Application of rosiglitazone in preparation of medicine for treating glioma and composition of rosiglitazone

By regulating the Rb-E2F1 signaling axis with rosiglitazone to inhibit MND1 gene expression, the problems of DNA repair capacity and chemotherapy resistance in glioma cells have been solved, achieving effective treatment for gliomas.

CN121648119APending Publication Date: 2026-03-13深港细胞谷(深圳)医疗科技有限公司
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610031278.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-12
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing treatment options for gliomas are insufficient to effectively overcome the heterogeneity of glioma cells, their DNA damage repair capabilities, and chemotherapy resistance, resulting in high recurrence rates and significant side effects. Current methods are insufficient to achieve radical cure of the tumor.

Method used

Rosiglitazone was used to regulate the Rb-E2F1 signaling axis, inhibit the transcription of the MND1 gene, interfere with the DNA repair homeostasis of glioma cells, and inhibit tumor growth.

Benefits of technology

Rosiglitazone significantly downregulates the mRNA and protein levels of MND1, disrupts the DNA damage repair capacity of glioma cells, and inhibits tumor proliferation, providing a novel and safe glioma treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121648119A_ABST
    Figure CN121648119A_ABST
Patent Text Reader

Abstract

According to the application of the rosiglitazone in preparation of the medicine for treating the glioma and the composition of the rosiglitazone, a brand-new Rb-E2F1-mediated MND1 transcription inhibition mechanism of the rosiglitazone in the glioma is clarified for the first time; and a new strategy with a great transformation prospect is provided for treatment of glioma, namely, a clinical drug rosiglitazone which has been subjected to security certification is utilized to interfere DNA repair steady state of glioma cells through targeted inhibition of MND1, so that tumor growth is inhibited.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of glioma treatment, and more particularly to the use of rosiglitazone in the preparation of glioma treatment drugs and its compositions. Background Technology

[0002] Gliomas are among the most aggressive and deadly primary malignant tumors of the central nervous system. Glioblastoma (GBM, WHO grade IV) has an extremely poor prognosis, with median survival remaining unsatisfactory even after standard treatment regimens (including maximum surgical resection, postoperative radiotherapy combined with temozolomide chemotherapy). The inherent heterogeneity of glioma cells, their strong DNA damage repair capabilities, and multidrug resistance to chemotherapy drugs constitute major obstacles to treatment. Furthermore, the formation of a tumor immunosuppressive microenvironment further weakens the effectiveness of existing therapies, leading to almost inevitable tumor recurrence. Therefore, exploring novel treatment strategies that can overcome drug resistance and precisely intervene in key pathogenic pathways of gliomas is a core issue urgently needing breakthroughs in the field of neuro-oncology.

[0003] Gliomas are among the most aggressive and destructive primary malignant tumors of the central nervous system. Glioblastoma multiforme (GBM), a WHO grade IV tumor, has an extremely poor prognosis, with a median survival of only about 15 months. Glioblastoma cells exhibit highly invasive growth characteristics, making their boundaries with normal brain tissue indistinct and difficult to completely remove surgically. The current standard treatment for gliomas, the Stupp regimen—based on maximally safe surgical resection, supplemented by concurrent chemoradiotherapy with temozolomide and adjuvant chemotherapy—while able to slow tumor progression to some extent, still faces many serious challenges. First, while radiotherapy and chemotherapy kill tumor cells, they cause irreversible damage to normal nerve tissue, leading to severe side effects such as cognitive impairment and neurotoxicity, significantly impacting patients' quality of life. Second, due to the inherent heterogeneity and strong DNA damage repair capabilities of gliomas, they readily develop resistance to traditional chemotherapy drugs, resulting in a persistently high recurrence rate after treatment. More importantly, the vast majority of recurrent gliomas develop into treatment-resistant tumors, making it difficult to achieve a radical cure with current methods.

[0004] Against this backdrop, the "drug repurposing" strategy demonstrates unique translational medicine value due to its known pharmacological properties, mature safety data, and relatively low development costs and risks. Rosiglitazone, a classic thiazolidinedione drug, has long been used in the clinical treatment of type 2 diabetes. Summary of the Invention

[0005] To address the aforementioned problems, the present invention provides the use of rosiglitazone or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating gliomas.

[0006] In one embodiment, the present invention provides the use of rosiglitazone or a pharmaceutically acceptable salt thereof in the preparation of a pharmaceutical composition for treating glioma.

[0007] In one embodiment, the present invention provides a pharmaceutical composition for treating glioma, comprising the active ingredient rosiglitazone or a pharmaceutically acceptable salt thereof, and pharmaceutically acceptable excipients.

[0008] Pharmaceutically acceptable salts of rosiglitazone can also be used in this invention. Salts commonly used in the art can be used as salts, such as acid addition salts formed from pharmaceutically acceptable free acids, without limitation. As used herein, the term "pharmaceuticalally acceptable salt" refers to any organic or inorganic addition salt of rosiglitazone that is relatively non-toxic and harmless to the patient and effectively activates the compound without diminishing its beneficial effects due to side effects.

