FLP-IN-PIEC cell line as well as construction method and application thereof

By constructing the FLP-IN-PIEC cell line in PIEC cells, and utilizing the combined technology of CRISPR/Cas9 and Flp recombinase, we achieved site-directed integration and stable expression of exogenous genes, solving the problem of unstable exogenous gene expression in PIEC cells. This provides an efficient and stable gene expression platform suitable for gene function research, recombinant protein production, and vaccine development.

CN121628840APending Publication Date: 2026-03-10CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511871291.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-12
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

The lack of a mature site-specific integration system in existing PIEC cells leads to unstable exogenous gene expression, low random integration efficiency, long screening cycles, and gene silencing issues, which limits the application of porcine cells in gene function research, vaccine development, and recombinant protein production.

Method used

CRISPR/Cas9 gene editing technology was used to knock the FRT recombination site into the HIPP11 safe site in PIEC cells. The Flp recombinase was used to achieve site-directed single-copy integration of the foreign gene. The CRISPR/Cas9 system was used for site-directed cleavage and homologous recombination. The Flp recombinase was used to achieve efficient site-directed integration of the foreign gene into the FRT site. The promoter design was optimized to ensure stable expression.

Benefits of technology

This method achieves stable and uniform expression of exogenous genes in PIEC cells, avoids position effect interference, improves genetic stability and screening efficiency, provides a universal cell vector platform, and shortens the research and development cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121628840A_ABST
    Figure CN121628840A_ABST
Patent Text Reader

Abstract

The invention relates to the related technical field of molecular biology and cell engineering, in particular to an FLP-IN-PIEC cell line and a construction method and application thereof, and the construction method comprises the following steps: step 1, constructing CRISPR / Cas9 site-specific cleavage plasmid containing a pig HIPP11 safety site sequence; step 2, constructing a donor plasmid Donor-FRT containing a homologous arm of a safety site of the HIPP11; 3, jointly transfecting plasmids in the step 1 and the step 2 into a porcine hip artery endothelial cell line (PIEC) to obtain an FLP-IN-PIEC cell line for expressing red fluorescence; and 4, under the action of Flp recombinase, transfecting an exogenous gene donor plasmid containing an FRT site to the FLP-IN-PIEC cell line obtained in the step 3, and driving the expression of a target gene through an optimized strong promoter to realize fixed-point transfer and efficient expression of the exogenous gene in the pig (PIEC) cell line. Different from an existing Flp-In system depending on a random integration strategy, the construction method disclosed by the invention emphasizes fixed-point integration and promoter optimization, and improves the homogeneity, stability and screening efficiency of exogenous gene expression.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology and cell engineering, in particular to a FLP-IN-PIEC cell line and a construction method and application thereof. BACKGROUND

[0002] In the research of molecular biology, cell engineering and biopharmaceuticals, obtaining a cell line capable of stably expressing exogenous genes is an important basis for protein function analysis, immunological research, vaccine development and exogenous protein production. However, the existing methods for obtaining stable cell lines still have many limitations, especially in pig-derived cells (such as PIEC cells), there is still a lack of mature and controllable site-specific integration system. The existing technologies mainly include the following categories:

[0003] Random integration method: Common methods such as conventional plasmid transfection or slow virus vector mediated integration, the insertion position of exogenous genes in the genome is uncontrollable, which is easily affected by "genomic position effect", resulting in differences, instability or gradual decrease of exogenous gene expression with passage. In addition, random integration process may cause disturbance of genome structure, which is not conducive to obtaining uniform cell lines.

[0004] Transposon system: represented by PiggyBac transposon system, although it can significantly improve the integration efficiency, but the integration events still occur randomly in multiple places in the genome. Multiple copy integration may lead to genomic instability or induce insertion mutation, and the expression difference between different clones is obvious, which limits its application in research that requires strict expression consistency.

