Kaempferol-3-O-(2 '-coumaroyl)-glucoside synthesis related enzyme, coding gene and application thereof

Abstract

The invention relates to the technical field of biology, in particular to an enzyme related to synthesis of kaempferol-3-O-(2 '-coumaroyl)-glucoside, a coding gene and application of the enzyme, and discloses acyltransferase CsCFAT, the amino acid sequence of which is shown as SEQ ID NO.1. The acyltransferase CsCFAT effectively solves the problem that existing kaempferol-3-O-(2'-coumaroyl)-glucoside is difficult to obtain. The invention discovers and identifies that the acyltransferase CsCFAT has the function of catalyzing kaempferol-3-O-glucoside and p-coumaroyl-coenzyme A to generate a target product for the first time, and fills the blank of a specific biological catalysis tool of the compound; compared with traditional plant extraction and chemical synthesis, large-scale production of CsCFAT is achieved through prokaryotic expression, a recombinant protein band after purification is single, a single product peak can be generated through catalytic reaction, and the obtaining efficiency and purity of a target compound are greatly improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and in particular to an enzyme related to synthesis of kaempferol-3-O-(2'-p-coumaroyl)-glucoside, a coding gene and application thereof. O BACKGROUND

[0002] Kaempferol-3-O-(2'-p-coumaroyl)-glucoside is a flavonol derivative with a specific structure, which is widely present in plants and has potential application value in the fields of food, medicine and cosmetics. Its unique molecular structure endows it with various biological activities such as antioxidant and anti-inflammatory, and it has high application potential in the development of functional food additives, the preparation of natural pharmaceutical active ingredients, and the research and development of antioxidant cosmetic raw materials, etc. Therefore, it is of great significance to study the efficient acquisition method of the compound.

[0003] At present, the main way to obtain kaempferol-3-O-(2'-p-coumaroyl)-glucoside is to extract and separate it from natural plants. However, this method has obvious limitations: on the one hand, the natural content of kaempferol-3-O-(2'-p-coumaroyl)-glucoside in plants is low, resulting in huge consumption of raw materials and low extraction efficiency in the extraction process; on the other hand, the composition of plants is complex, containing various flavonoids with similar structures, and the subsequent separation and purification steps are complicated, which requires the use of complex separation equipment and process, not only increasing the production cost, but also difficult to guarantee the high purity of the product, seriously limiting the large-scale production and industrial application of the compound. O O Chemical synthesis method has also been tried to prepare kaempferol-3-O-(2'-p-coumaroyl)-glucoside, but this method also has shortcomings. In the process of chemical synthesis, harsh reaction conditions such as high temperature, high pressure or strong acid and alkali environment are often needed, which not only has high energy consumption, but also may pollute the environment; at the same time, the specificity of chemical synthesis reaction is poor, which is easy to produce various by-products, further increasing the difficulty of product separation and purification, and the use of some chemical reagents may affect the biological safety of the product, which is not conducive to its application in food and medicine fields.

[0004] Biocatalysis method has become a research hotspot in the field of natural compound synthesis due to its advantages of mild reaction conditions, high specificity and environmental friendliness. Among them, enzyme catalysis technology is considered as an ideal way to synthesize kaempferol-3-O-(2'-p-coumaroyl)-glucoside on a large scale because it can efficiently catalyze specific reactions under mild conditions with high product purity and less by-products. However, so far, there is no enzyme that can efficiently and specifically catalyze the synthesis of kaempferol-3-O-(2'-p-coumaroyl)-glucoside. O