[0009] Pharmaceutically acceptable salts can be obtained by conventional methods using inorganic or organic acids. These pharmaceutically acceptable salts may include those derived from hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, acetic acid, glycolic acid, lactic acid, pyruvic acid, malonic acid, succinic acid, glutaric acid, fumaric acid, malic acid, mandelic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, benzoic acid, hydroxybenzoic acid, phenylacetic acid, cinnamic acid, salicylic acid, methanesulfonic acid, benzenesulfonic acid, or toluenesulfonic acid.

[0010] This invention is based on a key new discovery: we reveal for the first time that rosiglitazone can transcriptionally repress MND1 gene expression in glioma cells by regulating the Rb-E2F1 signaling axis. Specifically, rosiglitazone treatment induces dephosphorylation of retinoblastoma protein (Rb), and the activated form of Rb subsequently inhibits the activity of the key transcription factor E2F1. E2F1 is a core regulator of the cell cycle G1 / S phase transition, and its downstream target genes include MND1 (Meiotic Nuclear Division 1), which is involved in DNA homologous recombination repair. Abnormally high expression of MND1 in somatic cells promotes genomic instability and proliferation survival in tumor cells. Our study confirms that rosiglitazone significantly downregulates the mRNA and protein levels of MND1 through the above pathway, thereby disrupting the DNA damage repair capacity of glioma cells and ultimately inhibiting their proliferation.

[0011] Although the role of MND1 in meiosis is well-established, its biological function and regulatory mechanisms in somatic tumors such as gliomas remain largely unknown. Currently, no literature reports a direct regulatory relationship between rosiglitazone and MND1 expression, nor are there any proposals or plans to use rosiglitazone to target MND1 for glioma treatment. Existing glioma treatments also lack inhibitors that directly target this site.

[0012] In summary, this invention not only elucidates for the first time a novel Rb-E2F1-mediated MND1 transcriptional inhibition mechanism of rosiglitazone in glioma, but also provides a promising new strategy for the treatment of glioma: namely, using the clinically proven safe drug rosiglitazone to inhibit MND1, thereby interfering with the DNA repair homeostasis of glioma cells and inhibiting tumor growth. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 This is a graph showing the effect of drug compounds on MND1 mRNA expression in glioma cells; Figure 2 This is a diagram showing the concentration-dependent inhibition of LN229 and U87MG cell proliferation by rosiglitazone. Figure 3 This is a graph showing the concentration-dependent inhibition of MND1 mRNA levels in LN229 and U87MG cells by rosiglitazone. Figure 4 This is a graph showing the concentration-dependent inhibition of MND1 protein levels in LN229 and U87MG cells by rosiglitazone. Figure 5 The image shows the results of rosiglitazone dephosphorylation modification of Rb protein in LN229 cells and Rb protein in U87MG cells. Figure 6 The figure shows the results of rosiglitazone dephosphorylation modification of Rb protein in LN229 cells and Rb protein in U87MG cells, inhibiting the protein expression of E2F1. Figure 7 This is a diagram showing the results of rosiglitazone activating PPAR-γ receptors and inhibiting MND1 expression. Figure 8 The figure shows the results of co-transfection of the luciferase reporter vector with the full-length wild-type promoter (WT) of MND1 and the OE-E2F1 plasmid, which resulted in a significant increase in relative luciferase activity. Figure 9 This is a graph showing the relative enrichment fold of the E2F1 antibody group detected using ChIP and quantitative PCR. Figure 10 This is a diagram showing the transcriptional results of E2F1 regulating MND1 through its different domains; Figure 11 This is a diagram showing the results of rosiglitazone treatment inhibiting the growth of subcutaneous tumors in tumor-bearing mice; Figure 12 This is a diagram showing the concentration-dependent inhibition of MND1 protein expression in subcutaneous tumors of tumor-bearing mice by rosiglitazone. Figure 13 This is a graph showing the tumor bioluminescence and volume results in mice treated with rosiglitazone to suppress orthotopic tumors; Figure 14 The figure shows the results of rosiglitazone's concentration-dependent inhibition of MND1 protein expression in orthotopic tumors, which prolongs the survival time of mice with orthotopic tumors. Detailed Implementation

[0015] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below with reference to embodiments. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this application. I. Materials and Methods (I) CCK-8 Experiment

[0016] 1. Prepare a 96-well plate and seed glioma cells into each well at an appropriate density, typically 3 × 10^3 to 6 × 10^3 cells per well, according to the experimental design requirements, to ensure the reliability of the experimental results. After seeding, culture the cells for 6 to 8 hours until they adhere and attach to the plate; this point is marked as time point 0.

[0017] 2. Add the corresponding treatment reagents to the wells of different groups to observe their effect on cell proliferation, and then continue to culture the cells.

[0018] 3. After cell culture is complete, add 10 μL of CCK-8 reagent to each well and gently shake the 96-well plate to ensure that the reagent is evenly distributed in the wells, thereby improving the accuracy of the experiment.

