Chimeric antigen receptor expression regulated by riboswitch

Abstract

The present disclosure relates to riboswitches and polynucleotide cassettes that modulate the expression of chimeric antigen receptors (CARs) in response to small molecule ligands, wherein the polynucleotide cassettes comprise the riboswitches and aptamers disclosed herein. Also provided are methods for generating a population of T cells wherein the T cells comprise a CAR transgene comprising an expression construct that inductively expresses a CAR in response to a small molecule inducer that binds to a riboswitch aptamer, which is part of the expression construct. Also provided are methods for treating cancer by administering to a patient in need thereof: (i) a population of T cells comprising an induced CAR comprising the riboswitch described herein; and (ii) a small molecule inducer (aptamer ligand) disclosed herein.

Description

[0001] References to sequence lists This application contains a sequence list, which has been submitted electronically in XML format and is hereby incorporated herein by reference in its entirety. The XML copy was created on July 31, 2024, named SeqList-162027-53576.xml, and has a size of 830,164 bytes. Technical Field

[0002] This disclosure relates to riboswitches and polynucleotide cassettes that regulate chimeric antigen receptor (CAR) expression in response to small molecule ligands, wherein the polynucleotide cassettes comprise the riboswitches and / or aptamers disclosed herein. A method for generating a population of T cells comprising an expression construct that induces expression of the CAR in response to a small molecule inducer binding to the riboswitch aptamer is also provided. A method for treating cancer is also provided, the method being performed by administering to a patient in need: (i) a population of T cells comprising the inducible CAR, the inducible CAR comprising the riboswitches disclosed herein; and (ii) the small molecule inducers (aptamer ligands) disclosed herein. Background Technology

[0003] Chimeric antigen receptor (CAR) T cells are genetically engineered T cells that have been modified to express receptors that recognize specific surface markers, such as those expressed on the surface of cancer cells. Because CARs are expressed on the surface of T cells, CAR T cells acquire supraphysiological properties and function as "living drugs," exhibiting immediate and stable effects. Summary of the Invention

[0004] On one hand, this disclosure provides a composition comprising an immune cell population (e.g., a T cell population) capable of expressing a chimeric antigen receptor (CAR) in response to the presence of a small molecule inducer (ligand), wherein the T cells in the T cell population comprise a polynucleotide comprising: (i) The first sequence encoding the chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) an alternative splicing exon flanked by a 5' intron and a 3' intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer attached to an effector region, the effector region comprising a stem-forming sequence comprising a 5' splice site sequence of the 3' intron and a sequence complementary to the 5' splice site sequence of the 3' intron; The second sequence is inserted into the first sequence.

[0005] On the one hand, a population of T cells comprising a polynucleotide construct containing a sequence encoding the following from 5' to 3': (a) First intron; (b) Alternative splicing exons; and (c) A second intron comprising a riboswitch, wherein the riboswitch comprises an effector region and an aptamer, wherein the riboswitch comprises from 5' to 3': (i) a 5' splice site sequence of the second intron; (ii) an aptamer sequence; and (iii) a sequence complementary to the 5' splice site sequence of the second intron; The 5' splice site sequence of the second intron and the sequence complementary to the 5' splice site sequence of the second intron can form a stem; The alternative splicing exon contains a stop codon. When the alternative splicing exon is spliced ​​into the CAR gene mRNA, the stop codon is in the same frame as the CAR gene, forming the polynucleotide construct.

[0006] In some implementations, the T cells in the T cell population have one or more of the following characteristics: (a) More than 30%, more than 35%, more than 40%, more than 45%, or more than 50% of the T cells in the T cell population have an immature phenotype; (b) Less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the T cell population have a differentiated phenotype; (c) Less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the T cell population are CD45RA. – and / or CD62L – ; (d) Less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the T cell population are exhausted T cells; (e) Enhanced cytotoxicity against cancer cells expressing the CAR antigen compared to T cells constitutively expressing the CAR; (f) Compared with T cells constitutively expressing the CAR, cytokine production is reduced when exposed to cancer cells expressing the CAR antigen; (g) Enhanced ability to expand in response to exposure to the CAR antigen compared to T cells constitutively expressing the CAR; and / or (h) Compared with T cells that constitutively express the CAR, the level of T cell exhaustion is reduced after exposure to the CAR antigen.

[0007] In some embodiments, the T cells in the T cell population have one or more of the following characteristics: more than about 30%; more than about 35%; more than about 40%; more than about 45%; or more than about 50% of the T cells in the T cell population are CD62L. + CD45RA + CCR7 + CD127 + Or CD132 + , or any combination thereof.

[0008] In some embodiments, the T cells in the T cell population have one or more of the following characteristics: more than about 30%; more than about 35%; more than about 40%; more than about 45%; or more than about 50% of the T cells in the T cell population are CD62L. + and / or CD45RA + .

[0009] In some implementations, the T cells in the T cell population have one or more of the following characteristics: more than about 30%; more than about 35%; more than about 40%; more than about 45%; or more than about 50% of the T cells in the T cell population are CD62L. + .

[0010] In some implementations, the T cells in the T cell population have one or more of the following characteristics: less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the T cell population have a differentiation phenotype effector memory or effector cell type.

[0011] In some implementations, exhausted T cells are CD39. + PD-1 + CTLA-4 + LAG-3 + TIM-3 + 2B4 / CD244 / SLAMF4 + CD160 + Or TIGIT + , or any combination thereof.

[0012] In one implementation, exhausted T cells are CD39. + .

[0013] In some implementations, reduced cytokine production refers to the production of TNFα, IL-2, IFNγ, or combinations thereof.

[0014] In the implementation scheme, a population of T cells obtained from a subject and engineered to express the CAR gene in response to a small molecule inducer (due to the incorporation of the gene regulatory cassette disclosed herein into the CAR gene) has a phenotype similar to that of a population of T cells obtained from the same subject and not engineered to express the CAR (e.g., a control T cell population obtained from the same patient). In the implementation scheme, the above-listed characteristics of the T cells (containing the inducible CAR disclosed herein) in the population are within approximately 5%, approximately 10%, approximately 15%, approximately 20%, or approximately 25% of those characteristics of the T cell population derived from the same patient (not engineered to contain the CAR gene). The percentage of T cells expressing cell surface markers disclosed herein can be measured using known techniques, including staining the markers with marker-specific antibodies followed by fluorescence activated cell sorting (FACS).

[0015] In some implementations, a multinucleotide sequence containing the first and second sequences is present in the T cell receptor (TCR) α constant chain (TRAC) locus of T cells.

[0016] A method is provided for preparing a composition comprising the T cell population described herein, the method comprising: (a) Obtaining a T cell population; (b) Introducing a polynucleotide into T cells in the population, the polynucleotide comprising: (i) The first sequence encoding the chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) an alternative splicing exon flanked by a 5' intron and a 3' intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer attached to an effector region, the effector region comprising a stem-forming sequence comprising a 5' splice site sequence of the 3' intron and a sequence complementary to the 5' splice site sequence of the 3' intron; The second sequence is inserted into the first sequence; and (c) Expand the T cells in the culture.

[0017] In one implementation, the aptamer binds to a small molecule ligand (including the small molecule ligands disclosed herein).

[0018] In the implementation scheme, an aptamer is or includes the aptamer sequence disclosed herein.

[0019] In some implementations, the 5' splice site sequence of the 3' intron includes GTGAGT, GTAAGC, GTAAGT, GGTTGG, or GTAGT, where N represents A, G, C, or T.

[0020] In some implementations, the 5' splice site sequence of the 3' intron contains GTAAGT, GTGAGT, or GTAATG.

[0021] In one implementation, the 5' splice site sequence of the 3' intron contains GTAATG.

[0022] In some implementations, the alternative splicing exon (a) is derived from exon 2 of the human dihydrofolate reductase gene, exon 5 of the human Wilms tumor 1 gene, exon 16 of the mouse calcium / calmodulin-dependent protein kinase II δ, or exon 6 of SIRT1; or (b) is synthetic.

[0023] In one implementation, the alternative splicing exon is modified exon 2 from human DHFR.

[0024] In some implementations, the alternative splicing exon contains SEQ ID NO: 590 or 591.

[0025] In some implementations, the alternative splicing exons have been modified by one or more of the following methods: altering the sequence of exon splicing enhancers, altering the sequence of exon splicing silencers, adding exon splicing enhancers, and adding exon splicing silencers.

[0026] In one embodiment, the variable exon contains a stop codon and is framed with the CAR gene. In another embodiment, in addition to or as a substitute for the stop codon, the variable exon contains another sequence that, when the variable exon is incorporated into the CAR gene mRNA via splicing, reduces or substantially prevents translation, including, for example, a microRNA binding site, thereby causing mRNA degradation.

[0027] In one implementation, the 5' intron contains a stop codon that is in the same frame as the target gene.

[0028] In some implementations, the 5' intron and the 3' intron (a) are derived from endogenous introns of the target gene; (b) are exogenous to the target gene; and (c) are derived from intron 2 of the human β-globin gene.

[0029] In one implementation, the 5' intron and the 3' intron are each independently about 50 to about 300 nucleotides long.

[0030] In one implementation, the 5' intron and the 3' intron are each independently about 125 to about 240 nucleotides long.

[0031] In one implementation, the stem-forming sequence is 6 to 13 base pairs long.

[0032] In one implementation, the stem-forming sequence is 7 to 12 base pairs long.

[0033] In one embodiment, the stem-forming sequence is 8 to 11 base pairs long. In another embodiment, the stem-forming sequence is 7 to 12 base pairs long.

[0034] In one embodiment of the method provided herein, the step of expanding T cells in a culture is performed in the absence of small molecule ligands.

[0035] A method for treating cancer is provided, the method being carried out by administering to a subject in need of: (i) a composition comprising the T cell population disclosed herein; and (ii) a composition comprising a small molecule ligand that binds to an aptamer.

[0036] In one embodiment, the composition comprising a T-cell population and a small molecule ligand is administered simultaneously.

[0037] In one embodiment, the composition comprising a T-cell population and a small molecule ligand is administered sequentially.

[0038] In one implementation, the subject is a human being.

[0039] In some implementations, the aptamer comprises a sequence that is at least 90% identical to any of SEQ ID NO: 1 or 7-588.

[0040] In some implementations, the aptamer comprises a sequence that is at least 95% identical to any of SEQ ID NO: 1 or 7-588.

[0041] In some implementations, the aptamer comprises any one of SEQ ID NO:1 or 7-588.

[0042] In some embodiments, the small molecule inducer is selected from compounds according to any one of formulas I–XXII.

[0043] In some embodiments, the small molecule inducer is selected from any of compounds 001-185 or any of the compounds in paragraph

[307] . Attached Figure Description

[0044] Figure 1A and 1B : Figure 1A A schematic diagram of a gene regulation cassette is provided, which includes a riboswitch located in an intron-variable exon-aptamer-intron background (in this example, in a luciferase gene background). Figure 1B Schematic diagrams of RiboCAR (CAR coding sequence containing the gene regulatory cassette disclosed herein) and ConstCAR (CAR constitutively expressed) are provided. Luci = luciferase. mtDHFR = modified dihydrofolate reductase exon 2 sequence.

[0045] Figure 2A and 2B : Figure 2A The expression of CAR (“RiboCAR”) in HEK 293 cells in response to the small molecule inducer compound 004 is shown compared to constitutively expressed CAR (“ConstCAR”), where the CAR coding sequence contains a gene regulatory cassette. See the construct configuration below. Figure 1B . Figure 2B The expression of CAR (“RiboCAR”) in HEK 293 cells in response to the small molecule inducer compound 004 is shown compared to background (HEK 293 cells without the CAR expression construct). The CAR coding sequence contains a gene regulatory cassette. MIF = mean fluorescence intensity.

[0046] Figure 3A and 3B : Figure 3A and 3B This study illustrates the expression of the CAR (RiboCAR-9) gene regulatory cassette-coding sequence in HEK 293 cells in response to increasing concentrations of the small molecule inducer compound 004. HEK 293 cells were transfected with the specified CAR construct and treated with the listed concentrations of the small molecule inducer compound 004. Forty-eight hours post-transfection, cells were stained with anti-FMC63 antibody, and CAR expression was measured by flow cytometry. No CAR expression of the RiboCAR-9 construct was detected in the absence of the inducer. CAR expression increased in a dose-dependent manner in the presence of increasing inducer concentrations.

[0047] Figure 4A , 4B 4C, 4D, and 4E: Figure 4A and 4B The expression of CARs on the surface of Jurkat cells transfected with the RiboCAR-9 construct in response to a variety of small molecule inducers disclosed herein is shown. Figure 4C , 4D Figure 4E illustrates CAR expression on the surface of Jurkat cells with RiboCAR-9 or ConstCAR expression cassettes knocked into the TRAC locus. Treatment with compound 004 induced stable CAR expression on the surface of Jurkat cells in a dose-dependent manner. Figure 4CRemoving the small molecule inducer caused a rapid decrease in CAR expression on the cell surface. Figure 4D and 4E This indicates that the small molecule compounds disclosed in this paper regulate the inducibility and reversibility of CAR expression through riboswitch.

[0048] Figure 5A and 5B : Expression of CAR on the surface of primary T cells with RiboCAR (construct RiboCAR-9) or ConstCAR knocked into the TRAC locus. In the absence of the riboswitching inducer compound 004, no CAR was detected on the cell surface of RiboCAR-T cells. However, in the presence of compound 004, RiboCAR-T cells robustly expressed CAR on their cell surface. Figure 5A and 5B ), and CAR expression levels increase in response to increasing concentrations of the inducer. Figure 5B ).

[0049] Figure 6A and 6B : Figure 6A The results showed that T cells generated by knocking in the RiboCAR expression cassette (construct RiboCAR-9) into the TRAC locus in the absence of an inducer (i.e., CAR gene expression is turned off) had a higher proportion of L-selectin. + (CD62L + RiboCAR cells (markers of naive T cells and stem cell-like memory T cells), comprising approximately 52% of the population (untreated with compound 004), were essentially identical to T cells (mock T cells) that had not received the CAR expression cassette. Even after treatment with compound 004, CD62L in RiboCAR T cells... + The proportion of cells remains high, similar to that of T cells. Therefore, RiboCAR T cells mainly consist of naive T cells and stem cell-like memory T cells (naive / Tscm cells). Furthermore, approximately 17% of the cells in the RiboCAR T cell population are CD45RA. – CD62L – The cells mainly consist of effector memory T cells. In contrast, T cells engineered with ConstCAR show a higher degree of differentiation, with CD45A being more abundant. + CD62L + The proportion of cells was significantly lower (approximately 11%), while CD45RA... – CD62L – The proportion of cells was significantly higher (approximately 47%), and these cells were mainly effector memory T cells with a higher degree of differentiation. Figure 6BThe results showed that the ConstCAR T cell population contained a high proportion of T cells expressing CD39 (48%), CD39 being a marker of exhausted T cells that suppress T cell function. Only a small fraction (approximately 14% to 16%) of RiboCAR-T cells or T-mimicking cells expressed CD39.

[0050] Figure 7A , 7B 7C and 7D: Figure 7A The results showed that in the absence of a riboswitching inducer, RiboCAR-T cells (constructed RiboCAR-9) did not exhibit cytotoxic activity against target Raji-ffLuc cells, while in the presence of the riboswitching inducer compound 004, RiboCAR-T cells induced robust tumor cell lysis in a dose-dependent manner. In contrast, ConstCAR-T cells exhibited cytotoxic activity regardless of the presence of a riboswitching inducer, but their target cell killing activity was lower (approximately 20%) compared to RiboCAR-T cells treated with the riboswitching inducer compound 004. Figure 7B and 7C The results showed that RiboCAR-T cells produced the cytokines IL-2 and IFNγ in the co-existence of tumor antigens and riboswitching inducers, and the cytokine release levels increased in response to higher concentrations of the riboswitching inducer compound 004. Notably, the IL-2 and IFNγ levels produced by RiboCAR-T cells treated with compound 004 were significantly lower than the cytokine levels released by ConstCAR-T cells. Figure 7D The expansion of RiboCAR-T cells and ConstCAR-T cells in response to antigen stimulation was shown. After three rounds of antigen stimulation, RiboCAR-T cells expanded by approximately 218-fold, while ConstCAR-T cells were exhausted after the third round of antigen stimulation.

[0051] Figure 8A and 8B RiboCAR-T cells outperform ConstCAR-T cells in in vivo anti-tumor efficacy. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) 6 10 Raji-ffLuc cells were injected into NSG mice via tail vein injection, and 4 days later, the mice were orally administered a riboswitch small molecule inducer, followed by an injection of 2×10⁻⁶ cells 4 hours later. 6 CAR-T cells. For example Figure 8AAs shown, in these lymphoma mice, 7 days after CAR-T cell injection, mice injected with ConstCAR-T cells exhibited less tumor growth compared to mice injected with control mimic T cells or RiboCAR-T (constructed RiboCAR-9) cells not treated with a riboswitch inducer. However, in mice injected with the same number of RiboCAR-T cells but treated with the small molecule inducer compound 004, the tumor burden was even lower than in mice injected with ConstCAR-T cells. Furthermore, prolonged survival was observed in mice receiving RiboCAR-T cells and administering the small molecule inducer. Figure 8B ).

[0052] Figure 9A , 9B 9C, 9D, 9E, and 9F: Riboswitching inducers remotely modulate the in vivo antitumor efficacy of RiboCAR-T cells in a dose-dependent manner. Figure 9A The results showed the effects of NOD / SCID / IL2Rγ - / - Results of an experiment involving the injection of Raji-ffLuc cells into (NSG) mice. Three days after Raji cell implantation, mice were administered a mediator or a small molecule inducer at 30 mg / kg or 100 mg / kg via oral feeding once daily. Sixteen hours after the first administration of the inducer, the CAR was... + RiboCAR-T cells (constructed RiboCAR-9) were intravenously infused into mice carrying Raji cells. Tumor progression or regression was monitored using bioluminescence imaging. Figure 9B , 9C Figures 9D, 9E, and 9F show the quantitative results of bioluminescence (each line represents the result for one animal). Figure 9B The results of mice treated with mimic T cells and ConstCAR T cells are shown. Figure 9C and 9E The results of mice treated with RiboCAR-T cells and a specified dose of the small molecule inducer compound 004 are shown. Figure 9D and 9F The results are shown in mice treated with RiboCAR-T cells and a specified dose of the small molecule inducer compound 111.

[0053] Figure 10Treatment with RiboCAR-T cells and a small molecule inducer prolonged the survival of tumor-bearing mice (constructed RiboCAR-9). Endpoints, from longest to shortest, were: RiboCAR-T cells + 100 mg / kg compound 111; RiboCAR-T cells + 100 mg / kg compound 004; RiboCAR-T cells + 30 mg / kg compound 004; RiboCAR-T cells + 30 mg / kg compound 111; ConstCAR + 100 mg / kg compound 004; RiboCAR-T cells (without small molecule inducer).

[0054] Figure 11 The RiboCAR construct can induce and reversibly express anti-HER2 CAR. The CAR gene containing the gene regulatory cassette was generated as described in Example 7, and the cell surface expression of the anti-HER2-CAR molecule in response to treatment with a specified dose of the riboswitching small molecule inducer compound 004 (MXU-001) was tested in HEK 293 cells. MXU-001 concentrations from left to right were: 0 µM; 0.013 µM; 0.309 µM; 0.926 µM; 2.778 µM; 8.333 µM; 25 µM. "HER-CAR-A6" = HER-RiboCAR-A; "HER-CAR-B6" = HER-RiboCAR-B; etc. HER2-CAR = cells constitutively expressing HER2 CAR (ConstCAR).