[0005] Biocatalysis method has become a research hotspot in the field of natural compound synthesis due to its advantages of mild reaction conditions, high specificity and environmental friendliness. Among them, enzyme catalysis technology is considered as an ideal way to synthesize kaempferol-3-O-(2'-p-coumaroyl)-glucoside on a large scale because it can efficiently catalyze specific reactions under mild conditions with high product purity and less by-products. However, so far, there is no enzyme that can efficiently and specifically catalyze the synthesis of kaempferol-3-O-(2'-p-coumaroyl)-glucoside. O O Therefore, it is of great significance to find an enzyme that can efficiently and specifically catalyze the synthesis of kaempferol-3-O-(2'-p-coumaroyl)-glucoside.​​​​O - Glucoside reacts with acyl donors to produce kaempferol-3- O Enzymes for kaempferol-3-(2'-p-coumaryl)-glucosides are lacking, as are the corresponding encoding genes and related application technologies. This has resulted in slow progress in the research of enzyme-catalyzed synthesis of this compound, failing to meet practical production needs. Therefore, screening and identifying enzymes with the aforementioned catalytic functions, cloning their encoding genes, and developing corresponding enzyme-catalyzed synthesis technologies are crucial for breaking through the limitations of kaempferol-3- O The key bottleneck in the large-scale production of -(2'-p-coumaryl)-glucoside. Summary of the Invention

[0006] The purpose of this invention is to provide kaempferol-3- O This research aims to address the technical challenges of obtaining kaempferol-3-O-(2'-coumaroyl)-glucosinolate through plant extraction (low efficiency and poor purity) or chemical synthesis (harsh conditions and numerous byproducts), and to solve the problem of lacking specific biocatalytic tools. By providing acyltransferases with specific catalytic functions and related technologies, this research will enable the efficient and green synthesis of the target compound.

[0007] The objective of this invention is achieved through the following technical solution: This invention provides an acyltransferase CsCFAT, wherein the amino acid sequence of the acyltransferase CsCFAT is selected from any of the following: (1) As shown in SEQ ID NO.1; (2) It has ≥90% homology with the amino acid sequence shown in SEQ ID NO.1 and can catalyze kaempferol-3- O - Glucoside reacts with p-coumaroyl-CoA to produce kaempferol-3- O Enzymes of 2'-coumaroyl)-glucosinolates.

[0008] The present invention also provides a gene encoding the acyltransferase CsCFAT, the nucleotide sequence of which is selected from any of the following: (1) A nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1; (2) A nucleotide sequence complementary to the nucleotide sequence described in (1); (3) The nucleotide sequence described in (1) has ≥85% homology and encodes a protein that can catalyze kaempferol-3- O - Glucoside reacts with p-coumaroyl-CoA to produce kaempferol-3- O The nucleotide sequence of -(2'-p-coumaryl)-glucosinolate.

[0009] The present invention also provides a primer pair for amplifying the gene of claim 2, comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3; or the primer pair can specifically amplify the gene.

[0010] The present invention also provides a recombinant expression vector containing the aforementioned gene, and the vector is capable of expressing the aforementioned acyltransferase CsCFAT in host cells.

[0011] The present invention also provides a host cell containing the recombinant expression vector of claim 4.

[0012] The present invention also provides a method for producing the acyltransferase CsCFAT, comprising the following steps: (1) Culturing the host cells described above; (2) Inducing host cells to express the acyltransferase CsCFAT; (3) Extract and purify the expression product to obtain the acyltransferase CsCFAT.

[0013] This invention also provides an in vitro enzymatic synthesis of kaempferol-3- from the acyltransferase CsCFAT described above or the acyltransferase CsCFAT produced by the method. O Applications of -(2'-p-coumaryl)-glucoside.

[0014] This invention also provides an in vitro enzymatic method for synthesizing kaempferol-3- O The method for -(2'-p-coumaryl)-glucoside includes the following steps: using p-coumaryl coenzyme A as an acyl donor, and using kaempferol-3- O Using glucosinolate as a substrate, an enzyme reaction system was constructed by adding the acyltransferase CsCFAT to catalyze the reaction, yielding kaempferol-3- O -(2'-p-coumaryl)-glucoside.

[0015] Furthermore, the enzyme reaction system also contains 100 mM sodium phosphate buffer; the catalytic reaction is incubated at 40°C for 3-5 hours; after the catalytic reaction is completed, an equal volume of methanol is added to terminate the reaction, and the mixture is centrifuged at 4°C and 12000 rpm for 15 minutes. The supernatant is then collected to obtain the product containing kaempferol-3- O The product liquid of -(2'-p-coumaryl)-glucoside.

