR served as experimental groups (n=5), mice injected with strain DB-ZW1 and ZW1(Δmsbb)-aadA or ZW1(ΔlppAB)-aadA served as controls (n=5), and mice injected with PBS served as blank controls (n=4). Tumor volume, body weight, and survival rate of tumor-bearing mice were observed at days 0, 1, 3, 5, 7, 9, 12, and 14 after injection.
[0598] During the 14-day period, two mice in the blank control group had tumor volumes exceeding ethical limits and were therefore considered dead, while no other mice died ( Figures 6C and 7C ).
[0599] As shown in Figure 6A , strains DB-ZW1, ZW1(Δmsbb)-aadA, and ZW1(Δmsbb)-Fnr-SP-msbb-KnaR can all inhibit tumor growth, among which strain ZW1(Δmsbb)-aadA has a lower inhibitory effect on tumor growth than strain DB-ZW1, while strain ZW1(Δmsbb)-Fnr-SP-msbb-KnaR has the highest tumor inhibition.
[0600] As shown in Figure 6B, mice injected with all three strains showed no significant difference in weight loss over the course of one day. One day after bacterial injection, weight recovery was accelerated in mice injected with strains DB-ZW1, ZW1(Δmsbb)-aadA, and ZW1(Δmsbb)-Fnr-SP-msbb-KnaR.
[0601] The results showed that the strain ZW1(Δmsbb)-Fnr-SP-msbb had the strongest ability to inhibit tumor growth and the weakest toxicity.
[0602] As shown in Figure 7A, strains DB-ZW1, ZW1(ΔlppAB)-aadA and ZW1(ΔlppAB)-Fnr-SP-lppAB-KnaR can all inhibit tumor growth. Among them, there was no significant difference in the inhibition of tumor growth between strains DB-ZW1 and ZW1(ΔlppAB)-Fnr-SP-lppAB-KnaR, and both were higher than strain ZW1(ΔlppAB)-aadA.
[0603] As shown in Figure 7B, mice injected with all three bacterial strains showed no significant weight loss within one day. One day after bacterial injection, mice injected with strains ZW1(ΔlppAB)-aadA and ZW1(ΔlppAB)-Fnr-SP-lppAB-KnaR showed no significant weight recovery, and both groups showed higher weight gain than mice injected with strain DB-ZW1. On day 14 after injection, there was no significant difference in weight between the groups, indicating that the bacteria had been cleared from the mice's normal tissues.
[0604] The results showed that the strain ZW1(ΔlppAB)-Fnr-SP-lppAB-KnaR had the same ability to inhibit tumor growth as DB-ZW1, but was less toxic.
[0605] 6.2. As described in Example 6.1, the therapeutic effect of the strain prepared in Example 5.4 was tested.
[0606] Sequence Listing
Claims
1. A modified bacterium, wherein compared to an unmodified starting strain, the bacterium comprises a hypoxia-regulatable lipopolysaccharide (LPS) gene expression cassette, wherein the LPS gene expression cassette comprises a gene involved in LPS biosynthesis or transport or a gene encoding a cell wall lipoprotein controlled by a first strictly hypoxia-inducible promoter.
2. The modified bacterium of claim 1, wherein the gene involved in LPS biosynthesis is selected from the group consisting of a gene involved in O-antigen synthesis, a gene involved in core region synthesis, and a gene involved in lipid A synthesis.
3. The modified bacterium of claim 2, wherein the gene involved in O-antigen synthesis is selected from the group consisting of rfbN, rfbV, wzzB, gtrBb, gtrBa and rfbP / wbaP genes.
4. The modified bacterium of claim 2, wherein the gene involved in core region synthesis is selected from the group consisting of rfaB, rfaC / waaC, rfaF, rfaG, yibD, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaY, rfaZ, yijP, gmhA, yaeD, rfaE and rfaD genes.
5. The modified bacterium of claim 2, wherein the gene involved in lipid A synthesis is selected from the group consisting of lpxA, lpxB, lpxC, lpxD, lpxH, lpxK, htrB, msbB / lpxM, lpxO, lpxP, yeiU, kdtA, arnT, pagP, yjdB, yhjw, kdsA, kdsB, yrbI and yrbH genes.
6. The modified bacterium of claim 1, wherein the gene involved in LPS transport is selected from the group consisting of msbA, Wzy, wzxE, lptA, lptB, lptC / yrbK, lptD and lptG genes.
7. The modified bacterium of any one of claims 1 to 6, wherein the gene involved in LPS biosynthesis or transport or the gene encoding a cell wall lipoprotein is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the gene involved in LPS biosynthesis or transport or the gene encoding a cell wall lipoprotein is functionally replaced by the first strict hypoxia-inducible promoter, thereby the expression of the gene involved in LPS biosynthesis or transport or the gene encoding a cell wall lipoprotein in the bacterium is completely controlled by the first strict hypoxia-inducible promoter.