[0055] Figure 12A , 12B 12C, 12D, 12E, and 12F: RiboCAR-T cells targeting HER2 are more cytotoxic to tumor cells than T cells constitutively expressing HER2 CAR. Figure 12A The expression of HER2 CAR on the cell surface of primary T cells (constructed HER2 CAR-D) is shown. RiboCAR-T cells were treated with 25 µM compound 004 for 20 hours, with or without CAR gene targeting, three days later to induce CAR expression. The x-axis shows HER2 expression. Figure 12B The results showed that, compared with ConstCAR-T cells, RiboCAR-T cells were more robustly activated by the HER2 antigen on target Calu-3 cells in the presence of inducer compound 111 (also known as M310). Figure 12C This demonstrates the interaction of RiboCAR-T or ConstCAR-T cells with HER2 in the absence or with different concentrations of compound 111. +Target cell viability in Calu-3 cells co-cultured for 48 hours at an effector-to-target cell ratio of 2:1 (E:T ratio). Figure 12D This study compares the cytotoxic activity (tumor cell lysis) of RiboCAR-T cells with that of ConstCAR-T cells. Figure 12E Showing with Figure 12C Similar results were obtained from experiments with different E:T ratios. Figure 12F This study compares antigen-induced IFN-γ secretion induced by RiboCAR-T cells with that induced by ConstCAR-T cells.

[0056] Figure 13A and 13B The results show that small molecule inducers can remotely regulate the targeting of HER2. + In vivo antitumor activity of RiboCAR-T cells in tumors. 2.5 × 10⁻⁶ 6 Calu-3 cells were subcutaneously injected into NSG mice, and the mice were orally administered 300 mg / kg of either the ribo-switching small molecule inducer MXU-001 or M310 daily. The first dose was administered by injecting 2 × 10⁻⁶ cells into each mouse. 6 Administer ConstCAR-T or RiboCAR-T cells (constructed HER2 CAR-D) 6 hours prior to administration. Figure 13A The tumor volume is displayed. The traces from top to bottom (by endpoint) are: simulated T cells; RiboCAR without inducer; ConstCAR T cells; RiboCAR + 300 mg / kg MXU-001; RiboCAR + 300 mg / kg M310. Figure 13B Tumor growth is shown as a percentage (%). Trajectories from top to bottom (by endpoint) are: simulated T cells; RiboCAR without inducer; ConstCAR T cells; RiboCAR + 300 mg / kg MXU-001; RiboCAR + 300 mg / kg M310. Detailed Implementation

[0057] Chimeric antigen receptor (CAR)-T cell therapy is a promising treatment for certain cancers. However, mounting evidence confirms that the level and timing of CAR molecule expression are crucial for CAR-T cell activation, persistence, and anti-cancer activity. This disclosure provides a system capable of inducibly expressing any CAR (referred to herein as "RiboCAR") in response to a small molecule inducer. The disclosed system allows for precise control of CAR expression. Unlike previously reported tunable CAR platforms utilizing viral proteases or chemically induced protein dimerization, RiboCAR contains a synthetic mammalian ON riboswitch in the coding sequence of the CAR transgene, where the aptamer portion of the riboswitch functions as a sensor for a specific small molecule inducer. The expression level of the CAR gene depends on the level of the small molecule inducer (aptamer ligand). In the absence of the small molecule inducer, the CAR is undetectable, and the CAR level exhibits a precise dose-response with increasing dose of the small molecule inducer, reaching a level higher than constitutively expressed CAR at the point where the small molecule inducer is at its maximum. Upon withdrawal of the small molecule inducer, induced CAR expression decreases. T cells containing the RiboCAR expression cassette, when exposed to a small molecule inducer, not only induce CAR molecule expression, but T cell activity is also controlled by the small molecule inducer. Furthermore, compared to T cells constitutively expressing CAR, T cells expanded in the absence of the small molecule inducer R exhibit enhanced target-cell-stimulated T cell activation, reduced T cell exhaustion markers, and higher cytotoxicity upon induction. CAR levels can be modulated to optimal levels and can be switched on and off depending on the presence or absence of the small molecule inducer. Using bioavailable small molecule inducers, CAR-T activity can be precisely tuned and controlled in vivo. This precise control of CAR levels and its impact on CAR-T cell activity and persistence provides a system that significantly enhances the efficacy of CAR-T cell therapy, in contrast to current CAR-T systems with constitutively active CAR expression. This article provides expression constructs and vectors containing any of the sequences disclosed in Tables 2-6.

[0058] Chimeric antigen receptor The aptamers and gene regulatory cassettes disclosed herein can be used to regulate the expression of any target gene capable of being expressed in target cells, tissues, or organisms. The term "target gene" refers to a polynucleotide that is introduced into a cell and can be transcribed into RNA and translated and / or expressed under appropriate conditions.

[0059] As disclosed herein, the aptamers and gene regulatory cassettes presented herein are used to regulate the expression of immune cells, more specifically, chimeric antigen receptors (CARs) in T cells. CARs are receptor mimics containing an extracellular single-stranded variable fragment (scFv), a transmembrane domain, and an intracellular immune receptor tyrosine activation motif (ITAM) region associated with co-stimulatory signals.

[0060] First-generation CAR T cells contain an intracellular domain derived from the TCR CD3ζ chain, which can induce cytotoxicity of T cells against target cancer cells. However, they do not promote the proliferation of CAR T cells in vivo after re-infusion of engineered T cells. Second- and third-generation CAR T cells contain additional co-stimulatory intracellular domains, including CD28 or 4BB in second-generation CARs, and a second co-stimulatory domain fused to CD3ζ added in third-generation CARs. These additions enhance the potential for CAR T cell growth, proliferation, and persistence in patients.

[0061] In some implementations, the CAR T cells disclosed herein are engineered to express CARs that recognize cancer antigens. Non-limiting examples of cancer antigens include CD19, CD20, CD30, CD33, CD38, CD133, BCMA, TEM8, EpCAM, ROR1, folate receptor, CD70, MAGE-1, MAGE-2, MAGE-3, and MAGE... A-10, MAGE-C2, MAGE-A12, CEA, Tyrosinase, Midkin, BAGE, CASP-8, β-catenin, CA-125, CDK-1, ESO-1, gp75, gp100, MART-1, MUC-1, MUM-1, p53, PAP, PSA, PSMA, ras, trp-1, HER-2, TRP-1, TRP-2, IL13Rα, IL13Rα2, AIM-2, AIM-3, NY-ESO-1, C9orf112, SART1, SART2, SART3, BRAP RTN4, GLEA2, TNKS2, KIAA0376, ING4, HSPH1, C13orf24, RBPSUH, C6orf153, NKTR, NSEP1, U2AF1L, CYNL2, TPRGOLGA, BMI1, COX-2, EGFRvIII, EZH2, LICAM, Livin, Livin β, MRP-3, Nestin, OLIG2, ART1, ART4, B-cyclin, Gli1, Cav-1, cathepsin B, CD74, E-cadherin, EphA2 / Eck, Fra-1 / Fosl 1. GAGE-1, gangliosides / GD2, GnT-V, β1, 6-N, Ki67, Ku70 / 80, PROX1, PSCA, SOX10, SOX11, Survivin, βhCG, WT1, mesothelin, melan-A, NY-BR-1, NY-CO-58, MN (gp250), telomerase, SSX-2, PRAME, PLK1, VEGF-A, VEGFR2, and Tie-2. In some embodiments, the CAR-T cells disclosed herein are engineered to express multiple antigen recognition receptors to recognize one or more antigens.

[0062] In some embodiments, the CAR-T cells disclosed herein are further engineered to secrete therapeutic transgenes, including but not limited to IL-2, IL-2 mutant protein, IL-15, CD40L, IL-33 and IL-12, or variants thereof.

[0063] In some embodiments, the CAR-T cells disclosed herein are engineered to express proteins that inhibit, block, or antagonize the interactions of immunosuppressive peptides and / or their ligands. Immunosuppressive peptides inhibit or reduce immune responses by binding and include CD47, PD-1, CTLA-4, and their corresponding ligands, including SIRPα, PD-L1, PD-L2, B7-1, B7-2, and TIGIT. These peptides are present in the tumor microenvironment and suppress immune responses against tumor cells.

[0064] In some embodiments, the CAR-T cells disclosed herein are engineered to express a PD-1 variant (PD-1 decoy) designed to compete with endogenous PD-1. In some embodiments, the PD-1 decoy lacks the cytoplasmic domains of PD-1. In some embodiments, the PD-1 transmembrane and intracellular signaling domains in the PD-1 decoy are replaced by the co-stimulatory signaling domain of CD28 or a constitutively active IL-7 receptor to translate potential inhibitory signals into improved T cell function.

[0065] Variable splice ribose switch Riboswitches are regulatory segments of RNA polynucleotides that regulate the stability of RNA polynucleotides and / or the production of proteins from RNA polynucleotides in response to the presence or absence of aptamer-specific ligand molecules. In embodiments, riboswitches comprise a sensing region (e.g., an aptamer region) and an effector region, which together are responsible for sensing the presence of ligands (e.g., small molecules) and causing an increase or decrease in the expression of a target gene. The riboswitches described herein are recombinant, utilizing polynucleotides from two or more sources.

[0066] This paper provides a method for regulating CAR expression by inserting a polynucleotide cassette into a CAR gene containing a sequence encoding an alternative splicing riboswitch as described herein. The alternative splicing riboswitch comprises an alternative splicing exon flanked by 5' and 3' introns, and a riboswitch containing an aptamer (e.g., the aptamer disclosed herein). The aptamer described herein is encoded as part of a gene regulatory cassette to regulate CAR expression via alternative splicing of the resulting RNA (e.g., precursor mRNA) mediated by the aptamer / ligand. In this context, the gene regulatory cassette contains a riboswitch comprising a sensing region (e.g., the aptamer described herein) and an effector region, which together are responsible for sensing the presence of small molecule ligands and altering the splicing of the alternative exon. Splicing is the process of removing intron sequences from nascent precursor messenger RNA (precursor mRNA) and joining exons together to form mRNA. Splice sites are the junctions between exons and introns, defined by distinct shared sequences at the 5' and 3' ends of the intron (i.e., the splice donor and acceptor sites, respectively). Splicing occurs through a multicomponent structure called the spliceosome, a collection of small nuclear ribonucleoproteins (snRNPs) and various accessory proteins. By recognizing various cis-regulatory sequences, the spliceosome defines the exon / intron boundary, removes the intron sequence, and splices the exon along with the exon into the final signal (e.g., mRNA). In the case of alternative splicing, certain exons may be included or omitted to alter the final encoded signal, thereby changing the resulting expressed protein.

[0067] In one embodiment, regulation of target gene expression is achieved by using any of the DNA constructs disclosed in PCT application PCT / US2016 / 016234 (WO2016 / 126747, Regulation of gene expression by aptamer-mediated modulation of alternative splicing), which is hereby incorporated herein by reference in its entirety. In embodiments of this disclosure, the riboswitch and polynucleotide cassette disclosed in PCT application PCT / US2016 / 016234 (WO2016 / 126747) contain the aptamer-coding sequences described herein, replacing the aptamer sequences disclosed in PCT application PCT / US2016 / 016234 (WO2016 / 126747).

[0068] In one embodiment, the polynucleotide cassette comprises (a) a riboswitch and (b) an alternative splicing exon flanked by 5' and 3' introns, wherein the riboswitch comprises (i) an effector region comprising a stem-forming sequence including a 5' splice site sequence of the 3' intron (and a complementary sequence thereof), and (ii) the aptamer disclosed herein. In an embodiment, the effector region is a stem-forming region of a P1 stem forming the aptamer. Thus, in an embodiment, the effector stem is or comprises a P1 stem of the aptamer disclosed herein. In other words, the effector stem comprises a first sequence attached to the 5' end of the aptamer disclosed herein and a second sequence attached to the 3' end of the aptamer disclosed herein, wherein the first or second sequence comprises a 5' splice site sequence of the 3' intron, and the other comprises a sequence complementary to the 5' splice site sequence of the 3' intron. In the implementation scheme, the effector region includes the intron 5' splicing site (“5' ss”) sequence of the intron immediately adjacent to the variable exon 3', and a sequence complementary to the 5' ss sequence of the 3' intron.

[0069] In one implementation, the polynucleotide construct comprises sequences from 5' to 3' encoding the following: (a) First intron; (b) Alternative splicing exons; and (c) A second intron comprising a riboswitch, wherein the riboswitch comprises an effector region and an aptamer, wherein the riboswitch comprises from 5' to 3': (i) a 5' splice site sequence of the second intron; (ii) an aptamer sequence; and (iii) a sequence complementary to the 5' splice site sequence of the second intron; The 5' splice site sequence of the second intron and the sequence complementary to the 5' splice site sequence of the second intron can form a stem; The alternative splicing exon contains a stop codon. When the alternative splicing exon is spliced ​​into the CAR gene mRNA, the stop codon is in the same frame as the CAR gene, forming the polynucleotide construct.

[0070] Depending on the desired CAR expression level, those skilled in the art can modify the polynucleotide cassette inserted into the CAR coding sequence by altering the aptamer sequence, stem length, intron sequence, or exon sequence within the cassette. The modular nature of the expression cassette makes the CAR expression constructs compatible with a variety of practical applications, including CAR expression for research or therapy. Importantly, by changing the different components of the expression system, the CAR expression constructs disclosed herein allow those skilled in the art to fine-tune CAR expression to any level that might be desired for a given application. For example, in some cases, those skilled in the art may seek high levels of (absolute) CAR expression in the presence of an aptamer ligand. Alternatively, those skilled in the art may desire a construct that exhibits significant CAR expression in the absence of an aptamer ligand, but whose expression can be further “enhanced” at a desired time by applying the aptamer ligand. Other cases may benefit from a large difference in CAR expression levels between the presence and absence of an aptamer ligand (i.e., a high dynamic range). In still other cases, it may not be necessary to have very high CAR expression levels in the presence of an aptamer ligand, only very low CAR expression in the absence of an aptamer ligand.

[0071] 5' splice site sequences (i.e., splice site sequences located at the 5' end of introns) are well known in the art. Variations exist between different 5' splice site sequences, and these variations are well understood in the art. For example, Shapiro and Senapathy (Shapiro MB, Senapathy P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. Sep 11, 1987; 15(17): 7155-74; or Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet. May 1998; 7(5): 919-32, the references of which are incorporated herein by reference in their entirety) describe which positions of splice site sequences in various eukaryotic cells are variable and which are invariant. Similarly, Zhang (Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet. May 1998;7(5):919-32, the entire reference is incorporated herein by reference) also demonstrates which positions of splice site sequences may be variable and which positions are constant. Therefore, those skilled in the art can easily identify splice site sequences based on known common sequences and their position relative to exon / intron boundaries. Exemplary splice site sequences include, but are not limited to: AGG || GTGAGT; AAA || GT AA GC; GCA || GTAAGT; GAG || GTGTGG; A / CAG || GTA / GAGT; N AG || GTA / GAGT; NAG || GTAAGT; A / CA / TG || GTANGT; and NAG / A || GTAAGT (where || denotes an exon / intron boundary and N denotes A, G, C, or T).

[0072] When an aptamer binds to its ligand, the effector region forms a stem and thus prevents splicing to the splice donor site at the 3' end of the variable exon. Under certain conditions (e.g., when the aptamer is not bound to its ligand), the effector region is positioned in a context where the splice donor site at the 3' end of the variable exon is accessible, allowing the variable exon to be included in the CAR gene mRNA. In some embodiments, a polynucleotide cassette is placed in the CAR gene to regulate CAR expression in response to a ligand. In one embodiment, the variable splice exon contains a stop codon that is framed with the CAR gene when the variable splice exon is spliced ​​into the CAR gene mRNA.

[0073] In one embodiment, the gene regulatory cassette comprises the sequence of SEQ ID NO: 598, where -X- denotes the aptamer coding sequence disclosed herein. Lowercase letters indicate paired stem sequences that form part of the effector stem (the aptamer sequences disclosed herein may provide additional base pairs to the stem). In one embodiment, a variable exon (hereinafter underlined in SEQ ID NO: 598) is replaced by another variable exon sequence.

[0074] SEQ ID NO: 598 GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTT AAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCGAGTAACGCTGTTTCTCTAACTTGTAG GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAAA TCTTCAGTAGAAGgtaatgt-X-acattacGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATT GCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG. SEQ ID NO: 598 corresponds to: (SEQ ID NO:1186)-X-(SEQ ID NO:1187).

[0075] In one embodiment, the gene regulatory cassette comprises the sequence of SEQ ID NO: 599, where -X- denotes the aptamer coding sequence disclosed herein. Lowercase letters indicate paired stem sequences that form part of the effector stem. In one embodiment, a variable exon (hereinafter underlined in SEQ ID NO: 599) is replaced by another variable exon sequence.

[0076] SEQ ID NO: 599 GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTT AAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCGAGTAACGCTGTTTCTCTAACTTGTAG GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAAA TCTTCAGTAGAAGgtaatgtg-X-cacattacGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATAT TGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG. SEQ ID NO:599 corresponds to: (SEQ ID NO:1188)-X-(SEQ ID NO:1189).

[0077] The variable exon is flanked by 5' and 3' intron sequences. The 5' and 3' intron sequences that can be used in the gene regulatory cassette disclosed herein can be any sequence that can be spliced ​​from the CAR gene to form CAR gene mRNA or CAR gene mRNA containing variable exon mRNA, depending on the presence or absence of a ligand binding aptamer. Each of the 5' and 3' intron sequences has the sequences required for splicing, namely, the splice donor sequence, the splice acceptor sequence, and the branching point sequence. In one embodiment, the 5' and 3' intron sequences of the gene regulatory cassette are derived from one or more naturally occurring introns or portions thereof. In one implementation, the 5' and 3' intron sequences are derived from truncated human β-globin intron 2 (IVS2Δ), intron 2 of the human β-globin gene, SV40 mRNA introns (used in the pCMV-LacZ vector from Clontech Laboratories), intron 6 of the human triose phosphate isomerase (TPI) gene (Nott Ajit et al., RNA. 2003, 9:6070617), introns of human factor IX (Sumiko Kurachi et al., J. Bio. Chem. 1995, 270(10), 5276), endogenous introns of the target gene itself, or any genomic fragment or synthetic intron containing an element sufficient to regulate splicing (Thomas A. Cooper, Methods 2005(37):331) (Yi Lai et al., Hum Gene Ther. 2006:17(10):1036).

[0078] In one implementation, the variable exon and riboswitches are engineered to reside within endogenous introns of the target gene. In other words, the intron (or substantially similar intron sequences) is naturally present at the location of the target gene. In this case, the intron sequence immediately upstream of the variable exon is referred to as a 5' intron or 5' intron sequence, and the intron sequence immediately downstream of the variable exon is referred to as a 3' intron or 3' intron sequence. In this case, the endogenous intron is modified to contain splice acceptor sequences and splice donor sequences flanking the 5' and 3' ends of the variable exon. In one implementation, the 5' and / or 3' introns are exogenous to the target gene.

[0079] Splice donor and acceptor sites in the alternative splicing gene regulatory cassette can be modified to be enhanced or weakened. In other words, splice sites can be modified to more closely resemble those common to the splice donor or acceptor through standard cloning methods, site-directed mutagenesis, etc. Splice sites that are more similar to splice common tend to promote splicing and are therefore enhanced. Splice sites that are less similar to splice common tend to inhibit splicing and are therefore weakened. For the most common class of intron (U2) splice donors, the common site is A / CAG || GTA / GAGT (where || represents the exon / intron boundary). For splice acceptors, the common site is CAG || G (where || represents the exon / intron boundary). The frequencies of specific nucleotides at splice donor and acceptor sites are described in the art (see, for example, Zhang, MQ, Hum Mol Genet. 1988. 7(5):919-932). The strength of the 5' and 3' splice sites can be modulated to regulate the splicing of alternative exons.

[0080] Other modifications to the 5' and 3' introns present in the alternative splicing gene regulatory cassette for the purpose of regulating splicing include modification, deletion and / or addition of intron splicing enhancer elements, intron splicing repressor elements and / or splicing sites, and / or modification of branching site sequences.

[0081] In one implementation, the 5' intron is modified to contain a stop codon that will be framed with the CAR gene. The 5' and 3' intron sequences can also be modified to remove occult splice sites that can be identified using publicly available software (see, for example, Kapustin, Y. et al., Nucl. Acids Res. 2011.1-8).