[0005] Flp-In system: Flp recombinase can realize site-specific integration at the pre-existing FRT site in the genome, thereby improving the expression consistency. However, the traditional method often introduces FRT site into the cell genome by random integration method, and its position is also uncontrollable, so the stability and expression level still depend on the integration site itself, and it is difficult to completely avoid the position effect.

[0006] At present, there is no mature and repeatable Flp-In site-specific integration system reported for pig iliac artery endothelial cells (PIEC). The lack of controllable and single insertion site PIEC cell lines limits the further application of pig-derived cells in the fields of gene function research, vaccine development and recombinant protein production. Therefore, it is necessary to develop a cell line construction method that can realize site-specific integration in PIEC cells, and through the optimization of promoter design, both the efficiency of drug screening and the stable expression of target genes in long-term passage are ensured, so as to obtain stable cell lines with uniform expression, controllable gene copy number and repeatability. SUMMARY

[0007] The present application aims to provide a FLP-IN-PIEC cell line and a construction method and application thereof, so as to solve the problems of unstable expression of exogenous genes, low random integration efficiency, long screening period and easy gene silencing in the prior art.

[0008] To achieve the above-mentioned purpose, the present application provides the following technical scheme: a FLP-IN-PIEC cell line, which is constructed by using CRISPR / Cas9 gene editing technology to knock in a single FRT (Flp Recombination Target) recombination site sequence at the HIPP11 (H11) safe site of the genome of the PIEC cell as a carrier.

[0009] The cell line is obtained by using CRISPR / Cas9 gene editing technology to achieve the site-specific insertion of the FRT sequence at the HIPP11 safe site of the pig iliac artery endothelial cell (PIEC), and using Flp recombinase to achieve the site-specific integration of the exogenous gene at the FRT site, so as to obtain a cell line capable of stably expressing the exogenous gene.

[0010] Preferably, the DNA sequence length of the exogenous gene is not more than 10 kb, and the expression of the integrated gene is driven by the CBh promoter.

[0011] Preferably, the cell line maintains stable expression of the exogenous gene under the selection pressure of the puromycin drug, and maintains the stable integration state of the exogenous gene during the culture process of continuous passage for more than 10 generations.

[0012] Preferably, the FRT sequence is integrated into the genome in the form of a single copy at the pig HIPP11 site, thereby avoiding the differences in gene expression and genomic instability caused by random integration.

[0013] Preferably, the integration of the exogenous gene at the FRT site is mediated by Flp recombinase, and the integration event is independent of the random integration pathway.

[0014] Preferably, the CRISPR / Cas9 site-specific insertion step realizes the precise integration of the FRT sequence at the HIPP11 site of the PIEC cell genome, and is verified by ddPCR or sequencing to be a single insertion, and then the exogenous gene is integrated by Flp recombinase to realize high-efficiency site-specific integration

[0015] The construction method of the FLP-IN-PIEC cell line comprises the following steps:

[0016] 1. Target selection and vector construction: Select HIPP11 safe site in PIEC cell genome as integration target, design specific sgRNA; construct donor plasmid containing FRT sequence, resistance screening marker and homologous arm;

[0017] 2. Site-specific cleavage and transfection: Use CRISPR / Cas9 system to perform site-specific cleavage on HIPP11 site to generate DNA double-strand break; co-transfect Cas9 / sgRNA expression vector and donor plasmid into PIEC cells;

[0018] 3. Homologous recombination and integration: Repair the DNA double-strand break by homologous recombination repair mechanism (HDR) in cells to integrate FRT sequence and resistance gene driven by CMV promoter into HIPP11 site;

[0019] 4. Drug screening: Use resistance drug (such as puromycin) to screen transfected cells under pressure, remove non-integrated cells and enrich positive cell population;

[0020] 5. Monoclonal identification: Perform limited dilution method monoclonal culture on the screened positive cell population, and obtain FRT site integration and background pure FLP-IN-PIEC monoclonal cell strain through PCR identification and sequencing verification.

