SNP (Single Nucleotide Polymorphism) molecular marker related to silique number of rape and application of SNP molecular marker

By developing SNP molecular markers and primer pairs GT1_F and GT1_R related to the number of siliques in rapeseed, early screening of rapeseed with multiple siliques was achieved, solving the problem of slow breeding progress in existing technologies and improving breeding efficiency and accuracy.

CN121496094APending Publication Date: 2026-02-10GUIZHOU PROVINCIAL RAPE RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512005737.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-29
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently screen rapeseed germplasm with multiple horned fruits in the early stages, resulting in a slow and uncertain breeding process that affects the efficiency of high-yield rapeseed breeding.

Method used

SNP molecular markers related to the number of siliques in rapeseed were developed. PCR amplification was performed using primer pairs GT1_F and GT1_R. Rapeseed with the genotype TA at the SNP locus was detected as having a high number of siliques. A kit was designed for screening and identification.

Benefits of technology

Early screening using SNP molecular markers can significantly shorten the breeding selection cycle, improve breeding efficiency, reduce workload, improve the breeding process, and provide rapeseed variety resources with superior traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121496094A_ABST
    Figure CN121496094A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker related to the pod number of oilseed rape and application of the SNP molecular marker. The SNP molecular marker is located at the 106th site of a nucleotide sequence of SEQ ID NO.1, the SNP molecular marker is closely associated with the silique number of the rape, the SNP molecular marker is not limited by the growth stage of the rape and can be selected in the seedling stage, the breeding workload is greatly reduced, the breeding selection period of the rape is remarkably shortened, the breeding efficiency is improved, and the breeding process is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a SNP molecular marker related to the number of siliques in rapeseed and its application. Background Technology

[0002] Rapeseed yield is determined by three limiting factors: the number of siliques per plant, the number of seeds per silique, and the weight of 1000 seeds. Among these, the number of siliques per plant contributes the most to yield. Therefore, a thorough understanding of the genetic regulatory mechanisms of silique number formation in rapeseed is crucial for high-yield rapeseed breeding and ensuring food and oil security. The number of siliques per rapeseed plant is one of the core traits determining yield, controlled by multiple genes and easily influenced by the environment. SNPs (Single Nucleotide Polymorphisms) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, including single base transitions and transversions. Using SNP markers, breeders can screen individuals with superior genotypes at an early stage, accelerating the breeding process and reducing the uncertainty and time cost of traditional methods. Furthermore, SNP-assisted selection makes it possible to conduct in-depth analysis of the genetic basis of complex traits, thereby improving the accuracy and efficiency of breeding. Therefore, researching and developing SNP molecular markers significantly associated with the number of siliques in rapeseed has a significant promoting effect on marker-assisted breeding of rapeseed. Summary of the Invention

[0003] The present invention aims to overcome the shortcomings of the prior art by providing an SNP molecular marker related to the number of siliques in rapeseed and its application, which can screen germplasm with a large number of siliques at an early stage and will promote the breeding process of new varieties of silique-fruited rapeseed.

[0004] The technical solution of this invention is implemented as follows: The first aspect of the present invention is to provide an SNP molecular marker related to the number of pods in rapeseed, the nucleotide sequence of which is shown in SEQ ID No. 1, wherein the base at position 106 from the 5' end of the sequence shown in SEQ ID No. 1 is either T or A (it should be understood that "a" is used to represent position 106 from the 5' end of SEQ ID No. 1 in the sequence listing, only for the normal submission of the nucleotide sequence listing, and does not affect the relevant limitations of claim 1 and the specification of the present invention).

[0005] The inventors discovered that rapeseed with the TA genotype at the site of this SNP molecular marker is likely to have a significantly higher number of siliques than rapeseed with the TT genotype.

[0006] Based on the SNP molecular marker, a genotypic identification method for the number of pods in rapeseed can be developed. By analyzing the base sequence of the SNP site, the genotype of the SNP site is identified as TA, indicating that it is rapeseed with a large number of pods.

[0007] To perform the SNP molecular marker detection, a second aspect of the present invention is to provide a primer pair for detecting the SNP molecular marker described in the first aspect of the present invention, wherein the primer pair is GT1_F: 5'-CAAGGTTATGCTCCGAATGTCACA- 3' and primer GT1_R: 5'-AGAGTATCCATCTCGTTCGTCTTCT- 3'.