[0082] The lengths of the 5' and 3' intron sequences can be adjusted to, for example, meet the size requirements of the viral expression construct. In one embodiment, the 5' and / or 3' intron sequence is about 50 to about 300 nucleotides long. In another embodiment, the 5' and / or 3' intron sequence is about 125 to about 240 nucleotides long.

[0083] The stem portion of the effector region should have sufficient length (and GC content) to substantially prevent alternative splicing of variable exons after ligand binding to the aptamer, while also allowing access to the splice site when the ligand is not present in sufficient quantity. In an embodiment, the stem portion of the effector region includes a stem sequence in addition to the 5' splice site sequence of the 3' intron and its complementary sequence. In an embodiment, the additional stem sequence includes a sequence derived from the aptamer stem. The length and sequence of the stem portion can be altered using known techniques to identify stems that allow acceptable background CAR gene expression in the absence of ligand and acceptable CAR gene expression levels in the presence of ligand.

[0084] In some embodiments, the length of the riboswitch's effector stem is about 7 to about 20, about 7 to about 19, about 7 to about 18, about 7 to about 17, about 7 to about 16, about 7 to about 15, about 7 to about 14, about 7 to about 13, or about 7 to about 12 base pairs. In one embodiment, the length of the effector stem is 8 to 13 base pairs. In another embodiment, the length of the effector stem is 8 to 12 base pairs. In another embodiment, the length of the effector stem is 8 to 11 base pairs. In yet another embodiment, the stem length is about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs. In addition to the stem length, the GC base pair content of the stem can also be varied to alter the stem's stability.

[0085] In some embodiments, the 5' splice site sequence of the second intron (i.e., the intron located at the 3' end of the variable exon) and a sequence complementary to the 5' splice site sequence of the second intron can form a stem, which may include an additional stem-forming sequence (collectively referred to as the effector region stem). In embodiments, the length of this stem-forming sequence is about 7 to about 20, about 7 to about 19, about 7 to about 18, about 7 to about 17, about 7 to about 16, about 7 to about 15, about 7 to about 14, about 7 to about 13, or about 7 to about 12 base pairs. In one embodiment, the length of the region stem is 8 to 13 base pairs. In one embodiment, the length of the stem is 8 to 12 base pairs. In one embodiment, the length of the stem is 8 to 11 base pairs. In one embodiment, the length of the stem is about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs. In addition to stem length, the GC base pair content of the stem can also be altered to change stem stability.

[0086] The variable exon, as part of the alternative splicing gene regulatory cassette disclosed herein, is any polynucleotide sequence capable of being transcribed into precursor mRNA and alternatively spliced ​​into the mRNA of a CAR gene. In one embodiment, the variable exon contains at least one translation-repressing sequence, thereby preventing or reducing CAR gene expression from the mRNA when the variable exon is included in the CAR gene mRNA. In a preferred embodiment, the variable exon contains a stop codon that is co-located with the CAR gene when the variable exon is included in the CAR gene mRNA by splicing. In an embodiment, in addition to or as an alternative to the stop codon, the variable exon contains another sequence that, when the variable exon is incorporated into the CAR gene mRNA by splicing, reduces or substantially prevents translation, including, for example, a microRNA binding site, thereby causing mRNA degradation. In one embodiment, the variable exon contains a miRNA-binding sequence that causes mRNA degradation. In one embodiment, the variable exon encodes a polypeptide sequence that reduces the stability of proteins containing this polypeptide sequence. In one embodiment, the variable exons encode a polypeptide sequence that guides the degradation of a protein containing that polypeptide sequence.

[0087] The basal or background splicing level of a variable exon can be optimized by altering the exon splicing enhancer (ESE) and exon splicing repressor (ESS) sequences and / or by introducing an ESE or ESS sequence into the variable exon. Such alterations to the sequence of the variable exon can be achieved using methods known in the art, including but not limited to site-directed mutagenesis. Alternatively, oligonucleotides containing the desired sequence (e.g., those containing all or part of the variable exon) can be obtained from commercial sources and cloned into a gene regulatory cassette. Identification of the ESS and ESE sequences can be achieved using methods known in the art, including, for example, using ESEfinder 3.0 (Cartegni, L. et al., ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Research, 2003, 31(13): 3568-3571) and / or other available resources.

[0088] In one implementation, the variable exon is a naturally occurring exon. In other implementations, the variable exon is derived from all or part of a known exon. In this context, "derived from" means that the variable exon contains a sequence substantially homologous to a naturally occurring exon or a portion thereof, but this sequence may contain various mutations, such as mutations resulting from altering exon splicing enhancer (ESE) and exon splicing repressor (ESS) sequences and / or from introducing an ESE or ESS sequence into the variable exon. As used herein, "homology" and "homology" refer to the percentage of identity between two polynucleotide sequences or between two polypeptide sequences. The correspondence between one sequence and another can be determined by techniques known in the art. For example, homology can be determined by aligning sequences and directly comparing two polypeptide molecules using readily available computer programs. Alternatively, homology can be determined by hybridizing polynucleotides under conditions that allow them to form stable duplexes between homologous regions, followed by digestion with a single-strand-specific nuclease, and then determining the size of the digested fragment. When optimal alignment is performed with appropriate insertions or deletions, and the two polynucleotide or two polypeptide sequences are identified by the above methods as having at least about 80%, at least about 85%, at least about 90%, and at least about 95% nucleotide or amino acid matches within a defined molecular length, respectively, they are “substantially homologous” to each other.

[0089] In one embodiment, the alternative splicing exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), exon 5 of the mutant human Wilms' tumor 1 gene, exon 16 of the mouse calcium / calmodulin-dependent protein kinase II δ, or exon 6 of SIRT1. In another embodiment, the alternative splicing exon is or comprises the modified DHFR exon 2 of SEQ ID NO: 590 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAAATCTTCAGTAGAAG). In yet another embodiment, the alternative splicing exon is or comprises the modified DHFR exon 2 of SEQ ID NO: 591 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAATCTTCAGTAGAAG). In some implementations, the alternatively spliced ​​exon contains at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the same sequence as SEQ ID NO: 590 or SEQ ID NO: 591.

[0090] fit Aptamers are single-stranded nucleic acid molecules that fold into a three-dimensional structure and non-covalently bind to a specific ligand with high affinity and specificity. Aptamer ligands include ions, small molecules, proteins, viruses, and cells.

[0091] As used herein, the term "aptamer" refers to an RNA polynucleotide (or DNA sequence encoding said RNA polynucleotide) that specifically binds to a class of ligands. The term "ligand" refers to a molecule that is specifically bound by an aptamer. Because ligands induce the expression of target genes (i.e., CARs) in the gene regulatory cassettes disclosed herein, ligands are also referred to herein as inducers. An aptamer has a binding region capable of forming a complex with a predetermined target molecule (i.e., the ligand). The length of an aptamer is typically between about 15 and about 200 nucleotides. Most commonly, the length of an aptamer is between about 30 and about 100 nucleotides, for example, 70 to 90 nucleotides. An aptamer typically contains multiple paired (P) regions and unpaired regions, in which the aptamer forms a stem, and in which the aptamer forms a conjugating (J) region or a loop (L) region. Paired regions can be sequentially numbered starting from the 5' end (P1), and each stem can be sequentially numbered (P2, P3, etc.). The rings (L1, L2, etc.) are numbered based on adjacent paired regions, while the joining regions are numbered according to the paired regions they connect to (e.g., J1-2 joins paired region P1 with paired region P2).

[0092] In the implementation plan, X1-X6 are not simultaneously C, A, T, C, G, and A; X7-X 12The different values ​​are A, T, T, G, C, and A respectively; X 13 X 14 X 15 X 22 and X 23 They are not simultaneously G, A, T, C, and G; and / or X 16 -X 21 The aptamer sequence may be A, T, C, A, T, or G at different times. In an implementation, one or more of the above limitations apply to the aptamer when the 5' and 3' ends of the aptamer sequence disclosed herein are not C and G, respectively.

[0093] In one aspect, this disclosure provides an aptamer that binds to a small molecule, wherein the aptamer coding sequence comprises: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCX7X8X9X 10 X11X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO:2); where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:2 are any nucleotides or are not nucleotides; X1 is either C or T; X2 can be any nucleotide; X3 can be any nucleotide; X4 is either G or T; X5 is A, G, or T; X6 is either A or G; X7 is either A or T; X8 can be A, C, or T; X9 is A, C, or T; X 10 Any nucleotide; X 11 It can be any nucleotide or not a nucleotide; X 12 A; X 13 It can be A, C, or G; X 14 Any nucleotide; X15 For C, G, or T; X 16 For G or T; X 17 It can be A or T; X 18 Any nucleotide; X 19 It can be A or G; X 20 For A, G, T; X 21 For C, G, T; X 22 Let T be the value of T; and X 23 It can be A, G, or T.

[0094] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCX7X8X9X 10 X11X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 CAGGGAG (SEQ ID NO:2); where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:2 are any nucleotides or are not nucleotides; X1 is either C or T; X2 can be any nucleotide; X3 can be any nucleotide; X4 is either G or T; X5 is A, G, or T; X6 is either A or G; X7 is A; X8 can be A, C, or T; X9 is A, C, or T; X 10 Any nucleotide; X 11 It can be any nucleotide or not a nucleotide; X 12 A; X 13It can be A, C, or G; X 14 Any nucleotide; X 15 For C, G, or T; X 16 For G or T; X 17 It can be A or T; X 18 Any nucleotide; X 19 It can be A or G; X 20 For A, G, T; X 21 For C, G, T X 22 Let T be the value of T; and X 23 It can be A, G, or T.

[0095] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:4 are any nucleotides or are not nucleotides; X7 is A, G, or T; X8 can be any nucleotide; X9 can be any nucleotide; X 10 Any nucleotide; X 11 It can be any nucleotide or not a nucleotide; X 12 It can be A, C, or T.

[0096] In the implementation plan, X7-X 12 The values ​​are A, T, T, G, C, and A, respectively.

[0097] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:4 are any nucleotides or are not nucleotides; X7 is either A or T; X8 can be A, C, or T; X9 is A, C, or T; X 10 Any nucleotide; X 11 It can be any nucleotide or not a nucleotide; and X 12 The answer is A.

[0098] In the implementation plan, X7-X 12 The values ​​are A, T, T, G, C, and A, respectively.

[0099] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:4 are any nucleotides or are not nucleotides; X7 is A; X8 can be A, C, or T; X9 is A, C, or T; X 10 Any nucleotide; X 11 It can be any nucleotide or not a nucleotide; and X 12 The answer is A.

[0100] In the implementation plan, X7-X 12 The values ​​are A, T, T, G, C, and A, respectively.

[0101] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:3 are any nucleotides or are not nucleotides; X1 is C, G, or T; X2 can be any nucleotide; X3 can be any nucleotide; X4 can be any nucleotide; X5 can be any nucleotide; and X6 can be any nucleotide.

[0102] In the implementation plan, X1-X6 are not simultaneously C, A, T, C, G and A respectively.

[0103] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:3 are any nucleotides or are not nucleotides; X1 is either C or T; X2 can be any nucleotide; X3 can be any nucleotide; X4 can be any nucleotide; X5 is A, G, or T; and X6 can be any nucleotide.

[0104] In the implementation plan, X1-X6 are not simultaneously C, A, T, C, G and A respectively.

[0105] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:3 are any nucleotides or are not nucleotides; X1 is either C or T; X2 can be any nucleotide; X3 can be any nucleotide; X4 is either G or T; X5 is A, G, or T; and X6 is either A or G.

[0106] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X14X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO:5), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:5 are any nucleotides or are not nucleotides; X 13 X 14 X 15 X 22 and X 23 It can be any nucleotide.

[0107] In the implementation plan, X 13 X 14 X 15 X 22 and X 23 They are G, A, T, C, and G, respectively.

[0108] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX 13 X14X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO:5), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:5 are any nucleotides or are not nucleotides; X 13 It can be A, C, or G; X 14 Any nucleotide; X 15 For C, G, or T; X 22 Let T be the value of T; and X 23 It can be A, G, or T.

[0109] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO:6), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:6 are any nucleotides or are not nucleotides; X 16 Any nucleotide; X 17 Any nucleotide; X 18 Any nucleotide; X 19 Any nucleotide; X 20 For any nucleotide; and X 21 For C, G, and T.

[0110] In the implementation plan, X 16 -X 21 The values ​​are A, T, C, A, T, and G, respectively.

[0111] In the implementation scheme, the aptamer coding sequence includes: CTGGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO:6), where: The first and last nucleotides of the aptamer coding sequence of SEQ ID NO:6 are any nucleotides or are not nucleotides; X 16 For G or T; X 17It can be A or T; X 18 Any nucleotide; X 19 It can be A or G; X 20 For A, G, T; and X 21 For C, G, and T.

[0112] In the implementation scheme, the aptamer coding sequence comprises a sequence that is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 1 and 7-558. In the implementation scheme, the aptamer coding sequence comprises a sequence selected from the group consisting of SEQ ID NO: 1 and 7-558.

[0113] In an embodiment, the aptamer coding sequence comprises a sequence that is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 7-17, 89-96, 174-349, and 358-583. In an embodiment, the aptamer coding sequence comprises a sequence selected from the group consisting of SEQ ID NO: 7-17, 89-96, 174-349, and 358-583.

[0114] In the implementation scheme, the aptamer coding sequence comprises a sequence that is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447. In the implementation scheme, the aptamer coding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447.

[0115] In the implementation scheme, the aptamer coding sequence comprises a sequence that is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NO: 174, 358, 363, and 378. In the implementation scheme, the aptamer coding sequence comprises a sequence selected from the group consisting of SEQ ID NO: 174, 358, 363, and 378.

[0116] In embodiments, the aptamer-coding sequences provided herein are derived from any aptamer-coding sequences disclosed herein, wherein the first and last nucleotides of said aptamer-coding sequence are any nucleotides or not nucleotides. In embodiments, the first two and last two nucleotides of said aptamer-coding sequence can be any nucleotides or not nucleotides. In these embodiments, additional sequences may be present at the 5' and 3' ends of the aptamer-coding sequence and said additional sequences form part of the stem-forming sequence of the riboswitch.

[0117] In one respect, this disclosure provides aptamers encoded by the aptamer coding sequences disclosed herein.

[0118] Those skilled in the art will understand that the aptamers described herein can be ribonucleic acid (RNA) molecules. In embodiments, the aptamers described herein are portions of longer RNA polynucleotides, including, for example, heterologous nuclear RNA (hnRNA) or messenger RNA (mRNA).

[0119] Small molecule inducers The aptamers disclosed herein bind to small molecule ligands (also referred to herein as "small molecule inducers") or otherwise respond to the presence or addition of small molecule ligands. The small molecule inducers interact with the aptamers to promote the induction of CAR expression, as described herein.

[0120] The selected inducer can provide high inducibility of the target gene (i.e., the CAR gene) and preferably has good selectivity (high selectivity for the aptamer and low off-target binding). The compound may also provide one or more favorable physicochemical properties (e.g., solubility, physical and / or chemical stability), favorable pharmacokinetic properties (e.g., bioavailability, appropriate half-life and duration of action), and acceptable safety (low toxicity and / or fewer side effects, wide therapeutic window).

[0121] Small molecule inducers are disclosed in, for example, PCT applications PCT / US2020 / 045022 (WO2021 / 026245, RNA-targeting ligands, compositions thereof, and methods of making and using the same), PCT / US2022 / 031736 (WO2022 / 256382, RNA-targeting ligands, compositions thereof, and methods of making and using the same), PCT / IB2022 / 000762 (WO2023 / 111686, Aptamers and small molecule ligands), and PCT / IB2024 / 000314 (Small molecule ligands and aptamers), each of which is incorporated herein by reference. Small molecule inducers can be compounds having structures according to formulas I to XXII, including the small molecules listed in Table 1.

[0122] In the implementation scheme, the small molecule has a structure according to Formula I: I in X1, X2 and X3 are independently selected from CR1, CHR1, N, NH, O and S in each case, wherein adjacent X1, X2 and X3 are not simultaneously selected as O or S; Dashed lines represent optional double bonds; Y1, Y2, and Y3 are independently selected from CR2 and N in each case; n is 1 or 2, where when n is 1, only one dashed line is a double bond; LA is ,or L is selected from , , , , , Where k, p, q, r and v are independently selected from integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10, and z is selected from integers 1, 2, 3, 4 and 5; c, d, e, f, g, h, and i are independently selected from the integers 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; j is selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. M is selected from -NH-, -O-, -NHC(=O)-, -C(=O)NH-, -S-, and -C(=O)-; and A is selected from , , as well as , X4, X5, X6, and X7 are independently selected from CR3 and N; X8 is either N or CH; X b Selected from O, NH and NCH3; Each of R1, R2, and R3 is independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl groups; Alternatively, two R3s at adjacent ring positions can together form a 5- or 6-membered aromatic ring with 0 to 2 heteroatoms selected from O, S, N and NH; m is 1 or 2; Each R a Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. a Forming an oxo group, or two R atoms attached to different carbon atoms a Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; x is 0, 1, 2, or 3; Each R b Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. b Forming an oxo group; or two R atoms attached to different carbon atoms b Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; y is 0, 1, 2, or 3; and W is O or NR4, where R4 is selected from -H, -CO (C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO (aryl), -CO (heteroaryl), and -CO (cycloalkyl). The prerequisite is that at least two of X1, X2, X3, X4, X5, X6, and X7 are N; Or its pharmaceutically acceptable salt.

[0123] In the implementation scheme of the above structure, y is 0.

[0124] In the implementation scheme, the small molecule has a structure according to Formula II: Equation (II) in X1, X2 and X3 are independently selected from CR1, CHR1, N, NH, O and S in each case, wherein adjacent X1, X2 and X3 are not simultaneously selected as O or S; Dashed lines represent optional double bonds; Y1, Y2, and Y3 are independently selected from CR2 and N in each case; n is 1 or 2, where when n is 1, only one dashed line is a double bond; L is selected from , , , as well as , Where k, p, q, r, and v are independently selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, and z is selected from the integers 1, 2, 3, 4, and 5; and A is selected from , as well as , X4, X5, X6, and X7 are independently selected from CR3 and N; Each of R1, R2, and R3 is independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl groups; m is 1 or 2; and W is O or NR4, where R4 is selected from -H, -CO (C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO (aryl), -CO (heteroaryl), and -CO (cycloalkyl). The prerequisite is that at least two of X1, X2, X3, X4, X5, X6, and X7 are N; Or its pharmaceutically acceptable salt.

[0125] In one implementation of the above structure, at least one of X1, X2, or X3 is N.

[0126] In one implementation of the above structure, X1 is N.

[0127] In one implementation of the above structure, X2 is N.

[0128] In one implementation of the above structure, X3 is N.

[0129] In one implementation of the above structure, two of X1, X2, and X3 are N.

[0130] In one implementation of the above structure, X1 and X3 are N.

[0131] In one implementation of the above structure, at least one of Y1, Y2 and Y3 is N.

[0132] In one implementation of the above structure, Y1 is N.

[0133] In one implementation of the above structure, Y2 is N.

[0134] In one implementation of the above structure, Y3 is N.

[0135] In one implementation of the above structure, at least one of Y1, Y2 and Y3 is CR2.

[0136] In one implementation of the above structure, Y1 is CR2.

[0137] In one implementation of the above structure, Y2 is CR2.

[0138] In one implementation of the above structure, Y3 is CR2.

[0139] In one implementation of the above structure, n is 2.

[0140] In the implementation scheme, the small molecule has a structure according to Formula III: , Equation (III) in X 2a and X 2b Independently selected from CR1 and N; X1 and X3 are independently selected from CR1 and N; L and A are as provided in equation (II); and X1, X 2a X 2b And two of X3 are N.

[0141] In the implementation scheme, the small molecule has a structure according to formula (IV): Formula (IV) in L and A are provided in equation (II).