[0021] The application of FLP-IN-PIEC cell line in gene function research, recombinant protein production, vaccine development or stable cell line construction, as a high-efficiency and stable gene expression platform, is used for site-specific integration and expression of exogenous genes in PIEC cells (or specific avian / livestock source cells), for gene function research, to eliminate the position effect interference caused by random integration and to ensure the repeatability of experimental data. It is used for stable production of recombinant proteins or viral vectors.

[0022] Compared with the prior art, the application has the following beneficial effects:

[0023] 1. Site-specific integration, good uniformity: Overcomes the problem of random integration caused by traditional transfection or lentivirus infection, avoids position effect, and makes the gene expression level of different batches of cell strains have high consistency.

[0024] 2. High genetic stability: The exogenous gene is integrated in the HIPP11 safe site, which is not easy to lose or be silenced, and supports long-term subculture.

[0025] 3. High screening efficiency and flexibility: The optimized promoter combination (CMV+CBh) takes into account the resistance screening efficiency in the construction stage and the expression level of the target gene in the application stage; the CBh promoter is less likely to be silenced than the traditional CMV promoter in long-term culture, and is particularly suitable for research scenarios that require long-term expression.

[0026] 4. Platform versatility: Once the construction is successful, the cell line can be used as a universal cell carrier, and only the donor plasmid needs to be replaced to quickly construct a stable cell line expressing different target genes, greatly shortening the research and development cycle. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 PCR electrophoresis map of each fragment in the construction process of the donor plasmid, wherein: lane 1 is the vector skeleton fragment; lane 2 is the sequence fragment containing the FRT site; lane 3 is the upstream homologous arm fragment of the pig HIPP11 site (pHIPP11); lane 4 is the downstream homologous arm fragment of the pig HIPP11 site;

[0028] Figure 2 Schematic diagram of donor plasmid (Donor Vector) construction map and core element;

[0029] Figure 3 Co-transfection efficiency verification diagram of the donor plasmid and the CRISPR / Cas9 system;

[0030] Figure 4 Microscopic imaging diagram of the FLP-IN-PIEC monoclonal cell mass obtained after drug screening;

[0031] Figure 5 PCR amplification and sequencing verification diagram of genomic level FRT site integration;

[0032] Figure 6 Stability verification diagram of the FLP-IN-PIEC cell strain after expansion culture;

[0033] Figure 7 Macroscopic morphology diagram of the FLP-IN-PIEC cells after mass collection;

[0034] Figure 8 Digital droplet PCR (ddPCR) identification result of the FRT site copy number in the FLP-IN-PIEC cells;

[0035] Figure 9 Schematic diagram of the construction and application process of the FLP-IN-PIEC cell line;

[0036] Figure 10 Verification diagram of Flp recombinase-mediated site-directed integration of target genes. DETAILED DESCRIPTION

[0037] With reference to the accompanying drawings, the technical solutions in the embodiments of the present application will be described clearly and completely. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0038] The principle of the present application is based on the combination of Flp-In recombination system and CRISPR / Cas9 technology.

[0039] 1. Safe site selection: HIPP11 site is selected as a "safe harbor", which is located in the intergenic region, and the insertion of exogenous genes will not destroy the structure and function of endogenous genes, nor will it cause tumorigenic transformation of cells.

[0040] 2. Two-step strategy: first, the high-efficiency cleavage ability of CRISPR / Cas9 is used to accurately implant the FRT "landing site" into the genome; then the Flp recombinase is used to recognize the FRT site to realize the "one-key" site-specific insertion of exogenous genes.

[0041] 3. Dual-promoter orthogonal design: by distinguishing and screening the promoter (CMV) and the promoter of the target gene (CBh), the problem of expression silencing or transcription interference caused by a single promoter is solved, which significantly improves the robustness of the system.