[0008] A third aspect of the present invention is to provide a kit for detecting the SNP molecular markers described in the first aspect of the present invention, comprising the primer pairs described in the second aspect of the present invention.

[0009] A fourth aspect of the present invention is to provide the application of SNP molecular markers as described in the first aspect of the present invention, or primer pairs as described in the second aspect of the present invention, or kits as described in the third aspect of the present invention in the early screening of rapeseed germplasm with a high number of horned fruits and / or in the cultivation of transgenic rapeseed.

[0010] The fifth aspect of the present invention is to provide a method for detecting the silique number trait of rapeseed: extracting genomic DNA from the rapeseed to be tested, using the genomic DNA of the rapeseed to be tested as a template, performing PCR amplification using the primer pair described in the second aspect of the present invention, analyzing the sequence of the PCR amplification product, performing the detection of the SNP molecular marker described in the first aspect of the present invention, determining the genotype of the rapeseed to be tested, thereby determining the silique number trait of the rapeseed to be tested.

[0011] When the genotype of the SNP molecular marker is TA, the rapeseed initially identified as having a high number of siliques.

[0012] The sixth aspect of this invention is to provide a method for breeding rapeseed: extracting genomic DNA from each rapeseed in a rapeseed population, using the obtained genomic DNA as a template, performing PCR amplification using the primer pair described in the second aspect of this invention, analyzing the sequence of the PCR amplification product, detecting the SNP molecular markers described in the first aspect of this invention, determining the genotype of each rapeseed, thereby determining the silique number trait of each rapeseed, and breeding rapeseed.

[0013] The seventh aspect of the present invention is to provide the application of SNP molecular markers as described in the first aspect of the present invention, primer pairs as described in the second aspect of the present invention, or kits as described in the third aspect of the present invention in rapeseed breeding.

[0014] The SNP molecular markers, primer pairs, or kits are used for the selection of rapeseed varieties, molecular marker-assisted breeding, detection of breeding materials, whole-genome selection breeding, or preparation of whole-genome breeding kits. Beneficial effects

[0015] This invention, for the first time at the big data level, identifies a SNP located at position 106 of the nucleotide sequence in SEQ ID NO.1 that is closely associated with the number of siliques in rapeseed. This SNP molecular marker is not limited by the rapeseed growth stage and can be selected during the seedling stage, greatly reducing the breeding workload, significantly shortening the rapeseed breeding selection cycle, improving breeding efficiency, and refining the breeding process. In practice, it is used for marker-assisted breeding for rapeseed variety improvement, cultivating transgenic rapeseed with superior traits, and providing candidate gene resources for rapeseed variety selection, marker-assisted breeding, testing breeding materials, whole-genome selection breeding, or preparing whole-genome breeding kits. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 The statistical distribution results of the population silique number trait.

[0018] Figure 2 Manhattan plot of SNP markers that are highly significantly correlated with the number of pods in rapeseed.

[0019] Figure 3 To compare the differences in silique number among different genotypes of SNP markers that are highly significantly associated with the number of siliques in rapeseed, the TA allele was significantly associated with the number of siliques, with P < 0.001. Detailed Implementation

[0020] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0021] Example 1

[0022] Based on genome-wide association analysis (GWAS), SNP loci significantly associated with silique number were identified. This population was constructed by hybridizing Zhongshuang 11 and multi-stemmed materials bred by our research group. Two hundred rapeseed accessions were selected as research materials and sown at the Weiyuan Experimental Base of the Guizhou Rapeseed Research Institute in Changshun County, where basic water and fertilizer conditions suitable for rapeseed growth were provided. Young leaf tissues were selected, and genomic DNA was extracted from rapeseed using a polysaccharide-polyphenol plant genomic DNA extraction kit (Tiangen). DNA samples with OD values ​​between 1.8 and 2.0 and a content of 1.5 μg or higher were used for library construction and sequencing. The raw sequencing data were filtered to obtain high-quality sequencing data (Q20 >= 90%, Q30 >= 85%) with GC content between 37% and 39%, which were used for subsequent analysis. High-quality sequencing data were aligned to the reference genome (NCBI_Assembly:GCF_020379485.1) using BWA software (v0.7.17, parameters: mem-t4-k32-M). The alignment results were then sorted and deduplicated using SAMTOOLS (v1.9).