[0142] As in any of the above embodiments of the compound, L can be selected from... , as well as .

[0143] As in any of the above embodiments of the compound, L can be selected as .

[0144] In any of the above embodiments, q and r in the compound are 0 or 1.

[0145] In any of the above embodiments, q is 1 in the compound.

[0146] In any of the above embodiments, r is 1 in the compound.

[0147] In any of the above embodiments, r is 0 in the compound.

[0148] In any of the above embodiments, q and r in the compound are 1.

[0149] In any of the above embodiments, q is 1 and r is 0 in the compound.

[0150] In any of the above embodiments, m in the compound is 1.

[0151] In any of the above embodiments, W in the compound is selected from NH, O, and N (C1-C6 alkyl).

[0152] In any of the above embodiments, W in the compound is NH.

[0153] In any of the above embodiments, at least one of X4, X5, X6 and X7 in the compound is N.

[0154] In any of the above embodiments, X4 in the compound is N.

[0155] In any of the above embodiments, X5 in the compound is N.

[0156] In any of the above embodiments, X6 in the compound is N.

[0157] In any of the above embodiments, X7 in the compound is N.

[0158] In any of the above embodiments, X4 and X6 in the compound are N.

[0159] In any of the above embodiments, X5 and X7 in the compound are N.

[0160] In any of the above embodiments, X5 or X6 in the compound is N, and X4 and X7 are independently CR2.

[0161] In any of the above embodiments, A in the compound is .

[0162] In any of the above embodiments, the compound has the structure of formula V: (V).

[0163] In any of the above embodiments, L in the compound is or .

[0164] In any of the above embodiments, Y1, Y2 and Y3 in the compound are independently selected from CR2 and N in each case, wherein R1 is selected from -H, -Cl, -Br, -I, -F, -OH and -NH2.

[0165] In any of the above embodiments, z is 2 in the compound.

[0166] In any of the above embodiments, Y2 in the compound is N.

[0167] In any of the above embodiments, Y2 in the compound is CR2 and R1 is selected from -H, -F, -OH and -NH2.

[0168] In any of the above embodiments, A in the compound is .

[0169] In the implementation scheme, the small molecule has a structure according to the following structural formula: .

[0170] In other embodiments, the small molecule has a structure according to the following structural formula: , or .

[0171] In other embodiments, the small molecule has the structure of formula VI: Formula (VI) in X1, X2 and X3 are independently selected from CR1, CHR1, N, NH, O and S in each case, wherein adjacent X1, X2 and X3 are not simultaneously selected as O or S; Dashed lines represent optional double bonds; Y1, Y2, and Y3 are independently selected from CR2 and N in each case; n is 1 or 2, where when n is 1, only one dashed line is a double bond; L1 is selected from Where c, d, e, f, g, h and i are independently selected from the integers 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; j is selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; M is selected from -NH-, -O-, -NHC(=O)-, -C(=O)NH-, -S-, and -C(=O)-; and A is selected from and , X4, X5, X6, and X7 are independently selected from CR3 and N; Each of R1, R2, and R3 is independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl groups; m is 1 or 2; and W is -O- or -N(R4)-, where R4 is selected from -H, -CO (C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO (aryl), -CO (heteroaryl), and -CO (cycloalkyl). The prerequisite is that at least two of X1, X2, X3, X4, X5, X6, and X7 are N; Or its pharmaceutically acceptable salt.

[0172] In another implementation, L is , where B is selected from -NH- and -NHC(=O)-; and y is an integer selected from 1, 2, 3, 4 and 5.

[0173] In the above embodiments, at least one of X1, X2 or X3 in the compound is N.

[0174] In the above implementation scheme, X1 in the compound is N.

[0175] In the above implementation scheme, X2 in the compound is N.

[0176] In the above implementation scheme, X3 in the compound is N.

[0177] In the above embodiments, in each case, two of X1, X2, and X3 in the compound are N.

[0178] In the above embodiments, X1 and X3 in the compound are N.

[0179] In the above embodiments, at least one of Y1, Y2 and Y3 in the compound is N.

[0180] In the above implementation scheme, Y1 in the compound is N.

[0181] In the above implementation scheme, Y2 in the compound is N.

[0182] In the above implementation scheme, Y3 in the compound is N.

[0183] In the above embodiments, at least one of the compounds Y1, Y2 and Y3 is CR2.

[0184] In the above implementation scheme, Y1 in the compound is CR2.

[0185] In the above implementation scheme, Y2 in the compound is CR2.

[0186] In the above implementation scheme, Y3 in the compound is CR2.

[0187] In the above implementation scheme, n is 2 in the compound.

[0188] As in any of the above embodiments, the compound has the structure of formula (VII): , Equation (VII) in X 2a and X 2b Independently selected from CR1 and N; X1 and X3 are independently selected from CR1 and N; L1 and R1 are provided as in equation (I); and X1, X 2a X 2b And two of X3 are N; or their pharmaceutically acceptable salts.

[0189] In the above embodiments, the compound has the structure of formula (VIII): Formula (VIII) in L1 is provided as in formula (VI); or a pharmaceutically acceptable salt thereof.

[0190] In the above embodiments, c, d, e, f, g, h, and i in the compound are independently selected from integers 1, 2, and 3.

[0191] In the above embodiments, L1 in the compound is selected from... .

[0192] In the above embodiments, c, d, e, and f in the compound are independently selected from integers 1, 2, and 3.

[0193] In the above implementation scheme, c, d, and e in the compound are all 1.

[0194] In the above implementation scheme, L1 in the compound is .

[0195] In the above embodiments, e and f in the compound are independently selected from 1, 2 and 3.

[0196] In the above embodiments, e and f in the compound are 1 or 2.

[0197] In the above implementation scheme, e is 1 in the compound.

[0198] In the above implementation scheme, f is 2 in the compound.

[0199] In the above embodiments, e is 1 and f is 2 in the compound.

[0200] In the above implementation scheme, L1 in the compound is .

[0201] In the above embodiments, c in the compound is 1, 2 or 3.

[0202] In the above implementation scheme, c is 1 in the compound.

[0203] In the above implementation scheme, c is 2 in the compound.

[0204] In the above implementation scheme, c is 3 in the compound.

[0205] In the above embodiments, M in the compound is selected from -NH-, -O-, and -S-.

[0206] In the above embodiments, M in the compound is -NH-.

[0207] In the above embodiments, c is 1 and M is -NH-.

[0208] In the above implementation scheme, m is 1 in the compound.

[0209] In the above embodiments, W in the compound is selected from -NH-, -O-, and -N(C1-C6 alkyl)-.

[0210] In the above embodiments, W in the compound is -NH-.

[0211] In the above embodiments, at least one of X4, X5, X6 and X7 in the compound is N.

[0212] In the above implementation scheme, X4 in the compound is N.

[0213] In the above implementation scheme, X5 in the compound is N.

[0214] In the above implementation scheme, X6 in the compound is N.

[0215] In the above implementation scheme, X7 in the compound is N.

[0216] In the above embodiments, X4 and X6 in the compound are N.

[0217] In the above embodiments, X5 and X7 in the compound are N.

[0218] In the above embodiments, X5 or X6 in the compound is N, and X4 and X7 are independently CR2.

[0219] In the above implementation scheme, A in the compound is... .

[0220] In the above embodiments, the compound has the following structure: Or its pharmaceutically acceptable salt.

[0221] In other embodiments, the small molecule has the structure of formula (IX): Formula (IX) X1, X2, and X3 are independently selected from CR1, CHR1, N, NH, O, and S in each case, wherein adjacent X1, X2, and X3 are not simultaneously selected as O or S; Dashed lines represent optional double bonds; Y1, Y2, and Y3 are independently selected from CR2 and N in each case; R1 and R2 are independently selected from -H, -Cl, -Br, -I, -F, -CF3, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl groups; n is 1 or 2, where when n is 1, only one dashed line is a double bond; y is an integer selected from 1, 2, 3, 4, and 5; and B is selected from -NH- and -NHC(=O)-; or pharmaceutically acceptable salts thereof.

[0222] In the above embodiments, B in the compound is -NH-.

[0223] In the above embodiments, B in the compound is -NHC(=O)-.

[0224] In the above embodiments, y in the compound is an integer selected from 1, 2, and 3.

[0225] In the above embodiments, y in the compound is 1 or 3.

[0226] In the above embodiments, at least one of Y1, Y2 and Y3 in the compound is N.

[0227] In the above implementation scheme, Y1 in the compound is N.

[0228] In the above implementation scheme, Y2 in the compound is N.

[0229] In the above implementation scheme, Y3 in the compound is N.

[0230] In the above embodiments, at least one of the compounds Y1, Y2 and Y3 is CR2.

[0231] In the above implementation scheme, Y1 in the compound is CR2.

[0232] In the above implementation scheme, Y2 in the compound is CR2.

[0233] In the above implementation scheme, Y3 in the compound is CR2.

[0234] In the above embodiments, at least one of X1, X2 or X3 in the compound is N.

[0235] In the above embodiments, in each case, two of X1, X2, and X3 in the compound are N.

[0236] In the above implementation scheme, n is 2 in the compound.

[0237] In the above embodiments, the compound has the structure of formula (X): Formula (X) X 2a and X 2b Independently selected from CR1 and N; X1 and X3 are independently selected from CR1 and N; Where X1, X 2a X 2b And two of X3 are N; and B, R1, and y as described in formula (VII); or their pharmaceutically acceptable salts.

[0238] In the above embodiments, the compound has the structure of formula (XIa) or (XIb). in X 2a and X 2b Independently selected from CR1 and N; X1 and X3 are independently selected from CR1 and N; Where X1, X 2a X 2b And two of X3 are N; Where y is an integer selected from 1, 2, and 3; and R1 is as described in formula (IX); or a pharmaceutically acceptable salt thereof.

[0239] In the above implementation scheme, y is 1 in the compound.

[0240] In the above implementation scheme, y is 3 in the compound.

[0241] In the above embodiments, the compound has the structure of formula (XII): Formula (XII) Wherein B and y are as described in formula (IX); or their pharmaceutically acceptable salts.

[0242] In the above embodiments, B in the compound is -NH-.

[0243] In the above embodiments, B in the compound is -NHC(=O)-.

[0244] In the above embodiments, the compound has the following structure: or its pharmaceutically acceptable salt The compounds according to the above structural formula and embodiments can be prepared, for example, according to the methods provided in PCT / US2020 / 45022 and from U.S. Provisional Application Serial No. 63 / 195779 filed on June 2, 2021, the disclosure of which is incorporated herein by reference in its entirety.

[0245] In other embodiments, the small molecule has a structure according to formula XIII. XIII Or its pharmaceutically acceptable salt, wherein X 4 Selected from CH, CR d And N; X 6 Selected from CH, CR d And N; X 7 Selected from CH, CR d And N; Where X 4 X 6 or X 7 N consists of 0 or 1 of them; A. Choose from the following groups: and X a Selected from N and CH; X b Selected from O, NH and NCH3; Each R aIndependently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. a Forming an oxo group; or two R atoms attached to different carbon atoms a Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; Each R b Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. b Forming an oxo group; or two R atoms attached to different carbon atoms b Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; m It can be 1 or 2; x It can be 0, 1, 2, or 3; y It can be 0, 1, 2, or 3; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Or, two Rs at adjacent ring positions d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; and w It can be 0, 1, or 2.

[0246] For compounds according to formula XIII, x It can be selected as 1, 2, or 3; x It can be selected as 1 or 2; or, x It can be selected as 1. R a It can be selected as methyl, fluorine, or chlorine; or R a It can be selected as methyl. Or, x It can be 0.

[0247] For compounds according to formula XIII, y can be chosen as 0 or 1. R b It can be selected from halogen or methyl; or R b It can be selected as methyl.

[0248] For compounds according to formula XIII, w It can be selected as 0 or 1. R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0249] For compounds according to formula XIII, each R d The group can be selected from halogen, C1 to C3 alkyl, -OCH3, -CF3, -CH2F and -CHF2; or R d It can be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rs at adjacent ring positions. d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N and NH.

[0250] For compounds according to formula XIII, X a It can be N.

[0251] For compounds according to formula XIII, X b It can be O.

[0252] In some embodiments of the compound of formula XIII, when A is selected as hour, x It is 1, 2, or 3; and / or Two Rs at adjacent ring positions d Together they form a 5- or 6-membered aromatic ring with 0 to 2 heteroatoms selected from O, S, N and NH.

[0253] In other embodiments, the small molecule has a structure according to formula XIV. XIV Or its pharmaceutically acceptable salt, wherein A. Choose from the following groups: and X a Selected from N and CH; Each R a Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. a Forming an oxo group; or two R atoms attached to different carbon atoms a Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; Each R bIndependently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. b Forming an oxo group; or two R atoms attached to different carbon atoms b Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; m It can be 1 or 2; x It can be 0, 1, 2, or 3; y It can be 0, 1, 2, or 3; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; or, two R groups at adjacent ring positions. d They can together form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; w It can be 0, 1, or 2; and z It can be 0, 1, or 2.

[0254] For compounds according to formula XIV, x It can be selected as 1, 2, or 3; x It can be selected as 1 or 2; or x It can be selected as 1. R a It can be selected as methyl, fluorine, or chlorine; or R a It can be selected as methyl. Or, x It can be 0.

[0255] For compounds according to formula XIV, y can be chosen as 0 or 1. R b It can be selected from halogen or methyl; or R b It can be selected as methyl.

[0256] For compounds according to formula XIV, w It can be selected as 0 or 1. R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0257] For compounds according to formula XIV, z It can be selected as 1 or 2; or z It can be selected as 1. Each Rd It can be independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, and -CHF2; or R d It can be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rs at adjacent ring positions. d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH. Alternatively, z It can be 0.

[0258] For compounds according to formula XIV, X a It can be N.

[0259] In some embodiments of the compound of formula XIV, when A is selected as hour, x It is 1, 2, or 3; and / or Two Rs at adjacent ring positions d Together they form a 5- or 6-membered aromatic ring with 0 to 2 heteroatoms selected from O, S, N and NH.

[0260] In other embodiments, the small molecule has a structure according to formula XV. XV Or its pharmaceutically acceptable salt, wherein A. Choose from the following groups: and Each R a Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. a Forming an oxo group; or two R atoms attached to different carbon atoms a Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; Each R b Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. b Forming an oxo group; or two R atoms attached to different carbon atoms b Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; m It can be 1 or 2; xIt can be 0, 1, 2, or 3; y It can be 0, 1, 2, or 3; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Or, two Rs at adjacent ring positions d They can together form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; w It can be 0, 1, or 2; and z It can be 0, 1, or 2.

[0261] For compounds according to formula XV, x It can be selected as 1, 2, or 3; x It can be selected as 1 or 2; or, x It can be selected as 1. R a It can be selected as methyl, fluorine, or chlorine; or R a It can be selected as methyl. Or, x It can be 0.

[0262] For compounds according to formula XV, y can be chosen as 0 or 1. b It can be selected from halogen or methyl; or R b It can be selected as methyl.

[0263] For compounds according to formula XV, w It can be selected as 0 or 1. R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0264] For compounds according to formula XV, z It can be selected as 1 or 2; or z It can be selected as 1. Each R d It can be independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, and -CHF2; or R d It can be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rs at adjacent ring positions. d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH. Alternatively, z It can be 0.

[0265] In some embodiments of the compound of formula XV, when A is selected as hour, x It is 1, 2, or 3; and / or Two Rs at adjacent ring positions d Together they form a 5- or 6-membered aromatic ring with 0 to 2 heteroatoms selected from O, S, N and NH.

[0266] In other embodiments, the small molecule has a structure according to formula XVI. XVI Or its pharmaceutically acceptable salt, wherein X 4 Selected from CH, CR d And N; X 6 Selected from CH, CR d And N; X 7 Selected from CH, CR d And N; Where X 4 X 6 or X 7 N consists of 0 or 1 of them; X a Selected from N and CH; Each R a Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. a Forming an oxo group; or two R atoms attached to different carbon atoms a Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; m It can be 1 or 2; x It can be 0, 1, 2, or 3; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Or, two Rs at adjacent ring positions dTogether they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; and w It can be 0, 1, or 2.

[0267] For compounds according to formula XVI, x It can be selected as 1, 2, or 3; x It can be selected as 1 or 2; or, x It can be selected as 1. R a It can be selected as methyl, fluorine, or chlorine; or R a It can be selected as methyl. Or, x It can be 0.

[0268] For compounds according to formula XVI, w It can be selected as 0 or 1. R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0269] For compounds according to formula XVI, each R d The group can be selected from halogen, C1 to C3 alkyl, -OCH3, -CF3, -CH2F and -CHF2; or R d It can be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rs at adjacent ring positions. d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N and NH.

[0270] For compounds according to formula XVI, X a It can be N.

[0271] For compounds according to formula XVI, X b It can be O.

[0272] In some embodiments of the compound of formula XVI, x It is 1, 2, or 3; and / or Two Rs at adjacent ring positions d Together they form a 5- or 6-membered aromatic ring with 0 to 2 heteroatoms selected from O, S, N and NH.

[0273] In other embodiments, the small molecule has a structure according to formula XVII. XVII Or its pharmaceutically acceptable salt, wherein Each R aIndependently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. a Forming an oxo group; or two R atoms attached to different carbon atoms a Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Or, two Rs at adjacent ring positions d They can together form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; w It can be 0, 1, or 2; x It can be 0, 1, 2, or 3; and z It can be 0, 1, or 2.

[0274] For compounds according to formula XVII, x It can be selected as 1, 2, or 3; x It can be selected as 1 or 2; or, x It can be selected as 1. R a It can be selected as methyl, fluorine, or chlorine; or R a It can be selected as methyl. Or, x It can be 0.

[0275] For compounds according to formula XVII, w It can be selected as 0 or 1. R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0276] For compounds according to formula XVII, z It can be selected as 1 or 2; or z It can be selected as 1. Each R d It can be independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, and -CHF2; or each R d It can be independently selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rs at adjacent ring positions. dTogether they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N and NH.

[0277] In some embodiments of the compounds of formula XVII, x It is 1, 2, or 3; and / or Two Rs at adjacent ring positions d Together they form a 5- or 6-membered aromatic ring with 0 to 2 heteroatoms selected from O, S, N and NH.

[0278] In other embodiments, the small molecule has a structure according to formula XVIII. XVIII Or its pharmaceutically acceptable salt, wherein Each R a Independently selected from methyl, halogen, hydroxyl, and amino groups; Each R c Independently selected from methyl, halogen, hydroxyl, and amino groups; Each R d Independently selected from methyl, halogen, hydroxyl, and amino groups; x It can be 0, 1, 2, or 3; w It can be 0, 1, or 2; and z It can be 0, 1, or 2.

[0279] For compounds according to formula XVIII, x It can be selected as 1, 2, or 3; x It can be selected as 1 or 2; or, x It can be selected as 1. R a It can be selected as methyl, fluorine, or chlorine; or R a It can be selected as methyl. Or, x It can be 0.

[0280] For compounds according to formula XVIII, w It can be selected as 0 or 1. R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0281] For compounds according to formula XVIII, z It can be selected as 0 or 1; or z It can be selected as 1.

[0282] In other embodiments, the small molecule has a structure according to formula XIX: XIX Or its pharmaceutically acceptable salt, wherein R a Selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or otherwise or alternatively; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Or, two Rs at adjacent ring positions d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; and w It can be 0, 1, or 2.

[0283] z It can be 0, 1, or 2.

[0284] For compounds according to formula XIX, R a The group can be selected from methyl, halogen, hydroxyl, and amino groups; R a It can be selected as methyl, fluorine, or chlorine; or R a It can be selected as methyl.

[0285] For compounds according to formula XIX, each R c It can be independently selected from methyl, halogen, hydroxyl and amino groups.

[0286] For compounds according to formula XIX, each R d It can be independently selected from methyl, halogen, hydroxyl and amino groups.