[0016] This invention also provides a method for the gene described above to catalyze the synthesis of kaempferol-3- in vivo. O Application of 2'-coumaroyl)-glucoside in tea.

[0017] Advantages

[0018] The present application effectively solves the existing problem of obtaining kaempferol-3- O - (2'-p-coumaroyl) glucoside. The acyltransferase CsCFAT is first discovered and identified to have the function of catalyzing kaempferol-3- O - glucoside and p-coumaroyl coenzyme A to generate the target product, filling the blank of specific biological catalysis tools for the compound; compared with traditional plant extraction and chemical synthesis, the present application realizes the large-scale production of CsCFAT through prokaryotic expression, and after purification, the recombinant protein band is single, and the catalytic reaction can generate a single product peak, greatly improving the obtaining efficiency and purity of the target compound.

[0019] Meanwhile, the in vitro enzyme synthesis in the present application adopts mild reaction conditions, without high temperature, strong acid and alkali, with less by-products, meeting the needs of green chemical industry and natural product synthesis, which is suitable for small-scale preparation in the laboratory, can be expanded to industrial production, and can also realize the in vivo synthesis of the target compound in tea plants by introducing the CsCFAT gene into tea plants through genetic engineering technology, providing a new way for tea quality improvement and in-situ obtaining of the target product, and has wide application scenarios. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0021] Figure 1 FIG. 1 is the SDS-PAGE electrophoresis result diagram of CsCFAT recombinant protein and PMAL-C5X empty protein in the present application; Figure 2 FIG. 2 is the in vitro enzyme activity chemical spectrum for preparing kaempferol-3- O - (2'-p-coumaroyl) glucoside in the present application. DETAILED DESCRIPTION

[0022] The various exemplary embodiments of the present application will be described in detail below, and the detailed description should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0023] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where a range of values is provided, it is understood that each intervening value, to the upper and lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.

[0024] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the patents, patent applications, publications, and descriptions are cited.

[0025] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in scope by the described embodiments.

[0026] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and methods.

[0027] The chemical reagents, biochemicals and materials used in the present application are commercially available unless otherwise stated.

[0028] The present application will be described in greater detail by way of reference only to the following Examples, which are not to be construed as limiting the scope of the application. The reagents and materials used in the following examples are commercially available unless otherwise stated. Also, unless otherwise indicated, the experimental methods, detection methods, preparation methods disclosed in the present application are carried out according to conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA techniques and related fields.

[0029] Example 1 Prokaryotic expression and protein purification of CsCFAT 1. Experimental materials and reagent preparation 1.1 Strains and vectors Host strains: Escherichia coli DH5α (for recombinant plasmid construction and amplification), Escherichia coli BL21(DE3) (for recombinant protein expression); Vectors: peasy-Blunt-Zero vector (containing the correctly sequenced CsCFAT gene, the amino acid sequence of the acyltransferase CsCFAT encoded by this gene is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.6), PMAL-C5X vector (for recombinant protein expression, containing an MBP tag and an ampicillin resistance gene).

[0030] 1.2 Enzymes and Reagents Restriction endonucleases: NdeI, BamHI; Substrate and acyl donor: Kaempferol-3- O - Glucoside, p-Coumaryl Coenzyme A; Culture media: LB solid medium (containing 100 mg / L ampicillin, abbreviated as Amp), LB liquid medium (containing 100 mg / L Amp); Buffer solution: Buffer 1: Contains 11.688g NaCl, 0.29224g EDTA, and 2.4228g Tris. Make up to 1L with double-distilled water and adjust the pH to 7.4. Buffer2: Add 3.6031g of maltose to Buffer1 and adjust the pH to 7.4; Sodium phosphate buffer: 100mM, pH=8; Other reagents: IPTG (isopropyl-β-D-thiogalactoside), 50% sterile glycerol, methanol (chromatographic grade), and protein purification resin.