[0019] 4. Place the 96-well plate back into an incubator at 37 °C for 1 to 4 hours. The specific incubation time can be adjusted according to experimental needs until a significant color change is observed for subsequent measurements.

[0020] 5. Use an ELISA reader to measure the absorbance (OD value) of each well at a wavelength of 450 nm.

[0021] 6. Calculate the cell proliferation rate based on the measured OD value and plot the growth curve to comprehensively assess the cell proliferation. (II) Luciferase reporter gene experiment

[0022] 1. For the MND1 gene promoter region, we designed and synthesized a full-length wild-type fragment containing the core regulatory sequence and a mutant fragment carrying a specific transcription factor binding site mutation, to ensure the accuracy and sequence specificity of the mutation design.

[0023] 2. The synthesized fragment was double-digested using an identified restriction endonuclease to obtain a promoter fragment with a specific sticky end.

[0024] 3. The pGL3-Basic reporter vector was linearized using the same pair of restriction endonucleases, and the digestion products were recovered and purified by agarose gel electrophoresis to ensure the compatibility of the vector backbone with the ends of the inserted fragment.

[0025] 4. At an appropriate molar ratio, the enzyme-digested and purified promoter fragment was mixed with the linearized pGL3-Basic vector and ligated overnight at 16°C using T4 DNA ligase to construct the pGL3-MND1-promoter (wild-type / mutant) recombinant reporter plasmid.

[0026] 5. The ligation product was transformed into DH5α chemocompetent cells, plated on LB solid medium containing 100 µg / mL ampicillin, and cultured overnight at 37°C to screen for positive transformants.

[0027] 6. Randomly select single colonies and use colony PCR to initially screen clones with the correct insert size. Verify positive clones using Sanger sequencing to ensure that the promoter sequence is complete and the mutation site is accurately introduced.

[0028] 7. 24 hours before cell transfection, seed target cells into 24-well plates at an appropriate density. For transfection, use Lipofectamine 2000 transfection reagent and follow the manufacturer's recommended procedure to co-transfect the recombinant reporter plasmid and the internal control plasmid pRL-TK (expressing Renilla luciferase).

[0029] 8. Forty-eight hours after transfection, discard the culture medium and collect cells using passive lysis buffer. Centrifuge the lysate at 4°C, 12,000 × g for 10 minutes, and use the supernatant for subsequent assays.

[0030] 9. Strictly follow the instructions of the Dual-Luciferase Reporter Gene Detection Kit to sequentially determine the activities of firefly luciferase and Renilla luciferase. Use Renilla luciferase activity as an internal control, and normalize the data from each well.

[0031] 10. Experiments should be independently repeated at least three times, and data should be expressed as mean ± standard deviation. Use appropriate statistical methods (such as t-tests or one-way ANOVA) to compare the relative luciferase activities among different reporter plasmid groups and assess the statistical significance of differences in promoter activity. (III) Chromatin Immunoprecipitation (ChIP)

[0032] 1. Cell fixation and cross-linking: Seed the target cells in 10 cm culture dishes and culture them until they reach approximately 90% confluence. Replace with fresh culture medium. Add formaldehyde to a final concentration of 1% and incubate gently at room temperature for 10 minutes to allow protein-DNA cross-linking to occur.

[0033] 2. Termination of cross-linking and cell collection: Add glycine to a final concentration of 125 mM and incubate at room temperature for 5 minutes to terminate the cross-linking reaction. Discard the culture medium and gently wash the cells twice with pre-chilled phosphate-buffered saline (PBS). Add PBS containing a protease inhibitor cocktail, scrape the cells with a cell scraper, transfer the suspension to pre-chilled centrifuge tubes, and collect the cell pellet by centrifugation at 4°C and 500 × g for 5 minutes.

[0034] 3. Cell Lysis and Chromatin Fragmentation: Add an appropriate amount of SDS lysis buffer containing protease inhibitors to the cell pellet, resuspend the pellet, and lyse on ice for 30 minutes. Subsequently, transfer the lysate to a Covaris microTUBE and perform chromatin fragmentation using a Covaris S220 sonicator (conditions: peak power 75 W, duty cycle 10%, cycle time 200 ms, total processing time 8 minutes) to obtain DNA fragments with an average length of approximately 200-500 bp. Perform agarose gel electrophoresis on a small amount of the fragmented product to verify the fragmentation efficiency.

[0035] 4. Immunoprecipitation: Dilute the fragmented chromatin sample to IP buffer, take a small amount as an "Input" control and store at -20°C. Add the target protein-specific antibody (or isotype IgG control) pre-conjugated with Protein A / G magnetic beads to the remaining sample and incubate overnight at 4°C by rotation.

[0036] 5. Complex Washing and Elution: The following day, the magnetic beads were separated using a magnetic rack and washed sequentially with low-salt immune complex washing buffer, high-salt immune complex washing buffer, LiCl washing buffer, and TE buffer. After washing, freshly prepared elution buffer (containing 1% SDS and 0.1 M NaHCO3) was added, and the mixture was gently eluted at room temperature for 15 minutes. The supernatant was then collected.