[0287] In other embodiments, the small molecule has a structure according to formula XX. XX Or its pharmaceutically acceptable salt, wherein X 4 Selected from CH, CR d And N; X 6 Selected from CH, CR d And N; X 7 Selected from CH, CR d And N; Where X 4 X 6 or X 7 N consists of 0 or 1 of them; X b Selected from O, NH and NCH3; Each R b Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. b Forming an oxo group; or two R atoms attached to different carbon atoms b Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; m It can be 1 or 2; y It can be 0, 1, 2, or 3; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Or, two Rs at adjacent ring positions d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; and w It can be 0, 1, or 2.

[0288] For compounds according to formula XX, y can be chosen as 0 or 1. R b It can be selected from halogen or methyl; or R b It can be selected as methyl.

[0289] For compounds according to formula XX, w It can be selected as 0 or 1. R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0290] For compounds according to formula XX, each R d The group can be selected from halogen, C1 to C3 alkyl, -OCH3, -CF3, -CH2F and -CHF2; or R d It can be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rs at adjacent ring positions. d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N and NH.

[0291] For compounds according to formula XX, X b It can be O.

[0292] In other embodiments, the small molecule has a structure according to formula XXI. XXI Or its pharmaceutically acceptable salt, wherein Each R b Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. b Forming an oxo group; or two R atoms attached to different carbon atoms b Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Or, two Rs at adjacent ring positions d They can together form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; m It can be 1 or 2; w 0, 1 or 2 y y is 0, 1, or 2; and z It can be 0, 1, or 2.

[0293] For compounds according to formula XXI, y can be chosen as 0 or 1. R b It can be selected from halogen or methyl; or R b It can be selected as methyl.

[0294] For compounds according to formula XXI, w It can be selected as 0 or 1. R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0295] For compounds according to formula XXI, each R d The group can be selected from halogen, C1 to C3 alkyl, -OCH3, -CF3, -CH2F and -CHF2; or R d It can be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rs at adjacent ring positions.d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N and NH.

[0296] In other embodiments, the small molecule has a structure according to formula XXII. XXII Or its pharmaceutically acceptable salt, wherein Each R b Independently selected from C1 to C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halogen, hydroxyl, and amino groups; or alternatively, two R groups attached to the same carbon atom. b Forming an oxo group; or two R atoms attached to different carbon atoms b Forming a 4- to 6-membered carbon ring or a 4- to 6-membered heterocycle having one or two heteroatoms selected from O and NH; Each R c Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Each R d Independently selected from halogen groups, C1 to C3 alkyl groups, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl groups, and amino groups; Or, two Rs at adjacent ring positions d They can together form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N, and NH; m It can be 1 or 2; w It can be 0, 1, or 2; y y is 0, 1, or 2; and z It can be 0, 1, or 2.

[0297] For compounds according to formula XXII, y can be chosen as 0 or 1. R b Choose from methyl, halogen, hydroxy, and amino groups; or R b It can be selected from halogen or methyl; or R b It can be selected as methyl.

[0298] For compounds according to formula XXII, w Optional from 0 or 1. R c Choose from methyl, halogen, hydroxy, and amino groups; or R c It can be selected from halogen or methyl; or R c It can be selected from F, Cl or methyl.

[0299] For compounds according to formula XXII, each Rd The group can be selected from halogen, C1 to C3 alkyl, -OCH3, -CF3, -CH2F and -CHF2; or R d Choose from methyl, halogen, hydroxy, and amino groups; or R d It can be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rs at adjacent ring positions. d Together they can form 5- or 6-membered aromatic rings with 0 to 2 heteroatoms selected from O, S, N and NH.

[0300] In other embodiments, the small molecule ligand has the structure of the compound according to Table 1 (or a pharmaceutically acceptable salt thereof): Table 1. Small molecule ligands In the implementation scheme, the aptamers disclosed herein bind to one or more of the following compounds (or pharmaceutically acceptable salts thereof), or otherwise react with their presence: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , as well as .

[0301] Small molecule inducers can be prepared according to methods disclosed, for example, in PCT applications PCT / US2020 / 045022 (WO2021 / 026245), PCT / US2022 / 031736 (WO2022 / 256382) and PCT / IB2022 / 000762 (WO2023 / 111686), each of which is incorporated herein by reference.

[0302] The term "alkyl" refers to a saturated aliphatic group, including straight-chain alkyl and branched-chain alkyl. In a preferred embodiment, the straight-chain or branched-chain alkyl has six or fewer carbon atoms in its main chain (e.g., straight-chain C1-C6, branched-chain C3-C6). Alkyl groups include methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, tert-butyl, pentyl, isopentyl, hexyl, etc. The term "substituted alkyl" refers to an alkyl group having one to four independently selected substituents from the following: halogroup, amino group, amide group, sulfonamide group, OH, OCH3, nitro group, and CN.

[0303] The term "cycloalkyl" refers to a saturated carbocyclic group having 3 to 6 carbons in its ring. Cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

[0304] The term "bicyclic group" refers to a saturated carbocyclic group having two linked ring systems that may be fused or bridged. Bicyclic groups include bicyclo[2.1.1]hexane, bicyclo[2.2.1]heptane, decahydronaphthalene, etc. The term "tricyclic group" refers to a saturated carbocyclic group having three linked ring systems that may be fused and / or bridged. Tricyclic groups include adamantane, etc.

[0305] A carbon ring is a ring system that contains only carbon atoms as ring atoms (i.e., the ring system does not have heteroatoms as ring atoms). The carbon ring system can be unsaturated, but it is preferred that the carbon ring is not aromatic.

[0306] The term "alkenyl" refers to an unsaturated aliphatic group having at least one carbon-carbon double bond, including straight-chain alkenyl and branched-chain alkenyl. In a preferred embodiment, the alkenyl has two to six carbon atoms (e.g., C2-C6 alkenyl).

[0307] As used herein, the term "halogen" or "halogen group" indicates -F, -Cl, -Br or -I, and is preferably -F, -Cl or -Br.

[0308] As used herein, the term "alkoxyl / alkoxy" refers to an alkyl group as defined above, linked by an oxygen atom. Representative alkoxy groups include methoxy, ethoxy, propoxy, tert-butoxy, etc.

[0309] The terms "amine" and "amino" refer to unsubstituted and substituted amines, respectively, for example, portions that can be represented by the following general formula: R and R' are each independently selected from H and C1-C3 alkyl groups.

[0310] The term "amide group" refers to both unsubstituted and substituted amide substituents, such as portions that can be represented by the following general formula: R and R' are each independently selected from H and C1-C3 alkyl groups.

[0311] The terms "sulfonamide" or "sulfonamide group" refer to unsubstituted and substituted sulfonamide substituents, such as the portion that can be represented by the following general formula: R and R' are each independently selected from H and C1-C3 alkyl groups.

[0312] As used herein, the term "aryl" includes 5- and 6-membered monocyclic aromatic groups that may include zero to four heteroatoms, such as benzene, pyrene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine, and pyrimidine. Aryl groups having heteroatoms in their ring structures may also be referred to as "aryl heterocycles" or "heteroaryl groups." The term "aryl" also includes polycyclic systems having two or more rings, wherein two or more carbons are shared by two adjacent rings (the rings are "fused rings"), wherein at least one of the rings is aromatic. Thus, aryl includes 8- to 10-membered fused bicyclic aromatic groups that may include zero to five heteroatoms, wherein one or two rings are aromatic, such as naphthylene, quinolones, isoquinolines, benzo[b]thiophene, tetrahydronaphthalene, etc. Each aryl group may be unsubstituted or substituted with 1 to 5 substituents selected from the following: halogen, hydroxyl, amino, cyano, amide, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C 10Bicyclic, C1-C6 haloalkyl, C1-C6 perhaloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 perhaloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl, and heterocyclic.

[0313] The term "heterocyclic group" refers to a non-aromatic heterocycle having one to three cyclic heteroatoms. Preferably, the heterocycle is a 5- or 6-membered heterocyclic group having one to three heteroatoms selected from the group consisting of O, N, and S.

[0314] As used herein, the term "heteroatom" refers to an atom of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, and sulfur.

[0315] As used herein, the definitions of various expressions (e.g., alkyl, R) 1 R 2 (etc.) When it appears more than once in any structure, it is intended to be independent of its definition elsewhere in the same structure.

[0316] It should be understood that “substitution” or “replacing with…” includes the following implied conditions: such substitution conforms to the permissible valence of the substituted atom and the substituent, and said substitution produces a stable compound, for example, which does not undergo transformation on its own, such as by rearrangement, cyclization, elimination, etc.

[0317] The aptamer ligands disclosed herein may exist in specific geometric or stereoisomeric forms and mixtures thereof. Such geometric or stereoisomeric forms include, but are not limited to, cis and trans isomers, R-enantiomers and S-enantiomers, diastereomers, (D)-isomers, (L)-isomers, racemic mixtures thereof, and other mixtures thereof. Other asymmetric carbon atoms may be present in substituents, such as alkyl groups.

[0318] Compounds according to formulas I to XXII may contain acidic or basic functional groups and therefore may exist in salt form. Preferably, the salt form is a pharmaceutically acceptable salt. In this respect, the term "pharmaceutically acceptable salt" refers to a relatively non-toxic inorganic and organic acid and base addition salt of the compounds disclosed herein.

[0319] Compounds according to formulas I to XXII may contain one or more basic functional groups, such as amino or alkylamino groups, and are therefore capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable acids. These salts may be prepared in situ during the manufacturing process of the administration medium or dosage form, or by reacting a purified compound disclosed herein in its free base form with a suitable organic or inorganic acid alone and separating the resulting salt during subsequent purification. Representative salts include hydrobromide, hydrochloride, sulfate, hydrogen sulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, toluenesulfonate, citrate, maleate, fumarate, succinate, tartrate, naphthalate, methanesulfonate, gluconate, lactobionate, and silylic acid sulfonate, etc. (see, for example, Berge et al. (1977), “Pharmaceutical Salts”, J. Pharm. Sci. 66:1-19).

[0320] Pharmaceutically acceptable salts of the compounds of this invention include, for example, conventional non-toxic salts or ammonium salts derived from non-toxic organic or inorganic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, aminosulfonic acid, phosphoric acid, and nitric acid; and salts prepared from organic acids such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, p-aminobenzenesulfonic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, and isothionic acid.

[0321] In other cases, compounds according to formulas I to XXII may contain one or more acidic functional groups and are therefore capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable bases. These salts may also be prepared in situ during application mediator or dosage form manufacturing processes, or by reacting purified compounds in their free acid form with suitable bases, such as hydroxides, carbonates, or bicarbonates of pharmaceutically acceptable metal cations, with ammonia, or with pharmaceutically acceptable primary, secondary, or tertiary organic amines. Representative alkali metal or alkaline earth metal salts include lithium, sodium, potassium, calcium, magnesium, and aluminum salts. Representative organic amines that can be used to form base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, etc. (see, for example, Berge et al., ibid.).

[0322] In the embodiments, the aptamers provided herein bind to or otherwise react with one or more compounds of formula I-XXII provided herein, and / or bind to or otherwise react with metabolic analogs or derivatives of compounds of formula I-XXII.

[0323] The binding specificity of an aptamer to its ligand can be determined based on the comparative dissociation constant (K) of the aptamer to its ligand. d The ligand is defined by comparing its dissociation constant with that of the aptamer to unrelated molecules. Therefore, a ligand can be considered a molecule with a greater affinity for the aptamer than for unrelated materials. Typically, the Ka of the aptamer to its ligand is... d K of aptamers and unrelated molecules d At least about 10 times lower. In other implementations, K d K of aptamers and unrelated molecules d At least about 20 times lower, at least about 50 times lower, at least about 100 times lower, and at least about 200 times lower, at least about 500 times lower, at least about 1000 times lower, or at least about 10,000 times lower.

[0324] Method for preparing T cell compositions T cells for RiboCAR T-cell therapy can be obtained from a patient's blood using a blood separator. The CAR transgene containing the gene regulatory cassette described herein is introduced into the T cells using known methods. In a preferred embodiment, the CAR transgene containing the gene regulatory cassette disclosed herein is stably integrated into the genome of the T cells. In one embodiment, the CAR transgene containing the gene regulatory cassette is knocked into the TRAC locus, for example, by methods disclosed herein. After the T cells are modified, the number of T cells can be expanded in vitro, and the modified T cells are subsequently reinfused into the patient, typically via infusion. Because CAR expression levels are low or undetectable in the absence of an inducer, CAR expression during CAR-T cell preparation is avoided, and persistent CAR signaling-induced T-cell differentiation and T-cell exhaustion can be prevented.

[0325] This article provides a method for preparing a T-cell composition, the method comprising: Obtain a T cell population; A polynucleotide is introduced into T cells within the T cell population, the polynucleotide comprising: (i) The first sequence encoding the chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) an alternative splicing exon flanked by a 5' intron and a 3' intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer connected to an effector region, the effector region comprising a stem-forming sequence comprising a 5' splice site sequence of a 3' intron and a sequence complementary to the 5' splice site sequence of the 3' intron, wherein the second sequence is inserted into the first sequence; and The T cells were expanded in the culture.

[0326] In one implementation, T cells are expanded in the absence of small molecule ligands that bind to the aptamer. In another implementation, T cells are expanded in the presence of small molecule ligands that bind to the aptamer.

[0327] Therefore, the T cell population (containing the inducible CAR expression cassette described herein) possesses one or more of the following characteristics; two or more; three or more; four or more; five or more; six or more: In the aforementioned population, more than 30%, more than 35%, more than 40%, more than 45%, or more than 50% of the T cells have an immature phenotype and / or a stem cell phenotype; In the aforementioned population, more than 30%, more than 35%, more than 40%, more than 45%, or more than 50% of the T cells are CD62L. + CD45RA + CCR7 + CD127 + and / or CD132 + ; In the aforementioned population, more than 30%; more than 35%; more than 40%; more than 45%; or more than 50% of the T cells are CD45RA. + CD62L + ; In the aforementioned population, more than 30%; more than 35%; more than 40%; more than 45%; or more than 50% of the T cells are CD62L. + ; Less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the population have a differentiated phenotype (e.g., effector memory T cells); Less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the population are CD45RA. – CD62L – CCR7 - CD127 and / or CD132 - ; In the aforementioned population, less than approximately 35%; less than approximately 30%; less than approximately 25%; less than approximately 20%; less than approximately 18%; or less than approximately 16% of T cells are CD39. + (and / or express other markers of T cell exhaustion); Compared with T cells constitutively expressing the CAR, the cytotoxicity against cancer cells expressing the CAR antigen is enhanced; Compared with T cells constitutively expressing the CAR, cytokine (e.g., TNFα, IL-2 and / or IFNγ) production is reduced when exposed to cancer cells expressing the CAR antigen; Compared to T cells constitutively expressing the CAR, the ability to expand in response to exposure to the CAR antigen is enhanced; and / or Compared with T cells constitutively expressing the CAR, T cell exhaustion levels were reduced after exposure to the CAR antigen.

[0328] Naïve T cells are precursors to effector T cells and memory T cell subsets. Phenotypic, naïve T cells typically express certain surface markers, including but not limited to CD45RA, CCR7, CD62L, CD127, and / or CD132. Naïve T cells generally lack the expression of the aforementioned activation markers, including but not limited to CD25, CD44, CD69, CD45RO, and / or HLA-DR. Generally, naïve T cells exhibit low metabolism and do not produce pro-inflammatory cytokines or mediate effector immune responses. In some implementations, intracellular proteins such as FOXP1, ZEB2, and TBX21 are used as markers of naïve T cells.

[0329] Arranged in order of decreasing memory function and increasing effector function, differentiated T cells include stem cell-like memory cells (T cells). SCM ), Central Memory Type (T) CM ), effect memory type (TE) M ) and effector cell type (T) EFF ).

[0330] T cell exhaustion is a broad term used to describe T cell dysfunction caused by chronic stimulation. Exhausted T cells exhibit a distinct phenotype that may include overexpression of inhibitory markers such as PD-1, LAG-3, and TIM-3, as well as impaired ability to release pro-inflammatory cytokines such as IFNγ and TNFα. Exhaustion typically occurs in the tumor microenvironment, where T cells experience loss of cytotoxic function and their ability to effectively kill cancer cells becomes ineffective. See, for example, Wherry EJ, Kurachi M. Molecular and cellular insights into T cell exhaustion, Nat Rev Immunol. 2015 Aug;15(8):486-99, which is incorporated herein by reference in its entirety. Phenotypic markers can be used to differentiate effector T cells from exhausted T cells. These markers include effector CD8+. +High-level expression of biomarkers on T cells includes, but is not limited to, CD44, LY6C, and KLRG1 (Kerber cell lectin-like receptor subfamily G member), but these biomarkers are expressed at low or moderate levels on exhausted T cells. Alternatively, exhausted CD8+ can be used. + T cells express markers, such as inhibitory receptors, at significantly higher levels.

[0331] T-cell markers can help identify and / or quantify different T-cell populations in a given sample. Methods for identifying T-cell subsets are known in the art. See, for example, Mousset et al., Comprehensive Phenotyping of T Cells Using Flow Cytometry, Cytometry A. 2019 Jun;95(6):647-654; Golubovskaya et al., Different Subsets of T Cells, Memory, Effector Functions, and CAR-T Immunotherapy, Cancers (Basel). 2016 Mar 15;8(3):36; Walsh et al., Classification of T-cell activation via autofluorescence lifetime imaging. Nat Biomed Eng. 2021 Jan;5(1):77-88, all of which are incorporated herein by reference.

[0332] Some T cell markers (such as those acting as receptors) are located on the cell membrane. Other T cell markers (such as cytokines) are also secreted. Still other T cell markers (such as transcription factors) are located in the nucleus or cytoplasm. If a T cell is "negative" for a given marker, such as CD19... - This typically means that, compared to reference cells, the T cells either do not express the marker at all or express it in relatively small amounts. Similarly, if T cells are "positive" for a given marker, such as CD19... + This typically means that T cells express the marker at a significantly higher level than reference cells. The reference cell can be another T cell belonging to a different T cell population, or another mammalian cell.

[0333] In the implementation plan, naive T cells can be identified using the following substances: CD62L + CD45RA + CCR7 + CD127 +CD132 + CD25 - CD44 - CD69 - CD45RO - and / or HLA-DR - , or any combination thereof.

[0334] In the implementation scheme, exhausted T cells can be identified by the presence of the following substances: PD-1, CTLA-4, LAG-3, CD39, TIM-3, 2B4 / CD244 / SLAMF4, CD160, TIGIT, or any combination thereof.

[0335] In the implementation scheme, a population of T cells obtained from subjects and engineered to express CAR in response to a small molecule inducer (due to the incorporation of the gene regulatory cassette disclosed herein into the CAR gene) exhibits a phenotype similar to that of a population of T cells obtained from the same patient that were not engineered to express CAR (e.g., a control T cell population obtained from the same patient). In the implementation scheme, the aforementioned characteristics of T cells in said population (containing the inducible CAR expression cassette described herein) are within approximately 5%, approximately 10%, approximately 15%, approximately 20%, or approximately 25% of these characteristics in a T cell population derived from the same patient (not engineered to contain the CAR gene). In other words, the percentage of RiboCAR T cells expressing naive, stem cell-like, and / or exhaustion markers in said population is highly similar to that of T cells derived from the same patient that were not engineered to contain the CAR gene.

[0336] The presence of certain T cell markers and / or the percentage of T cells expressing one or more cell surface markers can be measured using techniques known to those skilled in the art. For example, marker-specific antibodies can be used to stain for the markers in cells, followed by fluorescence activated cell sorting (FACS). Other types of flow cytometry can also be used. Alternatively, the expression of certain markers can be assessed by measuring mRNA levels, for example, using real-time PCR, Northern blotting, DNA microarrays, gene expression serial analysis (SAGE), RNA sequencing, tiling arrays, or other methods known in the art. In some embodiments, marker expression is assessed by analyzing protein levels, for example, using Western blotting, immunoassays (including but not limited to enzyme-linked immunosorbent assays (ELISA)), mass spectrometry, or other methods known in the art. Those skilled in the art can further analyze cytokines secreted by T cells, for example, using any of the techniques disclosed herein, or enzyme-linked immunospot assays (ELISPOT), cytokine capture assays, or intracellular cytokine staining.