[0023] SNPs (single nucleotide polymorphisms) mainly refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, including single base transitions and transversions. SAMPOOLS and other software were used to detect population SNPs in the samples. High-quality SNPs were obtained through the following filtering and screening: (1) Q20 quality control (SNPs with a quality value of Q20, i.e., a sequencing error rate greater than 1%, were filtered out); (2) Support number (coverage depth) of the variant site > 3; (3) The proportion of missing genotypes in the resequencing samples of the variant site <= 20%; (4) Minimum allele frequency (MAF) of the variant site > 0.05. Finally, ANNOVAR software was used for population SNP annotation to obtain the relative positions of variant sites and genes, and to detect whether the variant sites on the genes were non-synonymous mutations.

[0024] The number of siliques was counted on a whole rapeseed plant at the stage of silique development. Each sample was counted five times, and the average value was calculated. After accurately counting the number of siliques in each rapeseed sample (…), Figure 1 Association analysis of the silique number trait in the population was performed using a mixed linear model (MLM) in GEMMA. Potential candidate SNPs were screened based on the significance of the association (P-value < 0.05). The results showed that a GWAS signal (-log) significantly correlated with silique number existed at the 6.78 Mb position of contig NC_063452.1 of rapeseed. 10 ( P-value) = 5.78), the peak SNP is located at position 6,784,262 bp in contig NC_063452.1, in the promoter region of gene-LOC106364161 (dis = 1,017 bp) ( Figure 2 This gene encodes a plant-specific transcription factor family member, DOF zinc finger protein DOF5.8-like. Compared to the TT genotype, rapeseed containing the TA genotype had a significantly higher number of pods (Table 1). Figure 3 By selecting the TA genotype at this SNP locus (gene-LOC106364161:-1017), it is possible to quickly select or predict rapeseed materials with multiple siliques, thereby effectively selecting rapeseed siliques and accelerating the molecular design breeding process of rapeseed varieties with multiple siliques.

[0025] Table 1. Statistics on different genotypes and silique number of rapeseed at gene-LOC106364161:-1017

[0026] Note: Due to the filtering step, the total number of individuals at each site is ≤200.

[0027] The number of siliques was counted for the above samples. The genotypes of the samples with a particularly large number of siliques (greater than or equal to 400 per plant) were counted. Among the 64 samples with the TA genotype, 19 had the TA genotype, accounting for 29.69%, while only 18 of the 128 samples with the TT genotype had the TT genotype, accounting for 14.06%.

[0028] Example 2

[0029] Development of SNP markers for gene-LOC106364161:-1017 Based on the reference genome (NCBI_Assembly:GCF_020379485.1), a total of 324 bp sequences were extracted from the upstream and downstream sequences of the SNP locus (gene-LOC106364161:-1017) that is significantly associated with the number of rapeseed pods. Primers were designed using Primer 5 software, and PCR amplification was performed using primers GT1_F: 5'-CAAGGTTATGCTCCGAATGTCACA- 3' and primers GT1_R: 5'-AGAGTATCCATCTCGTTCGTCTTCT- 3'. The PCR reaction system consisted of 1 μl DNA template, 12.5 μl PCR mix, 1 μl forward primer, 1 μl reverse primer, and 9.5 μl ddH2O, for a total of 25 μl. The PCR reaction program was: 98℃ denaturation for 10 sec, 55℃ annealing for 5 sec, and 72℃ extension for 5 sec, for 30 cycles. The amplified product was recovered and sequenced to obtain the nucleotide sequence containing the above-mentioned SNP (gene-LOC106364161:-1017(T / A)) site, as shown in SEQ ID No. 1. The SNP site (named gene-LOC106364161:-1017) is located at the 106th bp position from the 5' end of the sequence shown in SEQ ID NO: 1. (It should be understood that the 106th bp position from the 5' end of SEQ ID No. 1 is represented by "a" in the sequence listing, only for the normal submission of the nucleotide sequence listing, and does not affect the relevant limitations of claim 1 and the specification of this invention).