[0042] Embodiment 1: Construction of cleavage plasmid

[0043] The HIPP11 sequence between the pig EIF4ENIF1 and DRG1 genes in NCBI is used as a template, and the sgRNA sequence is designed through an online sgRNA design tool. https: / / crispor.gi.ucsc.edu / A pair of primers is designed by adding CACCG sticky ends at the 5' end of the forward sequence and AAAC sticky ends at the 5' end of the reverse sequence and adding C bases at the 3' end, and the sequences are as follows:

[0044] Hipp-sgRNA-F: 5'-CACCGTGATAATCGTTGTACAGCT-3'

[0045] Hipp-sgRNA-R: 5'-AAACAGCTGTACAACGATTATCAC-3'

[0046] Mix 20 μM of sgRNA upstream and downstream primers with 5 μl of T4 Ligase Buffer, add enzyme-free water to 50 μl. Set the program in the PCR instrument to 95℃ for 5 min, reduce to 4℃ at 0.1℃ / s, and make the sgRNA primers into double-stranded sgRNA for standby. Use endonuclease Bbs1 to cut the PX458 plasmid at 37℃ for 1 hour, and recover the enzyme cutting product after electrophoresis in an agarose gel. Mix 10 μl of double-stranded sgRNA, 10 ng of recovered PX458 plasmid, 2 μl of T4 Ligase Buffer, 1 μl of T4 Ligase, add enzyme-free water to 20 μl, and wait for 30 min at room temperature to complete the ligation. Directly add the product to competent DH5a, plate, pick single colonies for sequencing, and obtain the cutting plasmid PX458-sgRNA.

[0047] Example 2: Construction of donor plasmid

[0048] The upstream and downstream homology arms are designed according to the knock-in target site with the PIEC genome as the template, and the related fragments are amplified with the PUC19 backbone and the CMV-FRT-cherry-PURO knock-in cassette as the templates. The upstream and downstream homology arm primers are as follows:

[0049] PUC-F: 5'- AGCAGTCTCCTGGAATAAGGCCTGGtgcactctcagtacaatctgctc - 3'

[0050] PUC-R: 5'- ACCTTATTGCAGTATCACTTAGGggcgtaatcatggtcatagctg - 3'

[0051] The MCS region of the PUC19 plasmid is selected for endonuclease cutting, and the linearized PUC19 plasmid is recovered after electrophoresis. The AmpR and Ori regions of the PUC19 plasmid are amplified by PCR using the primers described above as the backbone sequence.

[0052] Pig-5-F: 5'- GCTCTATGGCTTCTGAGGCGGAGCTTGGGCTCAGCACTGTCTAT - 3'

[0053] Pig-5-R: 5'- CCAGGCCTTATTCCAGGAGACTG - 3'

[0054] Pig-3-F: 5'- CCTAAGTGATACTGCAATAAGGTAG - 3'

[0055] Pig-3-R: 5'- GTCAATAATCAATGTCAACGCGTTGTACAACGATTATCAAAGG - 3'

[0056] PIEC cell gene was extracted as a template, and the third base at the 5' end of the PAM sequence was used as a separation to amplify 1120bp as an upstream homologous arm using Pig-5-F and Pig-5-R as primers, and 860bp as a downstream homologous arm using Pig-3-F and Pig-3-R as primers.

[0057] CMV-F: 5'- ACGCGTTGACATTGATTATTGACTAG - 3'

[0058] CMV-R: 5'- TCCGCCTCAGAAGCCATAGAGCTTTGTAGAGGTTTTACTTGC - 3'

[0059] The FRT site in the pFRT-lacZeo plasmid was inserted between the CMV promoter sequence and the cherry sequence, and the knock-in sequence was obtained by amplification using the above primers.

[0060] After electrophoresis of the above amplification product, the above amplification product was mixed with the backbone sequence, the upstream homologous arm, the downstream homologous arm, and the knock-in sequence in a mass ratio of 100ng: 50ng: 50ng: 80ng, and then homologous recombinase was added. Figure 1 The ligation product was directly added to competent DH5a, and after plating, single colonies were picked for sequencing to obtain the donor plasmid, as shown in Figure 2 .