[0337] Treatment methods and pharmaceutical compositions On one hand, a method for treating cancer is provided, which involves administering immune cells (e.g., T cells) containing a CAR transgene carrying a gene regulatory cassette as described herein to a patient. However, because the CAR gene sequence contains a gene regulatory cassette, the CAR is not expressed at a significant level; that is, it is in an "off state" in the absence of a specific ligand binding to the aptamer contained within the regulatory cassette riboswitch. CAR expression and T cell activity are only activated upon administration of an aptamer-specific ligand.

[0338] As used herein, the terms “subject” and “patient” are used interchangeably, regardless of whether the subject has received treatment in the past or is currently receiving any form of treatment. As used herein, the terms “subject” and “subjects” can refer to any vertebrate, including but not limited to mammals (e.g., cattle, pigs, camels, alpacas, horses, goats, rabbits, sheep, bovids, hamsters, guinea pigs, cats, dogs, rats and mice, non-human primates (e.g., monkeys, including but not limited to cynomolgus monkeys, chimpanzees, etc.) and humans). Subjects can be human or non-human. In some embodiments, subjects are humans.

[0339] As used herein, the terms “treat,” “treated,” “treating,” and “treatment” refer to therapeutic treatment in which the goal is to slow (alleviate) an unwanted physiological condition, symptom, or disease, or to achieve a beneficial or desired clinical outcome. For the purposes of this invention, beneficial or desired clinical outcomes include, but are not limited to, the reduction of symptoms; a decrease in the severity of the symptom, condition, or disease; stabilization (i.e., non-deterioration) of the state of the symptom, condition, or disease; a delay in the onset or slowing of the progression of the symptom, condition, or disease; an improvement in the state of the symptom, condition, or disease; and remission (partial or complete; whether detectable or undetectable) or enhancement or improvement of the symptom, condition, or disease. Treatment includes eliciting a clinically significant response without excessive side effects. Treatment also includes prolonging survival compared to expected survival without treatment.

[0340] The compositions disclosed herein (including pharmaceutical compositions) may be administered in therapeutically effective amounts. An "effective amount" or "therapeutically effective amount" means an amount of compound or pharmaceutical agent capable of producing a medically desired outcome in a subject receiving treatment. Treatment methods may be performed in vivo or ex vivo, alone or in combination with other drugs or therapies. Therapeutically effective amounts may be administered in single or multiple doses, by application or dosing, and are not intended to be limited to a particular formulation or route of administration.

[0341] Based on the antigen specificity of CARs, RiboCAR T-cell therapy can be used to treat a variety of cancers. In some implementations, RiboCAR T-cell therapy can be used to treat hematologic malignancies, including, for example, leukemia, lymphoma, and multiple myeloma.

[0342] T cells for RiboCAR T-cell therapy can be obtained from a patient's blood using a blood separator. The CAR transgene containing the gene regulatory cassette described herein is introduced into the T cells using known methods. In a preferred embodiment, the CAR transgene containing the gene regulatory cassette is stably integrated into the genome of the T cells. In one embodiment, the CAR transgene containing the gene regulatory cassette is knocked into the TRAC locus, for example, by the methods disclosed herein. After the T cells are modified, the number of T cells can be expanded in vitro, and the modified T cells are subsequently reinfused into the patient, typically via infusion. Because CAR expression levels are low or undetectable in the absence of an inducer, CAR expression during CAR-T cell preparation is avoided, and persistent CAR signaling-induced T-cell differentiation and exhaustion can be prevented.

[0343] In one implementation, the T cells used in RiboCAR T-cell therapy are derived from a healthy donor (allogeneic T cells). In another implementation, RiboCAR T-cell therapy uses the patient's own T cells (autologous T cells).

[0344] Delivery of the CAR gene, including the regulatory cassette described herein, to immune cells (RiboCAR T cells) and the small molecule inducer (ligand) can typically be performed simultaneously or separately in time. The delivery of the inducer will control when and at what level the CAR is expressed. The inducer can be delivered via a variety of routes, including but not limited to intravitreal, intraocular, inhalation, subcutaneous, intramuscular, intradermal, intralesional, surface, intraperitoneal, intravenous (IV), intraarterial, perivascular, intracerebral, intraventricular, oral, sublingual, sublipal, buccal, nasal, intrathoracic, intracardiac, intrathecal, epidural, intraosseous, or intra-articular. In this embodiment, the inducer molecule is delivered orally.

[0345] The timing of inducer delivery will depend on the need to activate the CAR. The presence of the gene regulatory cassette disclosed herein in the CAR transgene allows for temporal control of CAR expression in a manner determined by the timing of aptamer-specific ligand administration. The ability of the CAR transgene to express only upon ligand administration and to modulate expression levels by adjusting the dosage of the ligand (inducer) will increase the safety of CAR T-cell therapy and enhance CAR-T cell function, as described herein, by allowing CAR expression to be shut down in the absence of the ligand (e.g., during the generation of CAR-T cells containing the CAR gene with the regulatory cassette described herein). Furthermore, the safety of T cells with a regulated CAR (RiboCAR) disclosed herein is enhanced because these regulated CAR T cells exhibit stronger cytotoxicity but produce lower levels of cytokines (compared to constitutively CAR-expressing T cells), suggesting that T-cell therapy using the regulated CAR T cells described herein can reduce or avoid cytokine release syndrome (CRS, also known as cytokine storm), a common and serious side effect of standard CAR-T cell therapy, in which the CAR is constitutively expressed by T cells.

[0346] Furthermore, the ability to reduce or even shut down CAR expression by decreasing the dose of the inducer or stopping its administration can restore the function of exhausted CAR-T cells in patients: by controlling CAR expression using the riboswitch disclosed in this paper, simply shutting down CAR expression allows CAR-T cells to undergo intermittent "rest." This intermittent rest allows CAR-T cells to recover when they begin to deplete.

[0347] The small molecule inducers (ligands) described herein are typically combined with one or more pharmaceutically acceptable carriers to form pharmaceutical compositions suitable for administration to patients. Pharmaceutically acceptable carriers include solvents, binders, diluents, disintegrants, lubricants, dispersion media, coating agents, antibacterial and antifungal agents, isotonic agents, and absorption delay agents commonly used in the pharmaceutical industry. Pharmaceutical compositions may be in the form of tablets, pills, capsules, tablets, eye drops, etc., and are formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral, such as intravenous, intradermal, intranasal, subcutaneous, oral, inhalation, transdermal (surface), transmucosal, and ocular administration.

[0348] Pharmaceutical compositions comprising compounds of formulas I–XXII or those in Table 1 are administered to a patient according to a dosing regimen such that an amount of compound sufficient to desirably regulate CAR expression is delivered to the patient. When the dosage form is tablets, pills, etc., preferably, the pharmaceutical composition comprises 0.1 mg to 10 g of the compound; 0.5 mg to 5 g of the compound; 1 mg to 1 g of the compound; 2 mg to 750 mg of the compound; 5 mg to 500 mg of the compound; 10 mg to 250 mg of the compound; or 150 mg to 300 mg of the compound.

[0349] The pharmaceutical composition may be administered once daily or multiple times daily (e.g., 2, 3, 4, 5, or more times daily). Alternatively, the pharmaceutical composition may be administered less frequently than once daily, such as every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days, or once monthly or every few months. In some embodiments, the pharmaceutical composition may be administered to the patient only a small number of times, such as once, twice, three times, etc.

[0350] This article provides a method for treating a patient by administering a population of T cells with induced expression of a CAR gene (due to the presence of the gene regulatory cassette disclosed herein) to the patient for treatment of a patient requiring T-cell therapy. The method further includes administering to the patient a pharmaceutical composition comprising a ligand (inducer) that binds to an aptamer disclosed herein, and wherein the CAR gene contains the gene regulatory cassette disclosed herein, thereby providing the ability to regulate CAR expression in response to the ligand.

[0351] Products and reagent kits Kits or articles of manufacture for use in the methods described herein are also provided. In several aspects, the kits comprise compositions described herein in suitable packaging (e.g., compositions for delivering RiboCAR-T cells comprising a CAR containing a gene regulatory cassette; and compositions for delivering small molecule inducers). Suitable packaging for the compositions described herein is known in the art and includes, for example, vials (such as sealed vials), containers, ampoules, bottles, wide-mouth bottles, flexible packaging (e.g., sealed Mylar or plastic bags), etc. These articles of manufacture may also be sterilized and / or sealed. The kits may also contain reagents for generating the RiboCAR-T cells disclosed herein, including expression cassettes for inducing expression of the RiboCAR disclosed herein.

[0352] Kits containing the compositions described herein are also provided. These kits may also include instructions on how to use the compositions (e.g., the methods and uses described herein). The kits described herein may also include other materials that may be necessary from a commercial and user perspective, including buffers, diluents, filters, needles, syringes, and a packaging insert with instructions on administering the compositions or performing any of the methods described herein. For example, in some embodiments, the kit includes a modifiable RiboCAR expression cassette (knock-into-TRAC locus) in an rAAV HDR donor vector and a CRISPR / cas system for generating RiboCAR-T cells, a pharmaceutically acceptable vector suitable for injection, and one or more of the following: buffers, diluents, filters, needles, syringes, and a packaging insert with instructions on performing the injection. In some embodiments, the kit is suitable for intraocular injection, intramuscular injection, intravenous injection, etc.

[0353] It should be understood and anticipated that those skilled in the art may make variations to the material compositions and methods disclosed herein, and such modifications are intended to be included within the scope of this disclosure. The following examples further illustrate the invention, but should not be construed as limiting the scope of the invention in any way.

[0354] All references cited in this article are incorporated herein by reference in their entirety. Unless otherwise stated, all nucleotide sequences provided herein are 5' to 3' oriented.

[0355] Example Example 1. Riboswitches can respond to small molecule ligands to regulate CAR cell surface expression in HEK 293 cells in a dose-dependent manner. Experimental Procedure The creation of ConstCAR and RiboCAR constructs Gene fragments containing the human EF1α promoter DNA sequence, the 19BBzCAR post-bone growth hormone polyA sequence (bGHpA), or a ribosome were synthesized (IDT) and assembled using the Gibson Assembly Kit (NEB) to produce pEF1α-ConstCAR without a ribosome or pEF1α-RiboCAR containing a ribosome.

[0356] Transfection and flow cytometry One day before transfection, 3.5 × 10 4Personal embryonic kidney (HEK) 293 cells were plated in 96-well flat-bottomed plates. Plasmid DNA (500 ng) was added to test tubes or 96-well U-shaped plates. TransIT-293 reagent (Mirus; 1.4 μL) was added separately to 50 μL of Optimum I medium (Life Technologies) and allowed to stand at room temperature (RT) for 5 minutes. Then, 50 μL of this diluted transfection reagent was added to the DNA, mixed, and incubated at RT for 20 minutes. Finally, 7 μL of this solution was added to the cell wells of the 96-well plate. Four hours after transfection, the medium containing the transfection solution was replaced with fresh medium containing a specified concentration of a small molecule inducer such as compound 004. 24 or 48 hours after transfection, transfected cells were digested with trypsin and stained with PE-labeled monoclonal anti-FMC63 antibody (Acrobiosystems). Flow cytometry analysis was performed using a Guava easyCyte HT flow cytometer and Incyte software (EMD Millipore).

[0357] result The inventors in this case previously developed a synthetic aptamer riboswitching system based on alternative splicing to regulate gene expression via small molecule ligands. Such synthetic riboswitching systems, described, for example, in WO2016 / 126747 and WO2023 / 111686 (each incorporated herein by reference in its entirety), contain an intron-alternate exon-aptamer-intron box, wherein a ligand binding to the aptamer controls the accessibility of the 5' splice site of the 3' intron, thereby allowing regulation of target gene expression through modulation of alternative splicing. Figure 1A Riboswitches have been proven effective in regulating the expression of various genes, such as reporter genes, human Epo genes, human hormone genes, and genes encoding therapeutic antibodies (WO2016 / 126747 and WO 2023 / 111686). Here, a riboswitch is applied to a chimeric antigen receptor (CAR) expression cassette to regulate the expression of CAR receptor molecules in human cells.

[0358] CAR molecules are chimeric receptors, typically containing an extracellular domain for recognizing antigens on target tumor cells, a transmembrane domain, and an intracellular costimulatory and signal transduction domain for activating immune cells. As a proof-of-concept, we selected the well-characterized 19BBz CAR molecule for Examples 1-6. The 19BBz CAR is a second-generation anti-CD19 CAR containing an FMC63 single-stranded variable fragment (scFv), an intracellular 4-1BB costimulatory domain, and a CD3ζ signal transduction domain. These domains are linked together by a CD8α hinge and a transmembrane domain sequence. Figure 1BThis CAR molecule is delivered to human T lymphocytes via a lentiviral vector, thereby producing the FDA-approved CAR-T cell product Tisagenlecleucel (Kymriah).

[0359] Gene regulatory cassettes containing a riboswitcher with aptamer N5-12G6 (WO2023 / 111686) are inserted into the following eight locations in the CAR coding sequence: between nucleotides 148 and 149 (RiboCAR-1), between nucleotides 389 and 390 (RiboCAR-2), between nucleotides 571 and 572 (RiboCAR-3), between nucleotides 655 and 656 (RiboCAR-4), between nucleotides 1087 and 1088 (RiboCAR-5), between nucleotides 1220 and 1221 (RiboCAR-6), between nucleotides 1293 and 1294 (RiboCAR-7), or between nucleotides 1348 and 1349 (RiboCAR-8), to generate RiboCAR-1 through RiboCAR-8 constructs, respectively.

[0360] First, we tested the expression of CAR molecules on the cell surface of these eight constructs in HEK 293 cells in response to the ribo-switching small molecule inducer compound 004. For example... Figure 2A As shown, regardless of the presence or absence of the riboswitching inducer, CAR expression levels in HEK 293 cells transfected with the RiboCAR-6 construct were the same as those in cells transfected with the ConstCAR construct, indicating the lack of riboswitching for CAR expression regulation. In the absence of compound 004, cells transfected with RiboCAR-2, 5, 7, and 8 also expressed CAR, but at reduced levels; however, treatment with compound 004 increased CAR expression levels. In contrast, HEK 293 cells transfected with the RiboCAR-1 or RiboCAR-3 constructs did not express CAR in the absence of the riboswitching inducer compound 004, but expressed CAR at high levels in its presence. These results suggest that the gene regulatory cassette containing the riboswitching inducer is particularly effective in inducing CAR expression when located between nucleotides 148 and 149 (RiboCAR-1) or between nucleotides 571 and 572 (RiboCAR-3) in the CAR coding sequence.

[0361] To further enhance the induction of CAR expression levels, the ribo-switch cassette was modified by adding base pairs to the effector stem (aptamer P1 stem) region of the RiboCAR-3 construct, thereby generating the RiboCAR-9 construct. Figure 2BAs shown, in the absence of compound 004, no CAR molecules were detected on the cell surface of HEK 293 cells expressing RiboCAR-1, 3, or 9, respectively. However, treatment with compound 004 induced high levels of CAR expression, with the RiboCAR-9 construct exhibiting the highest CAR expression level among the three constructs. Furthermore, the RiboCAR-9 construct expressed CAR in a dose-dependent manner in response to compound 004. Additionally, when treated with 25 µM compound 004, the CAR expression level in cells expressing the RiboCAR-9 construct reached the CAR expression level in cells expressing ConstCAR, which lacks a ribosome switch and constitutively expresses CAR ( Figure 1B , 3A (And 3B). The RiboCAR-9 construct was selected for further testing.

[0362] Example 2. The RiboCAR construct was able to induce and reversibly express CAR molecules in Jurkat T cells. The expression of CARs in response to various small molecule compounds disclosed herein was tested in a lymphocyte-associated cell line (Jurkat cells) transfected with the RiboCAR-9 construct. Figure 4A As shown, in the absence of riboswitching inducers, Jurkat T cells transfected with the RiboCAR-9 construct did not express CAR molecules on their cell surface. However, when treated with the specified inducer compounds, the cells expressed CAR. Compounds 074, 076, 111, and 114 were particularly potent in inducing CAR expression in Jurkat cells. Figure 4A and 4B To further test the kinetics of riboswitch-regulated CAR expression, we generated stable Jurkat cell lines by knocking in RiboCAR-9 or ConstCAR expression cassettes into the TRAC locus, respectively. Consistent with transient transfection experiments, Jurkat T cells stably transfected with RiboCAR-9 did not express CAR on their cell surface in the absence of compound 004. Treatment of cells with compound 004 induced CAR expression on the cell surface of stably transfected Jurkat cells in a dose-dependent manner. Figure 4C Removal of the small molecule inducer caused a rapid decrease in CAR surface expression in Jurkat cells stably transfected with RiboCAR-9. Figure 4D and 4E This data demonstrates the inducibility and reversibility of CAR expression regulation by small molecule compounds through riboswitch.

[0363] Example 3. Riboswitch-controlled CAR will prevent T cell exhaustion induced by persistent CAR signaling during CAR-T cell expansion. Experimental procedure: AAV carrier The AAV plasmid, containing an AAV2 inverted terminal repeat (ITR) sequence and an EF1a promoter-driven RiboCAR cDNA or ConstCAR cDNA, was cloned using Gibson assembly technology. The 3' end of the plasmid is a bovine growth hormone polyA signal (bGHpA). Homologous arms of the TRAC locus genome, laterally attached to the Cas9 target site, were cloned in a reverse orientation, lateralizing them to the promoter-CAR-polyA cassette. The left homologous arm is 302 bp and the right homologous arm is 304 bp. The AAV genome was then packaged into an AAV6 capsid (SignaGen Laboratories).

[0364] Preparation of RNP Following the IDT RNP complex preparation protocol, RNPs are generated by combining two components, gRNA (crRNA and tracrRNA, synthesized by IDT), with Alt-R Cas9 (IDT). The RNP complex contains 30 pmol / µl gRNA and 25 pmol / µl Alt-R Cas9 enzyme.

[0365] Production of CAR-T cells Twenty-four hours after thawing, human peripheral pan-T cells (Stemcell Technologies) were activated in Lonza medium containing Dynabeads (1:1 magnetic beads:cells) human T activator CD3 / CD28 (ThermoFisher). The medium was supplemented with 5% human serum (Valley Biomedical), 200 U / ml IL-2 (R&D), 5 ng / ml IL-7, and 5 ng / ml IL-15 (R&D), at a cell density of 0.5 to 1 × 10⁻⁶ cells / year. 6 Cells / mL. Change the culture medium every 2 days and increase the cell rate to 0.5 to 1 × 10⁶ cells / mL. 6Re-coating was performed. Forty-eight hours after initial T cell activation, CD3 / CD28 beads were magnetically removed, and T cells were resuspended in P3 primary cell 4D-Nucleofector™ solution, using 20 μl buffer per million cells. 20 μl of P3 buffer containing 1 million T cells was mixed with 2 μl of RNP complex and electroporated using a 4D-Nucleofector™ X device (Lonza, EO-15 program). After electroporation, cells were diluted in T cell culture medium free of exogenous cytokines and incubated at 37°C and 5% CO2 for 1 hour. One hour after electroporation, recombinant AAV6 donor vector containing ConstCAR or RiboCAR expression cassettes and homologous arms was added at 1 × 10⁻⁶ cells / mL. 5 The multiple of infection (MOI) was added to T cells in RPMI 1640 medium and incubated at 37°C and 5% CO2 for 3 to 4 hours. Subsequently, the edited cells were cultured under standard conditions and expanded in T cell growth medium. Medium was replenished every 2 to 3 days as needed to maintain approximately 1 × 10⁻⁶ cells / mL. 6 The density of individual cells.