[0030] The nucleotide sequence of the SNP (gene-LOC106364161:-1017) site is as follows: CAAGGTTATGCTCCGAATGTCACAATTTTCTGTCAATGGAAGACAGTATCATATGGCTTACTATCTCACCGATGGTATTTATCCGAAATGGGCAACTTTTATCCAA(T / A)CAATTTCTTTACCACAAGCGCCGAAAGCAGTTTTATTTGCTCAGCGTCAAGAAG CTGTCCGAAAAGATGTCGAGCGTGCTTTTGGAGTCTTGCAAGCTCGCTTTGCCATTGTTAAAAATCCGGTGCTCTTTTGGGATAAAGTTAAAATAGGGAAGATTATGAGAGCATGTATCATACTCCATAATATGATAGTAGAAGACGAACGAGATGGATACTCT A kit for screening or detecting the number of horned fruit rapeseed materials, the kit containing the above-mentioned specific primer pair GT1.

[0031] Primer GT1_F: 5'-CAAGGTTATGCTCCGAATGTCACA- 3' Primer GT1_R: 5'-AGAGTATCCATCTCGTTCGTCTTCT- 3' The instructions for using the kit include the following steps: 1) Extract DNA from the rapeseed sample to be tested; 2) GT1 was amplified by PCR using specific primers to obtain PCR products. The PCR reaction system consisted of 1 μl DNA template, 12.5 μl PCR mix, 1 μl forward primer, 1 μl reverse primer, and 9.5 μl ddH2O, for a total of 25 μl. The PCR reaction program was as follows: denaturation at 98℃ for 10 seconds, annealing at 55℃ for 5 seconds, extension at 72℃ for 5 seconds, for 30 cycles. 3) The PCR amplification products were detected by 1% agarose gel electrophoresis and then sequenced. The sequencing peak diagram was then examined to analyze the genotype of the cassava samples. When the PCR product showed a single T peak at position 106 bp, the sample was of the TT genotype; when the PCR product showed a double TA peak at position 106 bp, the sample was of the TA genotype. Therefore, the TA genotype sample was a horned rapeseed material.

[0032] Example 3: Screening or detection of rapeseed germplasm with multiple horned fruits Seventy-four rapeseed samples were randomly selected from the rapeseed planting area of ​​the Weiyuan Experimental Base in Changshun County, Guizhou Province, and genotyping and silique count were performed after sequencing. The specific procedures are as follows: 1) Extract DNA from the rapeseed sample to be tested; 2) GT1 was amplified by PCR using specific primers to obtain PCR products. The PCR reaction system consisted of 1 μl DNA template, 12.5 μl PCR mix, 1 μl forward primer, 1 μl reverse primer, and 9.5 μl ddH2O, for a total of 25 μl. The PCR reaction program was as follows: denaturation at 98℃ for 10 seconds, annealing at 55℃ for 5 seconds, extension at 72℃ for 5 seconds, for 30 cycles. 3) The PCR amplification products were detected by 1% agarose gel electrophoresis and then sequenced. The sequencing peak diagram was then examined to analyze the genotype of the cassava samples. Specifically, when the PCR product showed a single T peak at position 106 bp, the sample was of the TT genotype; when the PCR product showed a double TA peak at position 106 bp, the sample was of the TA genotype.

[0033] The detection results of the rapeseed samples are shown in Tables 2 and 3. It can be seen that the SNP molecular markers of this invention have a high accuracy rate in identifying rapeseed with multiple siliques. The number of siliques in rapeseed samples with the TA genotype is generally higher than that in rapeseed samples with the TT genotype. That is, the A allele of the SNP locus (gene-LOC106364161:-1017) is highly significantly correlated with the number of siliques in rapeseed. By selecting the TA genotype at this SNP locus, rapeseed materials with multiple siliques can be quickly selected or predicted, thereby effectively selecting rapeseed with multiple siliques and accelerating the molecular design breeding process for rapeseed varieties with multiple siliques.