[0037] 6. Decross-linking and DNA purification: Add NaCl to all eluents and the reserved "Input" sample to a final concentration of 200 mM, and incubate overnight at 65°C to completely reverse cross-linking. Then, add RNase A and proteinase K for further treatment. Purify the DNA fragments using a DNA purification kit.

[0038] 7. Quantitative PCR Analysis: Primers designed targeting specific sequences in the promoter region of the target gene were used to quantify the purified DNA using real-time quantitative PCR (qPCR). The relative enrichment fold of the target DNA sequence in each immunoprecipitation sample was calculated using the percentage input method, and the results were normalized using the IgG group as a negative control. Experiments were independently repeated at least three times, and data are expressed as mean ± standard deviation.

[0039] (iv) Experiments to construct E2F1 functional domain deletion mutants (1) Specific amplification primers containing BamHI and XhoI restriction sites were designed and synthesized targeting the complete coding sequence (CDS) of human E2F1 protein. Using a plasmid containing E2F1 cDNA as a template, PCR amplification was performed using KOD Plus high-fidelity polymerase to obtain the E2F1 CDS fragment. Simultaneously, the pcDNA3.1(+) empty vector was double-digested with BamHI and XhoI and purified by gel extraction.

[0040] (2) Using homologous recombination cloning technology, the purified E2F1 CDS fragment was mixed with the linearized pcDNA3.1 vector at an appropriate molar ratio, and recombination was performed using a one-step cloning kit to construct the pcDNA3.1-E2F1 (wild-type) overexpression plasmid, which was then transformed into DH5α competent cells for amplification and verification.

[0041] (3) To construct the E2F1 functional domain deletion mutant, a pair of reverse complementary primers carrying homologous arms were designed for the target deletion region (such as the trans-activation domain, DNA binding domain, or dimerization domain). Using the verified pcDNA3.1-E2F1 plasmid as a template, reverse PCR amplification was performed using KOD Plus high-fidelity polymerase. The reaction conditions were as follows: 94°C pre-denaturation for 2 minutes; 94°C denaturation for 15 seconds, 68°C annealing for 30 seconds, 68°C extension for 4 minutes and 30 seconds, for a total of 25 cycles; and a final extension at 72°C for 7 minutes.

[0042] (4) After the PCR products were verified by agarose gel electrophoresis, they were gel-cleaved and recovered using a DNA purification and recovery kit. DpnI restriction endonuclease was then added to the purified products and incubated at 37°C for 15 minutes to digest the methylated template plasmid.

[0043] (5) The product after DpnI treatment was transformed into DH5α chemocompetent cells, spread on LB solid medium containing 100 μg / mL ampicillin, and incubated overnight at 37°C inverted.

[0044] (6) Select a single colony, verify the size of the inserted fragment by colony PCR, and send the positive clone to the sequencing company for full-length Sanger sequencing to ensure that the deleted region is accurate, the frameshift is correct, and the rest of the sequence is completely correct.

[0045] (7) 24 hours before cell transfection, the target glioma cells were seeded into 12-well plates at a density of 2 × 10^5 cells per well. When the cell adhesion rate reached 70–80%, 1 μg of the successfully constructed E2F1 deletion domain plasmid was transfected into the cells according to the Lipofectamine 2000 transfection reagent instructions, and an empty vector control group was set up.

[0046] (8) 24 hours after transfection, the culture medium was discarded, and total RNA was extracted from the cells using TRIzol reagent to determine its concentration and purity. Subsequently, reverse transcription was performed to synthesize cDNA, and the mRNA expression level of downstream target genes of E2F1 was detected by real-time quantitative PCR to analyze the effect of the E2F1 deletion domain on its transcriptional regulatory function.

[0047] II. Experimental Results Bioinformatics methods were used to screen candidate drugs that can inhibit MND1 gene transcription. The specific process is as follows: First, on public database platforms such as Enrichr, gene expression profile datasets of known drugs or compounds after perturbation were integrated and analyzed with glioma transcriptome data (RNA-seq) obtained under MND1 gene silencing conditions. Gene set enrichment analysis (GSEA) was used to screen for drug compounds that were significantly positively correlated with the MND1 downregulated phenotype (significant enrichment results are shown in Table 1). Count is used to visually compare the scale of gene involvement in different functional categories, reflecting the degree to which the functional category is involved in the input gene set; a high count value indicates that the functional category involves a wide range of genes, with more genes involved in the function. p.adjust (adjusted p-value) is the result of p-value after multiple comparison correction, used to control the false positive rate. In enrichment analysis, since a large number of functional categories are tested simultaneously, the original p-value is prone to false positives, so correction is required. In interpreting the results, count and p.adjust should be used together: a high count value indicates that the functional category involves a wide range of genes, while a low p.adjust value supports its statistical reliability. Therefore, priority should be given to enrichment terms with high count and low p.adjust. Based on bioinformatics analysis and comparison of mRNA levels, drugs that inhibit MND1 gene transcription were screened, as shown in Table 1.