[0031] 1.3 Instruments and Equipment Thermostatic shaker, refrigerated centrifuge (set to 4℃), ultrasonic homogenizer, SDSPAGE electrophoresis apparatus, time-of-flight liquid chromatography-mass spectrometry (LCQ-Tof-MS), gravity flow chromatography column.

[0032] 2. Cloning of the CsCFAT gene and construction of a recombinant expression vector 2.1 Target gene amplification In this embodiment, the basic primer pair used to amplify the CsCFAT gene includes an upstream primer (nucleotide sequence as shown in SEQ ID NO.2: ATGATCCAATTGCCACTTTTCCA) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.3: TCAAGGCGTCAAGTTTAAATAGGCT). This step uses specialized primers with added restriction enzyme sites at the 5' end of the aforementioned basic primers. The upstream primer sequence is shown in SEQ ID NO.4 (gagggaaggatttcacatatgATGATCCAATTGCCACTTTTCCA), and the downstream primer sequence is shown in SEQ ID NO.5 (acctgcagggaattcggatccTCAAGGCGTCAAGTTTAAATAGGCT). PCR amplification is performed using the correctly sequenced CsCFAT-peasy-Blunt-Zero vector as a template. After the PCR reaction, the amplification products are verified by agarose gel electrophoresis, and the target gene fragment is recovered. PCR amplification reaction system: ddH2O 20μl, 2× Phanta Max Master Mix 25μl, upstream primer (10 μM) 2μl, downstream primer (10 μM) 2μl, template DNA 1μl; Reaction procedure: 95℃ 3min, 95℃ 15sec, 55℃ 15sec, 72℃ 60sec, Go to step 2, cycles 35, 72℃ 5min, 4℃ end.

[0033] 2.2 Vector double digestion and ligation The PMAL-C5X vector was double-digested with restriction endonucleases NdeI and BamHI, and the digested vector fragments were recovered. The recovered target gene fragment and the digested PMAL-C5X vector fragment were ligated with DNA ligase to obtain the recombinant vector ligation product.

[0034] 2.3 Transformation and Validation of Recombinant Vectors The ligation product was transformed into *E. coli* DH5α competent cells using a heat shock method. The specific procedure was as follows: 30 min on ice, 1 min at 42°C, 5 min on ice, 500 μl of antibiotic-free LB medium was added, and the cells were incubated at 37°C with a shaker at 200 rpm for 45 min. The resulting bacterial culture was then plated onto LB agar containing 100 mg / L Amp and incubated upside down at 37°C for 12–14 h. Single colonies were picked from the agar and subjected to colony PCR verification (primers were the same as in step 1). Recombinant plasmids were extracted from PCR-positive colonies and sequenced. Recombinant plasmids with correct sequencing results were named CsCFAT-PMAL recombinant plasmids.

[0035] 3. Expression of recombinant acyltransferase CsCFAT 3.1 Transformation of expression strains with recombinant plasmids The CsCFAT-PMAL recombinant plasmid and PMAL-C5X empty vector plasmid were transformed into Escherichia coli BL21(DE3) competent cells by chemical transformation. The cells were plated on LB solid medium containing Ampr resistance and incubated upside down at 37°C for 10 h. Single colonies were picked and streaked, and colony PCR was used to verify whether the recombinant plasmids were successfully transformed. Samples with correct colony PCR bands were selected.

[0036] 3.2 Preservation of bacterial strains Take 500 μL of the bacterial culture of the positive strain that was verified by PCR, mix it thoroughly with 500 μL of 50% sterile glycerol, aliquot it into cryovials, and store at -80℃ for later use.

[0037] 3.3 Induced expression of recombinant proteins Select a verified positive monoclonal strain and incubate it in 5 mL of LB liquid medium containing Amp resistance for 10–12 h at 37°C with a constant-temperature shaker at 200–220 rpm. Take 200 μL of the cultured bacterial suspension and dilute it 1:100 to 200 mL of LB liquid medium containing the same resistance for further culture. Incubate at 37°C with a constant-temperature shaker at 200–220 rpm until the bacterial suspension reaches OD. 600 =0.6.