[0366] Antibodies and flow cytometry The following antibodies were used to determine CAR expression and T cell phenotype: PE-labeled anti-FMC63 antibody (Acrobiosystems), APC-labeled anti-human CD62L antibody (eBiosciences), FITC-labeled anti-human CD45RA antibody (Invitrogen), APC-labeled anti-human CD39 antibody (eBiosciences), and APC-labeled anti-human TCRα antibody (eBiosciences). (The last part, "2×10," appears to be a typo and should be removed.) 4 Two hundred microliters of T cell growth medium were used to treat the cells with a specified concentration of riboswitch inducer compound 004 and maintained under normal culture conditions for 24 hours. The treated T cells were then stained with a fluorescently labeled antibody at 4°C for 30 minutes and analyzed by flow cytometry using a Guava easyCyte HT.

[0367] result Using the CRISPR / Cas9 system and the rAAV6 HDR donor vector, complementary DNA (cDNA) driven by the EF1a promoter in ConstCAR or RiboCAR containing a riboswitch cassette was targeted to the TRAC locus to generate T cells with knock-in CAR gene and simultaneous knockout of endogenous T cell receptor (TCR).

[0368] First, the expression of CAR on the cell surface of engineered T cells was examined. To assess CAR expression on the cell surface of primary T cells, RiboCAR-T cells were treated with increasing concentrations of compound 004 for 20 hours four days after CAR gene targeting, and their phenotype was examined five days after CAR gene targeting. Figure 5A and 5B As shown, in the absence of the riboswitching inducer compound 004, CAR was not detected on the cell surface of RiboCAR-T cells, indicating that the CAR gene in the engineered T cells was completely switched off. However, in the presence of compound 004, RiboCAR-T cells robustly expressed CAR on the cell surface. Furthermore, the induced CAR expression level corresponded to the concentration of the riboswitching inducer, indicating that the small molecule induced the riboswitching regulation of CAR expression in primary human T cells.

[0369] To determine whether the phenotype of RiboCAR-T cells generated in the absence of an inducer (i.e., where CAR gene expression is turned off) differs from that of constitutively CAR-expressing T cells, we examined the expression of CD62L and CD45RA on T cells. Figure 6A As shown, CD62L in RiboCAR-T cell populations that were not treated with or treated with compound 004 + The proportion of cells was high. Approximately 52% of the cells in the population (not treated with compound 004) or CAR + Cells (treated with compound 004) are CD45A + CD62L + The cells are primarily composed of naive T cells and stem cell-like memory T cells (naive / Tscm cells). Approximately 17% of the cells in this population are CD45RA. – CD62L – The cells are primarily composed of effector memory T cells. RiboCAR-T cells exhibit a low-differentiation phenotype rich in naive / stem cell-like memory T cells, unlike T cells that have not undergone CAR engineering. Figure 6A The phenotypes of T cells transduced using the same method were essentially identical. In contrast, T cells engineered with ConstCAR showed a higher degree of differentiation and produced a significantly lower percentage of CD45A. + CD62L + Cells (approximately 11%) and a high percentage of CD45RA – CD62L –These cells (approximately 47%) are the majority of highly differentiated effector memory T cells. In addition to their highly differentiated phenotype, ConstCAR-T cells also have a higher proportion expressing CD39 (48%), a marker of T cell exhaustion that suppresses T cell function. In contrast, only a small percentage of RiboCAR-T cells or T-mimicking cells express CD39. Figure 6B These results indicate that RiboCAR-T cells in the off state essentially avoid persistent CAR signaling and prevent persistent CAR signaling-induced T cell differentiation, thereby maintaining CAR-T cell function.

[0370] Example 4: Compared with ConstCAR-T cells, RiboCAR-T cells exhibit stronger cytotoxicity against tumor cells and produce lower levels of cytokines. Experimental Procedure Cytotoxicity assay The cytotoxicity of CAR-T cells was measured using a standard luciferase assay. This assay used Raji cells (Raji-ffLuc) expressing firefly luciferase as target cells. Raji-ffLuc cells were generated by stable transfection of Raji cells (ATCC) with firefly luciferase cDNA driven by the CMV promoter. In short, effector (E) and tumor target (T) cells were co-cultured in triplicate in 96-well flat-bottom plates at a 2:1 E:T ratio, with each well containing 1 × 10⁻⁶ cells. 4 Target cells were cultured in exogenous cytokine-free medium, with a total volume of 200 μl. Target cells were individually plated at the same cell density to determine maximum luciferase expression (relative light units; RLUmax). After 48 hours, the supernatant was collected for cytokine assay, and 100 μl of luciferase substrate (Bright-Glo, Promega) was added to the cell pellet in each well. Emitted light was measured and quantified using a Tecan instrument with an integration time of 500 ms. Cytotoxicity / lysis was determined by the following formula: (1 - (RLU sample) / (RLUmax)) × 100.

[0371] Cytokine secretion assay After CAR-T cells and Raji-ffLuc were co-cultured for 48 hours, the supernatant was collected from the cytotoxicity assay and IL-2 and IFNγ were measured using the Human IL-2 or IFN-γ Quantikine ELISA Kit (R&D System) according to the manufacturer’s instructions.

[0372] Antigen stimulation and CAR-T cell proliferation assayFor repeated antigen-stimulated amplification assays, on day 0, Raji cells were treated with 8 µg / ml mitomycin C (Sigma) at 37°C for 2 hours and washed twice with PBS. Then, 2 × 10⁻⁶ cells were... 5 Raji cells treated with mitomycin C were plated into 12-well plates and then spread with 2 × 10⁶ cells per well. 5 The engineered T cells were co-cultured in 2 ml of cytokine-free T cell culture medium containing 2.8 or 8.3 µM compound 004. On day 3, viable CAR-T cells were counted using trypan blue and 2 × 10⁶ cells were cultured. 5 CAR-T cells and 2×10 5 Freshly prepared Raji cells treated with mitomycin C were then mixed into the same fresh culture medium containing compound O04 used on day 0. This process was repeated for a total of three rounds of stimulation. The absolute number of live T cells after three days of culture was divided by the number of CARs seeded at the time of co-culture. + The fold increase after each stimulation was calculated using the absolute number of T cells. This was achieved by using 2 × 10⁻⁶ cells... 5 Multiply by the CAR determined by flow cytometry + The percentage of T cells determines the CAR inoculation. + The absolute number of T cells is calculated by multiplying it by the amplification factor after each round of stimulation, thus determining the cumulative amplification factor.

[0373] result To assess the antigen-induced cytotoxicity and cytokine secretion of RiboCAR-T cells, as well as the effect of CAR expression levels on CAR-T cell function, RiboCAR-T or ConstCAR-T cells were treated with CD19 cells expressing firefly luciferase, either in the absence of the compound 004 or in the presence of increasing concentrations. + Target cells Raji (Raji-ffLuc) were co-cultured at a 2:1 effector-to-target cell ratio (E:T ratio). In this cytotoxicity assay, RiboCAR-T cells were not pretreated with a riboswitching inducer to induce CAR expression. Instead, RiboCAR-T cells, target Raji cells, and the riboswitching inducer were added together during co-culture. Figure 7AAs shown, in the absence of a riboswitching inducer, RiboCAR-T cells did not exhibit cytotoxic activity against target Raji-ffLuc cells. In the presence of the riboswitching inducer compound 004, RiboCAR-T cells induced robust tumor cell lysis in a dose-dependent manner. In contrast, ConstCAR-T cells exhibited cytotoxic activity regardless of the presence of the riboswitching inducer, but ConstCAR-T cells showed lower target cell killing activity (approximately 20%) compared to RiboCAR-T cells treated with the riboswitching inducer compound 004. Figure 7A These results indicate that riboswitches can regulate the cytotoxic function of CAR-T cells by modulating CAR expression, and that CAR-T cells controlled by riboswitches are more effective at killing tumor cells than CAR-T cells with uncontrolled CAR expression.

[0374] Furthermore, the secretion of cytokines IL-2 and INFγ by antigen-induced CAR-T cells was determined. As mentioned above, the cytotoxic activity of RiboCAR-T cells requires the co-existence of the tumor antigen and the riboswitching inducer. Similarly, RiboCAR-T cells only secrete cytokines IL-2 and INFγ in the co-existence of the tumor antigen and the riboswitching inducer. Moreover, upon exposure to increasing concentrations of the riboswitching inducer compound 004, cells released cytokines in a dose-dependent manner. Figure 7B and 7C Notably, RiboCAR-T cells treated with compound 004 produced significantly lower levels of IL-2 and IFNγ than ConstCAR-T cells released cytokines. Given that conventional CAR-T cell therapy is known to cause cytokine release syndrome, the reduced cytokine secretion of RiboCAR-T cells could potentially avoid this toxicity induced by CAR-T cell therapy.

[0375] Next, the expansion capacity of RiboCAR-T cells after tumor antigen stimulation was evaluated in vitro. Figure 7D As shown, RiboCAR-T cells expanded approximately 218-fold after three rounds of antigen stimulation, while ConstCAR-T cells were exhausted after the third round of antigen stimulation. This strong antigen-stimulated proliferation and expansion capacity of RiboCAR-T cells is consistent with their low degree of differentiation and stem cell-like memory T cell phenotype, which has been shown to be associated with the efficacy of CAR-T cell therapy.

[0376] In summary, these in vitro assays demonstrate that regulating CAR expression can modulate CAR-T cell function. RiboCAR-T cells generated in the absence of riboswitching inducers, while lacking CAR expression, exhibited excellent cytotoxicity against tumor cells and strong antigen-stimulated amplification capacity, but with reduced release of inflammatory cytokines. Therefore, riboswitched CAR-T cells could provide a more effective and safer option for CAR-T cell therapy.

[0377] Example 5. RiboCAR-T cells outperform ConstCAR-T cells in in vivo anti-tumor efficacy. Experimental Procedure The method for generating RiboCAR-T and ConstCAR-T cells is as described in Example 2. T cells are expanded in culture without the addition of riboswitch inducers, such as compound 004.

[0378] Human lymphoma mouse xenograft model Animal experiments were conducted at the Mispro Animal Facility according to protocols approved by the Mispro Institutional Animal Care and Use Committee. 1×10 6 One Raji-ffLuc cell was injected via tail vein into 8-10 week old female NOD / SCID / IL2Rγ cells. - / - (NSG) mice (Jackson Laboratory). Four days after Raji cell implantation, mice were administered a carrier (0.5% methylcellulose (viscosity: 400 cP) and 0.25% Tween 80) or 100 mg / kg of compound 004 prepared in the carrier via oral feeding once daily. Four hours after the first administration of the inducer, 2 × 10⁻⁶ cells were administered. 6 CAR + T cells were intravenously infused into mice carrying Raji cells. Tumor progression or regression was monitored using bioluminescence imaging with the LI-COR Pearl Trilogy imaging system, and quantification was performed using Image Studio Ver 5.2 (LI-COR). Mice were euthanized when they exhibited persistent arched back posture, persistent ruffled fur, paralysis, movement disorders, or weight loss exceeding 20%.

[0379] result In a human B-cell lymphoma xenograft mouse model, the antitumor efficacy of riboswitch-regulated CAR-T cells (RiboCAR-T cells) and constitutively CAR-expressing T cells (ConstCAR-T cells) was compared. 1×106 10 Raji-ffLuc cells were injected into NSG mice via tail vein injection, and 4 days later, the mice were orally administered a riboswitch small molecule inducer, followed by an injection of 2×10⁻⁶ cells 4 hours later. 6 CAR-T cells. For example Figure 8A As shown, 7 days after CAR-T cell injection, mice injected with ConstCAR-T cells exhibited less tumor growth in this type of lymphoma mouse compared to mice injected with control mimic T cells or RiboCAR-T cells not treated with riboswitch inducers, indicating the anti-tumor function of ConstCAR-T cells. However, in mice injected with the same number of RiboCAR-T cells but with those cells treated with the small molecule inducer compound 004, the tumor burden was even lower than in mice injected with ConstCAR-T cells. Furthermore, 7 days after CAR-T cell injection, further tumor regression was observed in the RiboCAR-T group treated with compound 004, while tumors in the control T cell group and the RiboCAR-T group not treated with compound 004 showed significant progression. Tumor progression was also observed in mice injected with ConstCAR-T cells 7 days after CAR-T cell injection, indicating that tumor growth was inhibited. Figure 8A Furthermore, prolonged survival was observed in the mouse group that received RiboCAR-T cells and small molecules. Figure 8B ).

[0380] These results from in vivo anti-tumor studies demonstrate that RibCAR-T cells possess potent anti-tumor functions, which only emerge in the presence of small molecule inducers. Furthermore, these results confirm that RibCAR-T cells generated in the absence of riboswitching inducers and therefore do not express CAR on T cells outperform constitutively CAR-T cells during in vitro expansion, indicating that integrating the gene-regulating riboswitching cassette disclosed herein into CAR during CAR-T cell fabrication can significantly improve CAR-T cell therapy.

[0381] Example 6. Riboswitch inducers remotely modulate the in vivo antitumor efficacy of RiboCAR-T cells in a dose-dependent manner. Experimental Procedure RiboCAR-T and ConstCAR-T cells were generated as described in Example 2. The T cells were then expanded in a culture without the addition of a riboswitching inducer, such as MXU-001 (also referred to herein as compound 004).

[0382] Human lymphoma mouse xenograft modelAnimal experiments were conducted at the Mispro Animal Welfare Centre according to protocols approved by the Mispro Institute's Animal Care and Use Committee. 1×10 6 Raji-ffLuc cells were injected via tail vein into 8-10 week old female NOD / SCID / IL2Rγ- / - (NSG) mice (Jackson Laboratory). For three days post-implantation, mice were administered a carrier (0.5% methylcellulose (viscosity: 400 cP) and 0.25% Tween 80) or a small molecule inducer prepared in the carrier at 30 mg / kg or 100 mg / kg once daily via oral feeding. Sixteen hours after the first administration of the inducer, 2 × 10⁻⁶ cells were injected into the mice. 6 CAR + RiboCAR-T cells were intravenously infused into mice carrying Raji cells. IVIS was used. ® The Lumina III imaging system (PerkinElmer) monitors tumor progression or regression using bioluminescence imaging and utilizes Living Image. ® 4.7.4 Tumor burden was analyzed and quantified using software (PerkinElmer). Mice were euthanized when they exhibited persistent arched back posture, persistent ruffled fur, paralysis, movement disorders, or weight loss exceeding 20%.

[0383] result The antitumor efficacy of riboswitched CAR-T cells (RiboCAR-T) in response to various doses of orally administered riboswitching inducers compounds 004 and 111 was evaluated in a mouse xenograft model of human B-cell lymphoma, identical to that in Example 5. NSG mice were inoculated with 1 × 10⁻⁶ riboswitching inducers via tail vein injection. 6 Raji-ffLuc cells were orally administered daily with varying doses of a small molecule ribo-switching inducer, with the first dose administered at an injection of 2 × 10⁶. 6 The process begins 20 hours before the start of the CAR-T cell therapy.

[0384] Six days after CAR-T cell injection, mice injected with ConstCAR-T cells showed less tumor growth compared to mice injected with control mimic T cells or RiboCAR-T cells not treated with riboswitch inducers, confirming the anti-tumor function of ConstCAR-T cells. Figure 9A-D). In mice injected with the same dose of RiboCAR-T cells but orally administered the small molecule inducer compound 004 or compound 111, the tumor burden was significantly lower than that in mice injected with RiboCAR-T cells but not treated with the inducer, or in the T-cell mimicry control group, indicating that the antitumor activity of RiboCAR-T cells is enhanced in the presence of riboswitching inducers. Furthermore, no tumor growth was detected in mice treated with higher doses of compound 004 or compound 111, indicating that riboswitching-controlled CAR-T cells have potent dose-responsive antitumor efficacy. Additionally, at 9 days post-CAR-T cell injection, significant tumor progression was observed in both the T-cell mimicry control group and the RiboCAR-T group not treated with the inducer. Tumor progression was also observed in mice injected with ConstCAR-T cells and in the RiboCAR-T group treated with low doses of the inducer, while tumor regression was maintained in the RiboCAR-T group treated with 100 mg / kg of compound 004 or compound 111. Figure 9E and 9F Consistent with the results in Example 5, RiboCAR-T cells exposed to 100 mg / kg inducer were superior to ConstCAR-T cells (2 × 10⁻⁶) in clearing tumor cells. 6 CAR + T cells). Due to the excellent anti-tumor activity of RiboCAR-T cells, a significant increase in survival was observed in mice treated with the inducing agent. Figure 10 These results from in vivo anti-tumor studies further demonstrate that RibCAR-T cells possess potent anti-tumor efficacy and can be remotely controlled via oral delivery of riboswitching inducers.

[0385] Example 7. The RiboCAR construct can inducibly and reversibly express anti-HER2 CAR. Experimental procedure: Generation of ConstCAR and RiboCAR targeting HER2 constructs The scFv in the 19BBz CAR was replaced with the sequence of the anti-HER2 antibody clone 4D5-8 to generate pEF1α-HER2 ConstCAR (riboswitching cassette-free). A gene fragment (IDT) containing the riboswitching cassette DNA sequence was synthesized and assembled using a Gibson Assembly Kit (NEB) to generate pEF1α-HER2 RiboCAR containing the riboswitching cassette.

[0386] Transfection and flow cytometry As described in Example 1.

[0387] result: To further test the general applicability of using riboswitches to regulate CAR expression and CAR-T cell activity, we generated several RiboCAR constructs targeting the HER2 antigen, which is highly expressed in various tumor types. To generate these anti-HER2 CAR constructs, variable heavy and light chain domain sequences of an anti-HER2 clone 4D5-8 antibody were used. Gene regulatory cassettes containing a riboswitcher with aptamer N5-12G6 (SEQ ID NO: 592) (disclosed in PCT Publication No. WO2023 / 111686, the entire disclosure of which is incorporated herein by reference) were inserted into different positions in the HER2 CAR coding sequence (SEQ ID NO: 1186): between nucleotides 148 and 149 (HER2-RiboCAR-A), between nucleotides 188 and 189 (HER2-RiboCAR-B), between nucleotides 376 and 377 (HER2-RiboCAR-C), and between nucleotides 568 and 569 (HER2-RiboCAR-D), respectively, to produce HER2-RiboCAR constructs - HER2 RiboCAR-A to HER2-RiboCAR-D. The aptamer stem (effectant) in these constructs is 9 base pairs in length. The ribosomes HER2-RiboCAR-E to HER2-RiboCAR-J are generated by inserting nucleotides 568 and 569 (HER2-RiboCAR-E), 588 and 589 (HER2-RiboCAR-F), 634 and 635 (HER2-RiboCAR-G), 706 and 707 (HER2-RiboCAR-H), 740 and 741 (HER2-RiboCAR-I), or 776 and 777 (HER2-RiboCAR-J) into the stem region of the aptamer (effector) with one extra base pair (total stem length of 10 base pairs (bp)).

[0388] First, the expression of anti-HER2-CAR molecules on the cell surface of these ten HER2-RiboCAR constructs in HEK 293 cells in response to the riboswitching small molecule inducer compound 004 was tested. In the absence of the small molecule inducer compound 004, the expression of HER2-CAR molecules on the cell surface of HEK 293 cells transfected with different HER2-RiboCAR constructs was either undetectable or at very low levels. Figure 11 However, when treated with compound 004, the CAR expression level in cells transfected with the HER2-RiboCAR construct increased in a dose-dependent manner. Figure 11These test results indicate that when the riboswitch is located at the positions listed above, it regulates CAR expression.

[0389] Example 8. HER2-targeting RiboCAR-T cells exhibit stronger cytotoxicity against tumor cells than T cells constitutively expressing HER2CAR. Experimental Procedure Generation of AAV vectors, RNP complexes, and CAR-T: Human primary CAR-T cells were generated using the ConstCAR construct constitutively expressing anti-Her2 CAR and the RiboCAR construct HER2 CAR-D. The procedure was as described in Example 3.