[0048] Table 1

[0049]

[0050] Subsequently, the enriched candidate compounds were experimentally validated: human glioma cells LN229 were treated with each compound, and after 24 hours, cells were collected and total RNA was extracted. MND1 mRNA expression levels were detected by real-time quantitative PCR. The results showed that acetaminophen (1 mmol / L) and rosiglitazone (50 μmol / L) significantly reduced MND1 transcription levels, suggesting their potential activity in inhibiting MND1 expression. Considering the potential toxic side effects of long-term high-dose use of acetaminophen, such as liver and kidney damage and bleeding risk, rosiglitazone was ultimately selected as the drug to inhibit MND1 gene transcription. The effects of different drug compounds on MND1 mRNA expression in glioma cells are shown in Table 2 and... Figure 1 As shown.

[0051] Table 2

[0052] (ii) Rosiglitazone inhibits the proliferation of glioma cells in a concentration-dependent manner. To investigate the effect of rosiglitazone on glioma cell proliferation, the cell culture medium was supplemented with the same volume of DMSO as the highest concentration of rosiglitazone as a control group. Cell culture media were then sequentially supplemented with 6.3 μmol / L, 12.5 μmol / L, 25 μmol / L, and 50 μmol / L of rosiglitazone as gradient treatment groups. The CCK-8 assay was used to assess the proliferation capacity of glioma cells. After 48 hours of incubation, the cell viability (percentage) of LN229 cells was 98.83 ± 3.251 in the DMSO group, 101.30 ± 4.367 in the 6.3 μmol / L group, 92.67 ± 5.428 in the 12.5 μmol / L group, 85.33 ± 3.445 in the 25 μmol / L group, and 72.50 ± 2.811 in the 50 μmol / L group. Results are shown below. Figure 2A. Compared with the DMSO group, the cell viability of the 12.5 μmol / L, 25 μmol / L, and 50 μmol / L groups was significantly reduced, indicating that rosiglitazone inhibited the proliferation of LN229 cells in a concentration-dependent manner. After 48 hours of incubation, the cell viability (percentage) of U87MG cells was 100.70 ± 2.658 in the DMSO group, 98.50 ± 3.728 in the 6.3 μmol / L group, 80.67 ± 1.751 in the 12.5 μmol / L group, 77.33 ± 4.099 in the 25 μmol / L group, and 67.30 ± 4.195 in the 50 μmol / L group. See results below. Figure 2 B. Compared with the DMSO group, the cell survival rates of the 12.5 μmol / L, 25 μmol / L and 50 μmol / L groups were significantly reduced, indicating that rosiglitazone inhibited the proliferation of U87MG cells in a concentration-dependent manner.

[0053] (iii) Rosiglitazone inhibits MND1 mRNA levels in a concentration-dependent manner. Quantitative PCR was used to evaluate the effect of rosiglitazone on the mRNA level of MND1 in glioma cells. The cell culture medium containing the same volume of DMSO as the highest concentration of rosiglitazone served as the control group. Gradient treatment groups were established by adding 6.3 μmol / L, 12.5 μmol / L, 25 μmol / L, and 50 μmol / L of rosiglitazone to the cell culture medium. After incubating LN229 cells for 24 hours, total RNA was extracted from each group and quantitative PCR was performed. After normalization using the internal reference gene β-actin, the mRNA expression levels of MND1 were 1.001 ± 0.041 in the DMSO group, 0.990 ± 0.055 in the 6.3 μmol / L group, 0.807 ± 0.085 in the 12.5 μmol / L group, 0.642 ± 0.054 in the 25 μmol / L group, and 0.421 ± 0.075 in the 50 μmol / L group. Results are shown below. Figure 3A. Compared with the DMSO group, the mRNA expression levels of MND1 in the 12.5 μmol / L, 25 μmol / L, and 50 μmol / L groups were significantly reduced, indicating that rosiglitazone inhibited the mRNA level of MND1 in LN229 cells in a concentration-dependent manner. After 24 hours of incubation in U87MG cells, and normalization treatment with the internal reference gene β-actin, the mRNA expression levels of MND1 were 1.002 ± 0.039 in the DMSO group, 1.011 ± 0.036 in the 6.3 μmol / L group, 0.850 ± 0.074 in the 12.5 μmol / L group, 0.721 ± 0.097 in the 25 μmol / L group, and 0.432 ± 0.047 in the 50 μmol / L group. (See attached results). Figure 3 B. Compared with the DMSO group, the mRNA expression levels of MND1 in the 12.5 μmol / L, 25 μmol / L and 50 μmol / L groups were significantly reduced, indicating that rosiglitazone inhibited the mRNA level of MND1 in U87MG cells in a concentration-dependent manner.