[0038] Take 2 mL of bacterial culture for later use. Add IPTG, the inducer, to the remaining culture medium. Set the constant temperature shaker to 16℃ and 200-220 r / min to induce for 24 h. Take 2 mL of the induced bacterial culture. Centrifuge the remaining bacterial culture at 4000 g, 4℃, and 15 min using a refrigerated centrifuge to remove the supernatant. Collect the induced bacterial cells. Add 20-25 mL of Buffer 1 to the pellet to resuspend the bacterial cells. Collect the resuspension in a 50 mL centrifuge tube.

[0039] The above liquid was used to break down the bacterial cells using an ultrasonic disruptor for 10 minutes (30W power, 2 seconds of sonication, 5 seconds of pause). After disruption, the cells were centrifuged at 5000 rpm and 4°C for 15 minutes using a low-temperature refrigerated centrifuge. The supernatant was collected for protein purification.

[0040] 4. Purification of recombinant acyltransferase CsCFAT 4.1 Resin Pretreatment and Column Packing Take the resin for protein purification, stir it to completely suspend the resin; transfer the suspended resin to a gravity flow chromatography column, let it stand until the resin settles naturally, drain the storage buffer from the tube, then equilibrate the column with 10 times the volume of the resin in Buffer1, and drain the buffer completely at a rate of 0.5~1 mL / min.

[0041] 4.2 Target protein binding and elution of contaminating proteins Slowly add the supernatant obtained in step 3.3 into the equilibrated chromatography column and let it stand at 4°C for 0.5 to 1 hour to allow the target protein to fully bind with the resin. Then, drain the waste liquid from the column at a flow rate of 0.5 to 1 mL / min and wash the resin with 5 to 10 column volumes of Buffer 1 to elute impurities.

[0042] 4.3 Elution and Validation of Target Protein The target protein was eluted with 2 column volumes of Buffer 2, and the eluent was collected in 3 fractions. The collected eluent was then analyzed by SDSPAGE electrophoresis.

[0043] 5. Experimental Results The final SDS-PAGE electrophoresis results of the CsCFAT recombinant protein and the PMAL-C5X empty vector protein are as follows: Figure 1 As shown, by Figure 1 It can be seen that the molecular weight of the CsCFAT recombinant protein band containing the MBP tag is about 97 kDa, and the molecular weight of the protein band expressed by the PMAL-C5X empty vector is about 42 kDa, both within a similar range. The purified recombinant protein can be used for subsequent in vitro enzyme activity experiments.

[0044] Example 2: In vitro enzyme activity assay and product identification of recombinant acyltransferase CsCFAT 1. In vitro enzyme-catalyzed reaction A 620 μL enzyme reaction system was constructed with the following composition: 100 mM sodium phosphate buffer (pH=8), 20 μM kaempferol-3-O-glucoside (substrate), 20 μM p-coumaroyl-CoA (acyl donor), and 10 μL of purified CsCFAT recombinant protein (protein concentration 10-20 μg). A negative control group was set up by replacing the CsCFAT recombinant protein in the system with an equal amount of PMAL-C5X empty vector expression protein. The reaction system was incubated in a 40℃ water bath for 4 h, and then 620 μL of methanol was added to terminate the reaction. The mixture was centrifuged at 12000 rpm for 15 min at 4℃, and 500 μL of supernatant was collected and stored in a brown liquid chromatography bottle for identification by LC-Q-Tof-MS.

[0045] 2. LCQ-Tof-MS identification of the product The reaction products in the supernatant were analyzed using LCQ-Tof-MS under the following detection conditions: Scanning mode: Negative ion scan; Scan range: m / z 100~1500; Sheath gas temperature: 350℃; Atomizer pressure: 35 psi; Gas flow rate: 8 L / min; Gas temperature: 320℃; Sheath air flow rate: 11L / min.