8. The modified bacterium of any one of claims 1 to 6, wherein the LPS gene expression cassette is exogenous, and the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the gene involved in LPS biosynthesis or transport or the gene encoding cell wall lipoprotein in the bacterium is completely controlled by the first strict hypoxia inducible promoter.
9. The modified bacterium of claim 8, wherein the exogenous LPS gene expression cassette is integrated into the chromosome of the bacterium.
10. The modified bacterium of claim 8, wherein the exogenous LPS gene expression cassette is located outside the chromosome of the bacterium.
11. The modified bacterium of claim 10, wherein the exogenous LPS gene expression cassette is present in a plasmid carried by the bacterium.
12. The modified bacterium of any one of claims 1-11, wherein the bacterium further comprises a hypoxia-regulatable essential gene expression cassette compared to an unmodified starting strain, wherein the essential gene expression cassette comprises an essential gene of the bacterium controlled by a second strict hypoxia-inducible promoter, and the bacterium lacks at least one gene involved in or regulating an endogenous anti-oxidative stress response pathway or a functional expression product thereof.
13. The modified bacterium of any one of claims 1 to 12, wherein the first and second strict hypoxia-inducible promoters are each independently selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
14. The modified bacterium of any one of claims 1 to 12, wherein the first and second strictly hypoxia-inducible promoters are each independently selected from the group consisting of fnrSp and ssbp1 promoters.
15. The modified bacterium of any one of claims 12-14, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues in the culture medium.
16. The modified bacterium of claim 15, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
17. The modified bacterium of claim 15, wherein the essential gene is selected from the group consisting of dapA and dapE.
18. The modified bacterium of any one of claims 12 to 17, wherein the gene involved in or regulating an endogenous anti-oxidative stress response pathway is a HtrA serine protease family gene.
19. The modified bacterium according to any one of claims 12 to 18, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is a protein related to the HtrA serine protease family.
20. The modified bacterium of any one of claims 12-19, wherein the bacterium lacks HtrA serine protease activity.
21. The modified bacterium of any one of claims 12-20, wherein the gene involved in or regulating an endogenous anti-oxidative stress response pathway is htrA.
22. The modified bacterium of any one of claims 12-21, wherein the bacterium lacks htrA.
23. The modified bacterium of any one of claims 12 to 22, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the second strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
24. The modified bacterium of any one of claims 12-22, wherein the essential gene expression cassette is exogenous, and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the second strict hypoxia-inducible promoter.
25. The modified bacterium of claim 24, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium.
26. The modified bacterium of claim 24, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium.
27. The modified bacterium of claim 26, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.
28. The modified bacterium of any one of the preceding claims, further comprising a pH-regulatable expression cassette comprising a gene encoding a hemolysin protein of bacterial origin under the control of a promoter active under acidic pH conditions.
29. The modified bacterium of claim 28, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
30. The modified bacterium of claim 29, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
31. The modified bacterium of claim 30, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
32. The modified bacterium of any one of claims 28-31, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.
5.
33. The modified bacterium of any one of claims 28-32, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM and ssaR.
34. The modified bacterium of any one of claims 28-32, wherein the promoter active under acidic pH conditions is sseA.
35. The modified bacterium of any of the preceding claims, wherein the unmodified starting strain is a facultative anaerobic bacterium.
36. The modified bacterium of any one of the preceding claims, wherein the bacterium is an Enterobacteriaceae bacterium.
37. The modified bacterium of any of the preceding claims, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia or Pantoea bacterium.
38. The modified bacterium of any of the preceding claims, wherein the bacterium is selected from the group consisting of Escherichia coli, E. blattae, E. fergusonii, E. hermannii, E. vulneris, S. enterica, S. bongori, S. typhi, S. choleraesuis, S. typhimurium, S. dysenteriae, S. flexneri, S. bournei, .boydii), Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia aldouae, Yersinia bercov-ieri, Yersinia frederiksenii, Yersinia intermedia, Yersinia kristensii, Yersinia (Y.mollaretti), Yersinia rohdei, Yersinia ruckeri, C.freundii, C.kaseri, C.braakii, E.aerogenes, E.cloacae, E.gergoviac, E.sakazakii, E.tavlorac, E.aminigenus, E.intermedius, asburiac, E.cancerogenus, E.dissolvens, E.nimipressualis, S.marcescens, S.entomophila, S.ficaria, S.fonticola, S.grimesii, S.liquefaciens, S.odorifera, S.plymuthica, S.proteamaculans), S. rubidaea, S. ureilytica, P. mirabilis, P. vulgaris, P. myxofaciens, P. penneri, P. hauseri, M. morganii, P. alcalifaciens, P. rustigianii, P. stuartii, P. rettgeri, P. heimbochae, H. alvei, and P. agglomerans.
39. The modified bacterium of any one of the preceding claims, wherein the bacterium is Salmonella typhimurium.
40. The modified bacterium of claim 34, wherein the starting strain is Salmonella typhimurium SL7207.
41. The modified bacterium of any one of the preceding claims, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).
42. The modified bacterium of any of the preceding claims, wherein when administered to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.