[0054] (iv) Rosiglitazone inhibits MND1 protein levels in a concentration-dependent manner. Western blot analysis was used to evaluate the effect of rosiglitazone on the protein level of MND1 in glioma cells. The cell culture medium containing the same volume of DMSO as the highest concentration of rosiglitazone served as the control group. Gradient treatment groups were established by adding 6.3 μmol / L, 12.5 μmol / L, 25 μmol / L, and 50 μmol / L of rosiglitazone to the cell culture medium. After incubating LN229 cells for 48 hours, total protein was extracted from each group and subjected to Western blot analysis. After grayscale normalization using the internal reference protein β-actin, the MND1 expression levels were: 1.108 ± 0.044 in the DMSO group, 1.015 ± 0.062 in the 6.3 μmol / L group, 0.810 ± 0.062 in the 12.5 μmol / L group, 0.313 ± 0.077 in the 25 μmol / L group, and 0.166 ± 0.018 in the 50 μmol / L group. See results Figure 4A. Compared with the DMSO group, the MND1 protein expression levels in the 12.5 μmol / L, 25 μmol / L, and 50 μmol / L groups were significantly reduced, indicating that rosiglitazone inhibited the MND1 protein level in LN229 cells in a concentration-dependent manner. After incubating U87MG cells for 48 hours, total protein was extracted from each group and subjected to Western blot. After grayscale normalization using the internal control protein β-actin, the MND1 expression values ​​were 0.839±0.030 in the DMSO group, 0.799±0.048 in the 6.3 μmol / L group, 0.759±0.025 in the 12.5 μmol / L group, 0.693±0.025 in the 25 μmol / L group, and 0.449±0.037 in the 50 μmol / L group. (See attached results). Figure 4 B. Compared with the DMSO group, the MND1 protein expression values ​​in the 25 μmol / L and 50 μmol / L groups were significantly reduced, indicating that rosiglitazone inhibited the MND1 protein level in U87MG cells in a concentration-dependent manner. (v) Rosiglitazone dephosphorylates Rb protein and inhibits E2F1 expression.

[0055] Western blot analysis was used to evaluate the effect of rosiglitazone on the Rb-E2F1 signaling axis in glioma cells. Cell culture medium supplemented with the same volume of DMSO as the rosiglitazone experimental group served as the control group, while cell culture medium supplemented with 50 μmol / L rosiglitazone served as the experimental group. After incubating LN229 cells for 48 hours, total protein was extracted from each group and subjected to Western blot analysis. After grayscale normalization of the internal reference protein β-actin, the Rb protein expression value was 1.038±0.112 in the DMSO group and 0.982±0.111 in the 50 μmol / L group; the phosphorylated Rb protein (p-Rb, phosphorylation site serine 807 / 811) expression value was 0.847±0.114 in the DMSO group and 0.347±0.083 in the 50 μmol / L group; the p-Rb / Rb ratio was 0.817±0.077 in the DMSO group and 0.350±0.050 in the 50 μmol / L group. Results are shown in […]. Figure 5A. Compared with the DMSO group, the p-Rb / Rb ratio of the 50 μmol / L group was significantly reduced, indicating that rosiglitazone dephosphorylation modified the Rb protein in LN229 cells. After incubating U87MG cells for 48 hours, total protein was extracted from each group and subjected to Western blot. After grayscale normalization of the internal reference protein β-actin, the Rb protein expression value was 0.854±0.065 in the DMSO group and 0.884±0.055 in the 50 μmol / L group; the phosphorylated Rb protein (p-Rb, phosphorylation site serine 807 / 811) expression value was 0.976±0.069 in the DMSO group and 0.373±0.068 in the 50 μmol / L group; the p-Rb / Rb ratio was 1.145±0.098 in the DMSO group and 0.420±0.052 in the 50 μmol / L group. Results are shown in […]. Figure 5 B. Compared with the DMSO group, the p-Rb / Rb ratio of the 50 μmol / L group was significantly reduced, indicating that rosiglitazone dephosphorylated and modified the Rb protein of U87MG cells.

[0056] The E2F1 protein expression level in LN229 cells was 0.921±0.068 in the DMSO group and 0.595±0.057 in the 50 μmol / L group. See results below. Figure 6 A. Compared with the DMSO group, the E2F1 protein expression level in the 50 μmol / L group was significantly reduced, indicating that rosiglitazone significantly inhibited the E2F1 protein level in LN229 cells. The E2F1 protein expression level in U87MG cells was 0.912 ± 0.067 in the DMSO group and 0.656 ± 0.072 in the 50 μmol / L group. See results below. Figure 6 B. Compared with the DMSO group, the E2F1 protein expression level in the 50 μmol / L group was significantly reduced, indicating that rosiglitazone significantly inhibited the E2F1 protein level in U87MG cells. These results suggest that rosiglitazone dephosphorylates the Rb protein in glioma cells and inhibits E2F1 protein expression. (vi) Rosiglitazone activates PPAR-γ receptors and inhibits MND1 expression.