[0390] Cytotoxicity assay The cytotoxicity of CAR-T cells was measured using the CellTiter-Glo cell viability assay (Promega) with HER2-positive Calu-3 cells as tumor target cells. In short, 1 × 10^4 target cells were seeded the day before co-culture. Triple copies were prepared using 96-well flat-bottom plates to transfer the effector (…). E ) and tumor target cells ( T ) at 2:1 E:T Ratio co-culture was performed, with each well supplemented with 200 μl of medium containing exogenous cytokines and escalating concentrations of compound 111. After 48 hours, cell viability was measured using the CellTiter-Glo kit according to the manufacturer's instructions. Emitted light was measured and quantified using a Tecan instrument with an integration time of 500 ms. Cytotoxicity / lysis was determined by the following formula: (1-(RLU) 样品 ) / (RLU 模拟T ))×100.

[0391] Cytokine secretion assay: After co-culturing CAR-T cells and Calu-3 cells for 48 hours, the supernatant was collected from the cytotoxicity assay. IFN-γ was measured using the Human IFN-γ Quantikine ELISA Kit (R&D System) according to the manufacturer's instructions.

[0392] result: Using the CRISPR / Cas9 system and the rAAV6 HDR donor vector, EF1a promoter-driven HER2ConstCAR or EF1a promoter-driven RiboCAR was targeted to the TRAC locus. This resulted in T cells with the HER2 CAR or RiboCAR gene knocked in and the endogenous T cell receptor (TCR) knocked out, respectively.

[0393] To assess the expression of HER2 CAR on the cell surface of primary T cells, RiboCAR-T cells were treated with or without 25 µM compound 004 for 20 hours three days after CAR gene targeting to induce CAR expression. Figure 12A As shown, in the absence of the riboswitch inducer compound 004, CAR was not detected on the cell surface of RiboCAR-T cells, indicating that the HER2 CAR gene in the engineered T cells was completely switched off, a phenomenon observed using CD19 RiboCAR. However, in the presence of compound 004, RiboCAR-T cells expressed CAR vigorously on the cell surface, indicating that the riboswitch regulation of CAR expression in primary human T cells induced by the small molecule was switched on.

[0394] Furthermore, based on CD69 expression indicators, RiboCAR-T cells were more robustly activated by the HER2 antigen on target Calu-3 cells in the presence of the inducer compound 111 (also known as M310) compared to ConstCAR-T cells. Figure 12B The observed difference in T cell activation between RiboCAR-T cells and ConstCAR-T cells suggests that RiboCAR-T cells expanded in the absence of small molecule inducers (i.e., expanded without CAR molecule expression) are more active and functional than ConstCAR-T cells, which may differentiate and be exhausted due to persistent CAR signaling.

[0395] To evaluate the effects of antigen-induced cytotoxicity and cytokine secretion of RiboCAR-T cells, as well as the influence of CAR expression levels on CAR-T cell function, RiboCAR-T or ConstCAR-T cells were in the absence or presence of different concentrations of compound 111, respectively, with HER2. + Calu-3 cells were co-cultured for 48 hours at an effector-to-target cell ratio of 2:1 (E:T ratio). During co-culture, T cells, target Calu-3 cells, and the small molecule inducer were added together. In the absence of the riboswitching inducer, RiboCAR-T cells did not exhibit any cytotoxicity or cytotoxicity against target Calu-3 cells. Figure 12C and 12E In contrast, in the presence of the riboswitch inducer compound 111, RiboCAR-T cells induce robust tumor cell lysis in a dose-dependent manner. Figure 12C and 12EIn contrast, ConstCAR-T cells exhibited cytotoxic activity regardless of the presence of a riboswitching inducer, but their target cell killing activity was lower (approximately 30%) compared to RiboCAR-T cells treated with the riboswitching inducer compound 111. Figure 12D Similar results were observed at lower E:T ratios. Figure 12E These results indicate that riboswitches can regulate the cytotoxic function of CAR-T cells by modulating CAR expression. Furthermore, this data suggests that riboswitched CAR-T cells are more effective at killing tumor cells than CAR-T cells constitutively expressing CAR.

[0396] The cytotoxic activity of RiboCAR-T cells requires the simultaneous presence of tumor antigens and riboswitch inducers. Figure 12E Therefore, the secretion of the cytokine IFN-γ by antigen-induced CAR-T cells was also determined. RiboCAR-T cells only secrete IFN-γ in the presence of both tumor antigen and riboswitching inducer. Figure 12F Furthermore, when exposed to the riboswitching inducer compound 111, RiboCAR-T cells release cytokines in a dose-dependent manner. Figure 12F It is noteworthy that RiboCAR-T cells treated with lower inducer concentrations produced lower levels of IFN-γ, but their cytotoxic activity against tumor cells was higher than that of ConstCAR-T cells, which is the same as observed using CD19 CAR-T cells.

[0397] These results demonstrate that regulating CAR expression can modulate CAR-T cell function. RiboCAR-T cells expanded in the absence of small molecule inducers (i.e., without CAR expression) exhibited excellent cytotoxicity against tumor cells, but with reduced release of inflammatory cytokines. Furthermore, these data suggest that riboswitching-regulated CAR expression and CAR-T cell activity are not limited to specific CARs, highlighting the broad applicability of riboswitching technology in CAR-T cell therapy.

[0398] Example 9. Small molecule inducers can remotely regulate the targeting of HER2. + In vivo antitumor activity of RiboCAR-T cells in tumors Experimental procedure: As described in Example 8, RiboCAR-T and ConstCAR-T cells targeting the HER2 antigen were generated. The T cells were then expanded in a culture without the addition of a riboswitching inducer, such as MXU-001 (compound 004).

[0399] Human HER2 + Solid tumor mouse xenograft model Animal research was conducted at the Mispro Animal Research Institute according to protocols approved by the Mispro Institutional Animal Care and Use Committee. (2.5 × 10) 6 Calu-3 cells were subcutaneously injected into 8- to 10-week-old female NOD / SCID / IL2Rγ cells. - / - In (NSG) mice (Jackson Laboratory), Calu-3 cells were implanted and administered orally once daily for 7 days. The mice were given either a carrier (0.5% methylcellulose (viscosity: 400 cP) and 0.25% Tween 80) or 300 mg / kg of MXU-001 or M310 (compound 111) prepared in the carrier. Six hours after the first administration of the inducer, 2 × 10⁻⁶ cells were administered. 6 CAR + RiboCAR-T cells or ConstCAR-T cells were intravenously infused into mice carrying Calu-3 tumors. Tumor progression or regression was monitored, and tumor volume was calculated as follows: V (mm²) 3) =L (mm)×W (mm)^2*3.14 / 6.

[0400] result: To evaluate the effects of orally administered riboswitching inducers MXU-001 and M310, HER2-targeting riboswitching modulates the antitumor activity of CAR-T cells (RiboCAR-T) against solid tumors. Therefore, 2.5 × 10⁻⁶ cells were used. 6 Calu-3 cells were subcutaneously injected into NSG mice, and the mice were orally administered 300 mg / kg of either the ribo-switching small molecule inducer MXU-001 or M310 daily. The first dose was administered by injecting 2 × 10⁻⁶ cells into each mouse. 6 Administer ConstCAR-T or RiboCAR-T cells 6 hours prior to administration.

[0401] Eight days after CAR-T cell injection, mice injected with ConstCAR-T cells showed less tumor growth compared to mice injected with control T-cell simulators or RiboCAR-T cells not treated with riboswitching inducers, confirming the antitumor activity of ConstCAR-T cells. In contrast, no antitumor activity of RiboCAR-T cells was observed in the absence of riboswitching inducers. However, compared to mice injected with RiboCAR-T cells but not treated with inducers or the T-cell simulator control group, tumor growth was significantly reduced in mice injected with RiboCAR-T cells and subsequently orally administered the small molecule inducers MXU-001 or M310, respectively. This data indicates that RiboCAR-T cells possess antitumor activity in mice treated with riboswitching inducers. By day 13 after CAR-T cell injection, tumors in both the T-cell simulator control group and the RiboCAR-T group not treated with inducers showed significant progression. In contrast, in the RiboCAR-T groups treated with MXU-001 or M310, respectively, tumor progression was paused, and the tumors were eliminated. Figure 13A and 13B Consistent with the results in Example 5, RiboCAR-T cells treated with a small molecule inducer were superior to the same dose of ConstCAR-T cells (2 × 10⁻⁶) in clearing tumor cells. 6 (1 CAR+ T cells). Due to the excellent anti-tumor activity of RiboCAR-T cells, a significant increase in survival was observed in mice treated with the inducing agent (data not shown).

[0402] These results from in vivo antitumor studies further demonstrate that RibCAR-T cells targeting solid tumors possess potent antitumor activity, which can be remotely controlled by oral administration of ribo-switching inducers. The antitumor efficacy of CAR-T cells targeting the HER2 antigen on solid tumors is comparable to that of RiboCAR-T cells targeting the CD19 antigen on liquid tumors, as observed.

[0403] In summary, these results confirm that incorporating a riboswitcher into the CAR gene and expanding CAR-T cells in the absence of a riboswitcher inducer (i.e., without CAR molecule expression on T cells) can significantly enhance the antitumor activity of CAR-T cells and the efficacy of CAR-T cell therapy. As shown in this article, using a riboswitcher and a small molecule inducer can not only tightly regulate CAR expression in a dose-dependent manner, but also finely tune RiboCAR expression levels using small molecules. Compared to ConstCAR-T cells, RiboCAR-T cells also exhibited more naive / stem cell memory T cell phenotypes in cultures. Furthermore, RiboCAR-T cells... exist It exhibits stronger cancer cell killing activity both in vitro and in vivo. exist The levels of cytokines released after stimulation by tumor cells in vitro were low, and exist It exhibits a higher capacity to stimulate tumor cell proliferation in vitro. Importantly, this effect is not limited to a specific CAR; as the data presented in this paper show, this effect can also be achieved using CARs that target liquid tumors (e.g., anti-CD19 CARs) or solid tumors (e.g., anti-HER2 CARs).

[0404] Sequence information: The induction folds in Table 2-5 are calculated in response to the expression level of luciferase in compound 004, where the luciferase gene contains an aptamer sequence in the context of the gene regulatory cassette of SEQ ID NO: 598.

[0405] The sequences in Tables 2-5 were isolated from the screening process, in which different regions of aptamer sequence 12C6-1 (SEQ ID NO:1) containing the putative TPP aptamer sequences (AP008955.1 / 944373-944459; CP030117.1 / 954080-954166; CP023474.1 / 977011-977097) were randomized. The randomized regions include: (1) the junction (J) region (J2-4) for connecting the pairing (P) regions P2 and P4 (see Table 2); (2) the loop (L) region L3a (see Table 3); (3) the P4 / J4-5 / J5-4 region (see Table 4); and the L5 region (see Table 5).

[0406] Table 2. Aptamer sequences, such as CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 Provided in CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), wherein at position X7-X 12 The nucleotides are randomly selected. In column 3, J2-4 (X7X8X9X) 10 X 11 X 12The sequence in the region (SEQ ID NO: 600) should be understood in the context of SEQ ID NO: 4. Therefore, the SEQ ID NOs listed in column 1 refer to aptamer sequences, where the shorter sequences provided in column 3 are presented in the context of SEQ ID NO: 4. For example, SEQ ID NO: 7 (CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCACACCACCTGATCCGGATCATGCCGGCGCAGGGAG) referenced in column 1 corresponds to CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCX7X8X9X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), but the sequence X7X8X9X in SEQ ID NO:4 10 X 11 X 12 (SEQ ID NO:600) is replaced with ACACCA (SEQ ID NO:602). The same naming system is used in Tables 3-6.

[0407] Table 3. Aptamer sequences are provided as in sequence CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO: 3), where the nucleotides at positions X1 to X6 are randomly selected. The sequence in column 3, namely region L3a (X1X2AX3X4X5X6) (SEQ ID NO: 684), should be understood as being presented in the context of SEQ ID NO: 3. Therefore, the SEQ ID NO listed in column 1 refers to the aptamer sequence, where the shorter sequence provided in column 3 is presented in the context of SEQ ID NO: 3.

[0408] Table 4. Aptamer sequences such as CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTX13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 Provided in CAGGGAG (SEQ ID NO:5), where at position X 13 To X 15、 X 22 and X 23 The nucleotides at these positions are randomly selected. The sequences in column 3, i.e., P4 / J4-5 to J5-4(X), are randomly selected. 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 The region (SEQ ID NO:770) should be understood as being in the context of SEQ ID NO:5. Therefore, the SEQ ID NO listed in column 1 refers to the aptamer sequence, while the shorter sequence provided in column 3 is presented in the context of SEQ ID NO:5.

[0409] Table 5. Aptamer sequences such as CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 Provided in CCGGCGCAGGGAG (SEQ ID NO:6), where position X 16 To X 21 The nucleotides at that position are randomly selected. The sequence in column 3, namely L5 (X) 16 X 17 X 18 X 19 X 20 X 21 The region (SEQ ID NO: 954) should be understood as being in the context of SEQ ID NO: 6. Therefore, the SEQ ID NO listed in column 1 refers to the aptamer sequence, while the shorter sequence provided in column 3 is presented in the context of SEQ ID NO: 6.

[0410] Table 6. Other sequences. SN = SEQ ID NO.

Claims

1. A composition comprising a population of T cells capable of expressing a chimeric antigen receptor (CAR) in response to a small molecule inducer, wherein the T cells in the population comprise a polynucleotide comprising: (i) a first sequence encoding the chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) a variable spliced exon flanked by a 5’ intron and a 3’ intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer linked to an effector region comprising a stem-forming sequence comprising a 5’ splice site sequence of the 3’ intron and a sequence complementary to the 5’ splice site sequence of the 3’ intron; wherein the second sequence is inserted into the first sequence.

2. The composition of claim 1, wherein the T cells in the population of T cells have one or more of the following properties: (a) more than about 30%, more than about 35%, more than about 40%, more than about 45%, or more than about 50% of the T cells in the population of T cells have a naive phenotype; (b) less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the population of T cells have a differentiated phenotype; (c) less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the population of T cells are CD45RA – and / or CD62L – ; (d) less than about 35%; less than about 30%; less than about 25%; less than about 20%; less than about 18%; or less than about 16% of the T cells in the population of T cells are exhausted T cells; (e) enhanced cytotoxicity against cancer cells expressing the CAR antigen as compared to T cells that constitutively express the CAR; (f) reduced cytokine production when exposed to cancer cells expressing the CAR antigen as compared to T cells that constitutively express the CAR; (g) enhanced ability to expand in response to exposure to the CAR antigen as compared to T cells that constitutively express the CAR; and / or (h) reduced level of T cell exhaustion following exposure to the CAR antigen as compared to T cells that constitutively express the CAR.

3. The composition of claim 2, wherein more than about 30%, more than about 35%, more than about 40%, more than about 45%, or more than about 50% of the T cells in the population of T cells are CD62L + CD45RA + , CCR7 + , CD127 + , or CD132 + , or any combination thereof.

4. The composition of claim 3, wherein more than about 30%; more than about 35%; more than about 40%; more than about 45% or more than about 50% of the T cells in the population of T cells are CD62L + and / or CD45RA + .

5. The composition of claim 4, wherein more than about 30%, more than about 35%, more than about 40%, more than about 45%, or more than about 50% of the T cells in the population of T cells are CD62L + .

6. The composition of any one of claims 2-5, wherein less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 18%, or less than about 16% of the T cells in the population of T cells have a differentiated phenotype effector memory or effector cell type.

7. The composition of any one of claims 2 to 6, wherein the exhausted T cells are CD39 + , PD-1 + , CTLA-4 + , LAG-3 + , TIM-3 + , 2B4 / CD244 / SLAMF4 + , CD160 + , or TIGIT + , or any combination thereof.

8. The composition of claim 7, wherein the T cell-depleted are CD39 + .

9. The composition of any one of claims 2-8, wherein the reduced cytokine production is a reduced production of TNFa, IL-2, IFNy, or a combination thereof.

10. The composition of any one of the preceding claims, wherein the polynucleotide sequence comprising the first sequence and the second sequence is present in a T cell receptor alpha constant chain (TRAC) locus of the T cells.

11. A method for making the composition of any one of the preceding claims, the method comprising: (a) obtaining a population of T cells; (b) introducing into the T cells in the population a polynucleotide comprising: (i) a first sequence encoding the chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) a variable splice exon flanked by a 5' intron and a 3' intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer linked to an effector region comprising a stem-forming sequence comprising a 5' splice site sequence of the 3' intron and a sequence complementary to the 5' splice site sequence of the 3' intron; wherein the second sequence is inserted into the first sequence; and (c) expanding the T cells in culture.

12. The composition of any one of claims 1 to 10 or the method of claim 11, wherein the aptamer binds a small molecule ligand.

13. The composition of any one of claims 1 to 10 or 12 or the method of claim 11 or 12, wherein the 5' splice site sequence of the 3' intron comprises GTGAGT, GTAAGC, GTAAGT, GTGTGG, or GTANGT, wherein N represents A, G, C, or T.

14. The composition or method of claim 13, wherein the 5' splice site sequence of the 3' intron comprises GTAAGT, GTGAGT, or GTAATG.

15. The composition or method of claim 14, wherein the 5' splice site sequence of the 3' intron comprises GTAATG.

16. The composition of any one of claims 1 to 10 or 12 to 15 or the method of any one of claims 11 to 14, wherein the variable splice exon (a) is exon 2 derived from the human dihydrofolate reductase gene, exon 5 of the human Wilms' tumor 1 gene, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6; or (b) is synthetic.

17. The composition or method of claim 16, wherein the variable splice exon is a modified exon 2 from DHFR.

18. The composition or method of claim 16, wherein the variable splice exon comprises SEQ ID NO: 590 or 591.

19. The composition of any one of claims 1 to 10 or 12 to 18 or the method of any one of claims 11 to 18, wherein the variable splice exon has been modified by one or more ways selected from the group consisting of altering a sequence of an exon splice enhancer, altering a sequence of an exon splice silencer, adding an exon splice enhancer, and adding an exon splice silencer.

20. The composition of any one of claims 1 to 10 or 12 to 19 or the method of any one of claims 11 to 19, wherein the 5' intron comprises a stop codon in-frame with a target gene.

21. The composition of any one of claims 1-10 or 12-20 or the method of any one of claims 11-20, wherein the 5’ intron and the 3’ intron (a) are derived from an endogenous intron of the target gene; (b) are exogenous to the target gene; (c) are derived from intron 2 of the human beta-globin gene.

22. The composition of any one of claims 1-10 or 12-21 or the method of any one of claims 11-21, wherein the 5’ intron and the 3’ intron are each independently about 50 to about 300 nucleotides long.

23. The composition or method of claim 22, wherein the 5’ intron and the 3’ intron are each independently about 125 to about 240 nucleotides long.

24. The composition of any one of claims 1-10 or 12-23 or the method of any one of claims 11-23, wherein the stem-forming sequence is 8 to 11 base pairs long.

25. The method of any one of claims 11-24, wherein the step of expanding the T cells in culture is performed in the absence of the small molecule ligand.

26. A method for treating cancer by administering to a subject in need thereof (i) a composition according to any one of claims 1-10 or 12-24; and (ii) a composition comprising a small molecule ligand that binds the aptamer.

27. The method of claim 26, wherein the composition and the small molecule ligand are administered simultaneously.

28. The method of claim 26, wherein the composition and the small molecule ligand are administered sequentially.

29. The method of any one of claims 26-28, wherein the subject is a human.

30. The composition according to any one of claims 1-10 or 12-24, or the method according to any one of claims 11-29, wherein the aptamer comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 or 7-588.

31. The composition or method according to claim 30, wherein the aptamer comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 1 or 7-588.

32. The composition or method according to claim 31, wherein the aptamer comprises any one of SEQ ID NOs: 1 or 7-588.

33. The composition according to any one of claims 1-10, 12-24, or 29-32, or the method according to any one of claims 11-32, wherein the small molecule inducer is selected from a compound according to any one of formulas I-XXII.

34. The composition according to any one of claims 1-10, 12-24, or 29-32, or the method according to any one of claims 11-32, wherein the small molecule inducer is selected from the group consisting of: 。

Images