[0046] The final in vitro enzyme activity chemical map is as follows: Figure 2 As shown, by Figure 2 It can be seen that, with p-coumaryl-CoA as the acyl donor, kaempferol-3- O When glucosinolate is used as a substrate, CsCFAT (amino acid sequence shown in SEQ ID NO.1) catalyzes the formation of a single product peak compared to the empty protein. By comparing the retention time and ion fragmentation information of the product peak and the standard, the product was identified as kaempferol-3- O -(2'-p-coumaryl)-glucoside, with a molecular mass-to-charge ratio of 593 in negative ion mode. These results indicate that, under in vitro conditions, CsCFAT can catalyze the catalysis of kaempferol-3- using p-coumaryl-CoA as an acyl donor. O -Kaempferol-3- corresponding to glucoside formation-- O -(2'-p-coumaryl)-glucoside.

[0047] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. An acyltransferase CsCFAT, characterized in that, The amino acid sequence of the acyltransferase CsCFAT is selected from any of the following: (1) As shown in SEQ ID NO.1; (2) It has ≥90% homology with the amino acid sequence shown in SEQ ID NO.1 and can catalyze kaempferol-3- O - Glucoside reacts with p-coumaroyl-CoA to produce kaempferol-3- O Enzymes of 2'-coumaroyl)-glucosinolates.

2. A gene encoding the acyltransferase CsCFAT of claim 1, characterized in that, Its nucleotide sequence is selected from any of the following: (1) The nucleotide sequence as shown in SEQ ID NO.6; (2) A nucleotide sequence complementary to the nucleotide sequence described in (1); (3) The nucleotide sequence described in (1) has ≥85% homology and encodes a protein that can catalyze kaempferol-3- O - Glucoside reacts with p-coumaroyl-CoA to produce kaempferol-3- O The nucleotide sequence of -(2'-p-coumaryl)-glucosinolate.

3. A primer pair for amplifying the gene of claim 2, characterized in that, It includes an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; or the primer pair can specifically amplify the gene as described in claim 2.

4. A recombinant expression vector, characterized in that, The vector contains the gene of claim 2 and is capable of expressing the acyltransferase CsCFAT of claim 1 in a host cell.

5. A host cell, characterized in that, It contains the recombinant expression vector as described in claim 4.

6. A method for producing the acyltransferase CsCFAT of claim 1, characterized in that, Includes the following steps: (1) Culturing the host cells as described in claim 5; (2) Inducing host cells to express the acyltransferase CsCFAT as described in claim 1; (3) Extract and purify the expression product to obtain the acyltransferase CsCFAT.

7. The in vitro enzymatic synthesis of kaempferol-3- kaempferol-3- from an acyltransferase CsCFAT as described in claim 1 or an acyltransferase CsCFAT produced by the method described in claim 6. O Applications of -(2'-p-coumaryl)-glucoside.

8. An in vitro enzymatic synthesis of kaempferol-3- O The method for -(2'-p-coumaryl)-glucoside, characterized in that, Includes the following steps: Using p-coumaryl-CoA as the acyl donor, and kaempferol-3- O Using glucosinolate as a substrate, an enzyme reaction system was constructed by adding the acyltransferase CsCFAT as described in claim 1, and a catalytic reaction was carried out to obtain kaempferol-3- O -(2'-p-coumaryl)-glucoside.

9. The method according to claim 8, characterized in that, The enzyme reaction system also includes 100 mM sodium phosphate buffer; the catalytic reaction is incubated at 40°C for 3-5 hours; after the catalytic reaction is completed, an equal volume of methanol is added to terminate the reaction, and the mixture is centrifuged at 4°C and 12000 rpm for 15 minutes. The supernatant is then collected to obtain the enzyme containing kaempferol-3- O The product liquid of -(2'-p-coumaryl)-glucoside.

10. A gene as described in claim 2 that can catalyze the synthesis of kaempferol-3- in vivo. O- Application of (2'-p-coumaryl)-glucoside in tea.

Images