[0061] Example 3: Construction and screening of FLP-IN-PIEC cell strain

[0062] After the PIEC cells were resuscitated, they were cultured at 39°C in a 5% CO2 environment, and after stable passage for 3-4 times, they were plated into 60mm dishes. When the cell density was about 70%, the cleavage plasmid and the donor plasmid were transfected into PIEC cells using lip2000 transfection reagent, and the transfection steps were as follows:

[0063] (1) In a 1.5mL sterile centrifuge tube, add 250μl Opti-MEM medium, add 6μg cleavage plasmid PX458-sgRNA and 6μg donor plasmid, and mix well;

[0064] (2) In a 1.5mL sterile centrifuge tube, add 250μl Opti-MEM medium, add 24μl lip2000 medium, and mix well;

[0065] (3) Mix the reagents in two centrifuge tubes, incubate at room temperature for 15 min, then add them evenly into one 60 mm dish for transfection;

[0066] (4) Replace the culture medium 12 hours after transfection.

[0067] The donor plasmid carries a red fluorescent protein sequence cherry and a puromycin resistance sequence PURO. The cells successfully transfected with the donor plasmid can emit red fluorescence. The cleavage plasmid carries a green fluorescent protein sequence GFP. After successful transfection, green fluorescence can be observed. 24 hours after transfection, the cells are observed under a fluorescence microscope, as shown in Figure 3 , the positive rate of green fluorescence (PX458) is 40-55%; the positive rate of red fluorescence (donor plasmid) is 65-75%; the proportion of double-positive (GFP⁺ / Cherry⁺) cells is about 30-45%. Drug screening is performed 36 hours after transfection. Cells successfully transfected with the donor plasmid will be resistant to puromycin. Untransfected cells are removed using puromycin. The steps are as follows:

[0068] (1) 36 hours after transfection, the cells are digested and passaged. The cells in each 60 mm dish are mixed by blowing and then passaged into two 10 cm dishes to reduce the cell density;

[0069] (2) About 12-24 hours after the passage, when the cells successfully adhere to the wall and have normal morphology without internal vacuoles, the original culture medium is removed and replaced with complete culture medium containing 2.5 μg / mL puromycin for screening;

[0070] (3) The culture medium containing 2.5 μg / mL puromycin is replaced once a day for one week;

[0071] (4) The culture medium containing 2 μg / mL puromycin is replaced every two days for three weeks. At this time, cells that have not stably integrated the knock-in sequence into the genome have basically died. The stably integrated cells can proliferate normally under drug screening, thereby forming a single cell colony.

[0072] In this embodiment: the PIEC survival rate before drug screening is 100%; only ~2-5% of the cells survive after drug screening; the proportion of stably red fluorescent positive cells in the surviving cells is more than 95%. The screening results show that only cells that successfully integrate the knock-in cassette can survive for a long time. The red fluorescent positive single cell colonies formed are shown in Figure 4 .

[0073] Example 4: Identification of FLP-IN-PIEC cell line

[0074] On the basis of Example 3, the single clone was used for large-scale culture. The position of the single clone was observed under a microscope, and a black marker pen was used to mark the bottom of the dish. A 6mm sterile glass single clone ring was used to cover the marked area, and trypsin was added to the clone ring for digestion. After digestion, the cells were transferred to a 12-well plate for large-scale culture.