[0057] To investigate the mechanism of rosiglitazone in inhibiting MND1 expression in glioma cells, PPARG gene silencing was performed on LN229 and U87MG cell lines by transfecting them with a lentiviral vector carrying shRNA, knocking down the expression of the PPAR-γ receptor protein. MND1 protein levels were detected by Western blot. Cell culture media with the same volume of DMSO as the rosiglitazone group and transfected with a lentiviral vector carrying shNC served as the control group. Cell culture media with 50 μmol / L rosiglitazone served as the rosiglitazone group. Cell culture media with 50 μmol / L rosiglitazone and transfected with a lentiviral vector carrying shPPAR-γ#1 served as the rosiglitazone + shPPAR-γ#1 group. Cell culture media with 50 μmol / L rosiglitazone and transfected with a lentiviral vector carrying shPPAR-γ#2 served as the rosiglitazone + shPPAR-γ#2 group. The sense (5'-3') sequence of ShPPAR-γ#1 is GCCAAGTTTGAGTTTGCT (SEQ ID No. 1), the sense (5'-3') sequence of shPPAR-γ#2 is CTGGCCTCCTTGATGAATA (SEQ ID No. 2), and the sense (5'-3') sequence of shNC is CCTAAGGTTAAGTCGCCCTCG (SEQ ID No. 3). After incubating LN229 cells for 48 hours, total protein was extracted from each group and subjected to Western blot. After grayscale normalization of the internal reference protein β-actin, the MND1 protein expression value in the control group was 0.985±0.026, the expression value in the rosiglitazone group was 0.178±0.020, the expression value in the rosiglitazone + shPPAR-γ#1 group was 0.904±0.060, and the expression value in the rosiglitazone + shPPAR-γ#2 group was 0.796±0.038. After incubating U87MG cells for 48 hours, total protein was extracted from each group and subjected to Western blot. After grayscale normalization of the internal reference protein β-actin, the MND1 protein expression value in the control group was 0.915±0.032, the expression value in the rosiglitazone group was 0.189±0.021, the expression value in the rosiglitazone + shPPAR-γ#1 group was 0.863±0.037, and the expression value in the rosiglitazone + shPPAR-γ#2 group was 0.771±0.056. See results Figure 7In LN229 and U87MG cells, the MND1 protein expression level was significantly lower in the rosiglitazone group compared to the control group. Compared to the rosiglitazone group, the MND1 protein expression levels in the rosiglitazone + shPPAR-γ#1 and rosiglitazone + shPPAR-γ#2 groups were significantly reversed; that is, the knockdown of the PPAR-γ receptor reversed the inhibitory effect of rosiglitazone on MND1 protein expression. These results indicate that rosiglitazone inhibits MND1 protein expression in glioma cells by activating the PPAR-γ receptor.

[0058] (vii) The transcription factor E2F1 binds to the promoter sequence of the target gene MND1, initiating the transcription of MND1. The MND1 promoter was inserted into the pGL3-Basic plasmid to construct a pGL3-MND1 promoter luciferase reporter vector. The positive regulatory effect of E2F1 on MND1 promoter activity was evaluated using a dual-luciferase reporter gene assay. Luciferase reporter vectors containing the full-length wild-type MND1 promoter (WT) were used as the WT group, and luciferase reporter vectors containing the mutant MND1 promoter (MT) were used as the MT group. These were co-transfected into glioma cells with either the vector plasmid or the E2F1 overexpression plasmid (OE-E2F1), respectively. After cell lysis, fluorescence signal intensity was measured, and luciferase activity was calculated. The WT promoter ranged from -1960 to +425 nt. The forward primer was (5'-3')GCTGGGCAAAAGAGCGAAACC (SEQ ID No. 4), and the reverse primer was (5'-3')GGGCCCCGTGGTCTTTTAGATAA (SEQ ID No. 5). The MT promoter sequence (GTCGGCGCCAAA, -38 to -26 nt) of the WT promoter was replaced with the CAGCCGCGGTTT (SEQ ID No. 3) sequence. In LN229 cells, using Renal luciferase activity as an internal control, after normalization of data from each well, the relative luciferase activity of the WT group co-transfected with the vector plasmid was 1.022±0.071, and the relative luciferase activity of the WT group co-transfected with the OE-E2F1 plasmid was 2.227±0.272; the relative luciferase activity of the MT group co-transfected with the vector plasmid was 0.997±0.035, and the relative luciferase activity of the MT group co-transfected with the OE-E2F1 plasmid was 0.975±0.082. (See attached results). Figure 8A. In the WT group, the relative luciferase activity was significantly increased when co-transfected with the vector plasmid compared to when co-transfected with the OE-E2F1 plasmid. In the MT group, there was no significant difference in the relative luciferase activity between the vector plasmid co-transfection and the OE-E2F1 plasmid co-transfection. That is, overexpression of E2F1 significantly enhanced the luciferase activity of the MND1WT promoter, but did not enhance the activity of the MT promoter. In U87MG cells, using Renal luciferase activity as an internal control, after normalizing the data from each well, the relative luciferase activity in the WT group co-transfected with the vector plasmid was 1.021±0.087, and the relative luciferase activity in the MT group co-transfected with the vector plasmid was 3.395±0.646; the relative luciferase activity in the MT group co-transfected with the vector plasmid was 1.013±0.085, and the relative luciferase activity in the MT group co-transfected with the OE-E2F1 plasmid was 1.026±0.129. Results are shown below. Figure 8 B. In the WT group, the relative luciferase activity was significantly increased when co-transfected with the vector plasmid compared to when co-transfected with the OE-E2F1 plasmid. In the MT group, there was no significant difference in the relative luciferase activity between the vector plasmid co-transfection and the OE-E2F1 plasmid co-transfection. That is, overexpression of E2F1 significantly enhanced the luciferase activity of the MND1 WT promoter, but did not enhance the activity of the MT promoter.