[0034] Table 2. Genotypes and silique number of the rapeseed samples at the SNP locus (gene-LOC106364161:-1017). Germplasm number Number of siliques (per plant) Genotype Germplasm number Number of siliques (per plant) Genotype Z_4 436 TA Z_89 290 TT Z_22 353 TA Z_91 237 TT Z_24 470 TA Z_97 422 TT Z_27 342 TA Z_100 298 TT Z_42 403 TA Z_101 290 TT Z_47 376 TA Z_103 277 TT Z_49 341 TA Z_108 284 TT Z_51 504 TA Z_124 282 TT Z_68 342 TA Z_128 252 TT Z_69 390 TA Z_139 305 TT Z_78 356 TA Z_151 248 TT Z_93 364 TA Z_152 253 TT Z_102 396 TA Z_157 269 TT Z_109 353 TA Z_161 283 TT Z_126 353 TA Z_162 239 TT Z_138 353 TA Z_174 324 TT Z_145 364 TA Z_177 302 TT Z_147 365 Z_178 311 TA Z_165 368 TT Z_189 231 TA Z_166 330 TT Z_193 287 TA Z_173 329 TT Z_195 278 TA Z_183 461 TT Z_201 216 TA Z_191 385 TT Z_202 287 TA Z_210 400 TT Z_220 262 TA Z_236 330 TT Z_221 278 TA Z_248 335 TT Z_232 281 TA Z_256 344 TT Z_234 247 TA Z_264 383 TT Z_237 277 TA Z_270 413 TT Z_244 254 TA Z_275 459 TT Z_253 172 TA Z_3 212 TT Z_261 222 TT Z_11 278 TT Z_274 244 TT Z_41 279 TT Z_276 276 TT Z_50 293 TT Z_283 291 TT Z_64 277 TT Z_287 292 TT Z_85 242 TT Z_295 273 TT Z_86 207 TT Z_300 284 TT Table 3. Genotypes and silique number of the rapeseed samples at the SNP locus (gene-LOC106364161:-1017). TT Genotype Average number of siliques (per plant) 380 TA TT 271 The specific embodiments of the present invention have been described in detail above, but they are merely examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A SNP molecular marker related to the number of siliques in rapeseed, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID No. 1, and the base at position 106 from the 5' end of the sequence shown in SEQ ID No. 1 is T or A.

2. The SNP molecular marker as described in claim 1, characterized in that, The genotype of the SNP locus is TA, which is a horned fruit number rapeseed.

3. A primer pair for detecting the SNP molecular marker of claim 1, characterized in that, The primer pair is GT1_F: 5'-CAAGGTTATGCTCCGAATGTCACA- 3' and primer GT1_R: 5'-AGAGTATCCATCTCGTTCGTCTTCT- 3'.

4. A kit for detecting the SNP molecular marker of claim 1, comprising the primer pair of claim 2.

5. The application of the SNP molecular marker as described in claim 1, or the primer pair as described in claim 2, or the kit as described in claim 3 in the early screening of rapeseed germplasm with a high number of horned fruits and / or in the cultivation of transgenic rapeseed.

6. A method for detecting the number of pods in rapeseed, characterized in that, Includes the following steps: Genomic DNA was extracted from the rapeseed to be tested. Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2. The sequence of the PCR amplification product was analyzed, and the SNP molecular marker described in claim 1 was detected to determine the genotype of the rapeseed to be tested, thereby determining the silique number trait of the rapeseed to be tested.

7. The method as described in claim 6, characterized in that, When the genotype of the SNP molecular marker is TA, the rapeseed initially identified as having a high number of siliques.

8. A method for breeding rapeseed, characterized in that, Includes the following steps: Genomic DNA was extracted from each rapeseed in the candidate rapeseed population. Using the obtained genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2. The sequence of the PCR amplification product was analyzed, and the SNP molecular markers described in claim 1 were detected to determine the genotype of each candidate rapeseed, thereby determining the silique number trait of each candidate rapeseed and selecting rapeseed for breeding.

9. The application of the SNP molecular marker as described in claim 1, or the primer pair as described in claim 2, or the kit as described in claim 3 in rapeseed breeding.

10. The application as described in claim 9, characterized in that, The SNP molecular markers, primer pairs, or kits are used for the selection of rapeseed varieties, molecular marker-assisted breeding, detection of breeding materials, whole-genome selection breeding, or preparation of whole-genome breeding kits.