[0075] The gene knock-in effect was identified by gene sequencing. The total DNA of different FLP-IN-PIEC cells was extracted using a DNA extraction kit, and PCR amplification was performed using HIPP11 primers. The primers were HIPP11-F (5'-TAAGTGATACTGCAATAAGGTAG-3') and HIPP11-R (5'-CCAGGCCTTATTCCAGGAGACT-3'). 10 pmol of upper and lower primers, 100 ng of total DNA of cells, 10 μl of 2x KOD ONE MIX were mixed, and enzyme-free water was added to make up to 20 μl. The PCR reaction program was as follows: 95°C for 3 min; 98°C for 10 s; 68°C for 1 min; jump to the second step for 35 cycles; 68°C for 5 min; 16°C for storage. The PCR product was taken for agarose gel electrophoresis, and the identified amplified samples were subjected to PCR product recovery and sequencing identification. The sequencing confirmed that the positive rate was 70-80% (n=20 clones). Figure 5 After the FLP-IN-PIEC cells were subcultured and expanded for 10 generations in a culture medium containing 0.5 μg / mL puromycin, red fluorescence signals were observed under a microscope, as shown in Figure 6 The average fluorescence intensity of the first generation and the tenth generation changed by less than 10%, indicating stable expression. The cell pellet of the high Cherry expression showed a distinct red tone, as shown in Figure 7 .

[0076] The FRT site was identified as a single integration: 5 ng of FLP-IN-PIEC cell DNA was extracted, and the PCR system was configured according to the instructions of the Sinanfu Sniper digital PCR. The ACTB gene copy number and the FRT site copy number were identified using primers.

[0077] ACTB-F: 5'-GATCTGGGTCATCTTCTCAC-3'

[0078] ACTB-R: 5'-ATCTGGCACCACACCTTCT-3'

[0079] FRT-F: 5'-GCCTCCTCCGAGCGGATGTA-3'

[0080] FRT-R: 5'-GTCTTGACCTCAGCGTCGTAGTG-3'

[0081] The ACTB gene is a single copy gene, and the FRT site is only inserted uniquely in the genome. The detection results of this embodiment are as follows: ACTB: about 2.00 copies / cell, FRT: about 1.02-1.15 copies / cell, ACTB / FRT ≈ 2:1, which proves that the FRT is a single copy integration in the genome, and there is no tandem repeat or multi-site integration, and the results are as follows Figure 8 .

[0082] Example 5: Application of FLP-IN-PIEC cell line

[0083] 1) Construction of PCDNA5-FRT plasmid

[0084] In the FLP-IN-PIEC cell, the knock-in sequence expresses the target protein using the CMV promoter. In order to avoid the same strong promoter causing promoter interference in the stable cell, the CBh promoter is used to replace the CMV promoter in the PCDNA5-FRT plasmid to drive the expression of the target gene.

[0085] P5-F: 5'- CATAGAAGACACCGGGACCGATC - 3'

[0086] P5-R: 5'- AACGCGTATATCTGGCCCGTACA - 3'

[0087] The PCDNA5-FRT plasmid is PCR amplified using the above primers as the backbone sequence.

[0088] CBH-F: 5'- TGTACGGGCCAGATATACGCGTTcgttacataacttacggtaaatgg- 3'

[0089] CBH-R: 5'- GATCGGTCCCGGTGTCTTCTATGCCaacctgaaaaaaagtgatttca - 3'

[0090] The CBh sequence is PCR amplified using the above primers as the insert sequence. The backbone sequence and the insert sequence are mixed in a mass ratio of 100 ng:50 ng, and then the homologous recombinase is added. The ligation product is directly added to competent DH5a, and after plating, single colonies are picked for sequencing to obtain the PCDNA5-FRT-CBh plasmid. The PCDNA5-FRT-CBh plasmid is inserted into the multi-enzyme cutting site (MCS) of the plasmid. In this experiment, the EGFP sequence is used as an example.

[0091] 2) Homologous recombination of protein of interest and drug screening

[0092] pOG44 plasmid expresses Flp recombinase, recombines PCDNA5 plasmid into FRT site. The principle is as Figure 9 After FLP-IN-PIEC cells are recovered, they are cultured at 39°C in a 5% CO2 environment, and after being stably passaged 3-4 times, they are plated into 60 mm dishes. When the cell density is about 70%, the pOG44 plasmid and the donor plasmid are transfected into PIEC cells using lip3000 transfection reagent. The transfection steps are as follows:

[0093] (1) 250 μl of Opti-MEM medium is added to a 1.5 mL sterile centrifuge tube, 6 μg of PCDNA5-FRT-EGFP plasmid and 6 μg of pOG44 plasmid are added and mixed.

[0094] (2) 250 μl of Opti-MEM medium is added to a 1.5 mL sterile centrifuge tube, 24 μl of lip2000 medium is added and mixed.

[0095] (3) The reagents in the two centrifuge tubes are mixed, incubated at room temperature for 15 min, and then uniformly added dropwise to a 60 mm dish for transfection.

[0096] (4) The medium is changed 12 hours after transfection.

[0097] After 24 hours, 300 μg / mL of hygromycin B medium is used for screening for one week to obtain stably transfected cells. Based on the fluorescence intensity, it is found that the integration positive rate is about 90%, as Figure 9 Stably expressed green can be seen.

[0098] Although embodiments of the present application have been shown and described, it is to be understood that various modifications, substitutions, replacements and changes can be made to these embodiments without departing from the principles and spirit of the present application, and the scope of the present application is defined by the appended claims and their equivalents.

Claims

1. A FLP-IN-PIEC cell line, characterized in that: The cell line is obtained by site-specific insertion of FRT sequence at HIPP11 safe site of pig iliac artery endothelial cell (PIEC) through CRISPR / Cas9 gene editing technology, and site-specific integration of exogenous gene at the FRT site through Flp recombinase, so that the cell line capable of stably expressing exogenous gene is obtained.

2. The FLP-IN-PIEC cell line according to claim 1, characterized in that: The DNA sequence of the exogenous gene is not more than 10 kb in length, and the expression of the gene after integration is driven by CBh promoter.

3. The FLP-IN-PIEC cell line of claim 1, wherein: The cell line maintains stable expression of exogenous gene under the pressure of puromycin drug screening, and maintains the stable integration state of exogenous gene during the culture process of continuous passage for more than 10 generations.

4. The FLP-IN-PIEC cell line of claim 1, wherein: The FRT sequence is integrated into the genome in a single copy form at the pig HIPP11 site, thereby avoiding gene expression difference and genome instability caused by random integration.

5. The FLP-IN-PIEC cell line of claim 1, wherein: The integration of the exogenous gene at the FRT site is mediated by Flp recombinase, and the integration event is independent of the random integration pathway.

6. The FLP-IN-PIEC cell line of claim 1, wherein: The CRISPR / Cas9 site-specific insertion step realizes the precise integration of FRT sequence at the HIPP11 site of PIEC cell genome, and is verified by ddPCR or sequencing as a single insertion, and then the exogenous gene is integrated at the FRT site by Flp recombinase.

7. A method of constructing a FLP-IN-PIEC cell line according to any one of the preceding claims 1 to 6, characterized in that, The method comprises the following steps: (1) selecting HIPP11 safe site in PIEC cell genome as integration target, designing specific sgRNA, and constructing donor plasmid containing FRT sequence, resistance screening marker and homologous arm; (2) using CRISPR / Cas9 system to perform site-specific cutting on HIPP11 site to generate DNA double-strand break, and co-transfecting Cas9 / sgRNA expression vector and donor plasmid into PIEC cells; (3) repairing the mechanism (HDR) of homologous recombination in cells to accurately integrate FRT sequence and resistance gene driven by CMV promoter in the donor plasmid into HIPP11 site; (4) using resistance drugs (such as puromycin) to pressurize and screen the transfected cells, remove non-integrated cells, and enrich positive cell population; (5) performing single clone culture on the screened positive cell population by limiting dilution method, and obtaining FLP-IN-PIEC monoclonal cell strain with site-specific integration of FRT site and pure background through PCR identification and sequencing verification.

8. The method of constructing a FLP-IN-PIEC cell line according to claim 7, characterized in that: The donor plasmid uses CMV promoter to drive resistance gene expression.

9. Use of the FLP-IN-PIEC cell line according to any one of claims 1-6 in gene function research, recombinant protein production, vaccine development or stable cell line construction.