[0059] The binding of E2F1 to specific sequences in the MND1 promoter region was further evaluated using ChIP and quantitative PCR (ChIP-qPCR). Cell lysates were treated with an ultrasonic disruptor, and IgG antibody was added as a control group, while E2F1 antibody was added as the experimental group. After purification, primers were designed based on specific sequences (-134 to -8 nt) in the MND1 promoter region, and DNA enrichment was assessed using quantitative PCR. The forward primer was (5'-3') TCGGATGGGTCGCTAGGG (SEQ ID No. 6), and the reverse primer was (5'-3') GGCCAGGACGCGTTTGAT (SEQ ID No. 7). The relative enrichment fold of the target DNA sequence in each immunoprecipitation sample was calculated using the percentage input method, and normalization was performed using the IgG group as a negative control. In LN229 cells, the relative enrichment fold of the IgG group was 1.061 ± 0.057, and the relative enrichment fold of the E2F1 antibody group was 3.641 ± 0.523. Results are shown below. Figure 9 A. Compared with the IgG group, the relative enrichment fold of the E2F1 antibody group was significantly increased. In U87MG cells, the relative enrichment fold of the IgG group was 1.006 ± 0.041, while the relative enrichment fold of the E2F1 antibody group was 4.467 ± 0.729. See the results below. Figure 9B. Compared with the IgG group, the relative enrichment fold of the E2F1 antibody group was significantly increased. That is, the enrichment fold of the MND1 core promoter sequence in the DNA fragment pulled out by the E2F1 antibody was significantly increased. These results indicate that E2F1 regulates the expression of the target gene MND1 at the transcriptional level by initiating MND1 transcription by binding to the MND1 promoter sequence.

[0060] The E2F1 domain-deleted plasmid was transfected into glioma cells. Total RNA was extracted 24 hours later, and quantitative PCR was used to detect the mRNA expression level of MND1, assessing the effect of the E2F1 domain-deleted plasmid on its transcriptional regulatory function. Transfection with the empty pcDNA3.1 vector plasmid served as the control group, while transfection with the pcDNA3.1-E2F1 (wild-type) plasmid served as the overexpression group. The following groups were transfected with different domain deletion positions: domain 1 deletion (Δ domain 1 group) for amino acid positions 2-28, domain 2 deletion (Δ domain 2 group) for amino acid positions 37-58, domain 3 deletion (Δ domain 3 group) for amino acid positions 67-82, domain 4 deletion (Δ domain 4 group) for amino acid positions 101-128, and domain 5 deletion (Δ domain 4 group) for amino acid positions 153-174. Group 5); amino acid positions of the deleted domains are from 195 to 284, and the plasmid is transfected as the domain 6 deletion group (Δ domain 6 group); amino acid positions of the deleted domains are from 300 to 349, and the plasmid is transfected as the domain 7 deletion group (Δ domain 7 group) (nucleotide sequence of domain 7: gagagaccgtaggtgggatcagccctgggaagaccccatcccaggaggtcacttctgaggaggagaacagggccactgactctgccaccatagtgtcaccaccaccatcatctcccccctcatccctcaccacagatcccagccagtct (SEQ ID No. 8); amino acid sequence of domain 7: EETVGGISPGKTPSQEVTSEEENRATDSATIVSPPPSSPPSSLTTDPSQS (SEQ ID No. 9)); amino acid positions of the deleted domains are from 368 to 437, and the plasmid is transfected as the domain 8 deletion group (Δ domain 8 group). In LN229 cells, after normalization using the internal reference gene β-actin, the mRNA expression levels of MND1 were as follows: control group: 1.001±0.063; overexpression group: 1.373±0.048; Δdomain 1 group: 1.494±0.056; Δdomain 2 group: 1.427±0.006; Δdomain 3 group: 1.364±0.057; Δdomain 4 group: 1.491±0.076; Δdomain 5 group: 1.432±0.046; Δdomain 6 group: 1.461±0.055; Δdomain 7 group: 1.033±0.038; and Δdomain 8 group: 1.476±0.062. (See attached results.) Figure 10Compared with the overexpression group, the mRNA expression value of MND1 in the Δ domain 7 group was significantly reduced, indicating that E2F1 regulates the transcription of MND1 through domain 7.

[0061] (viii) Rosiglitazone treatment inhibited the growth of subcutaneous tumors in tumor-bearing mice and, in a concentration-dependent manner, inhibited the expression of MND1 protein in subcutaneous tumors. One week after tumor cell transplantation, immunodeficient BALB / c mice were treated with rosiglitazone via gavage once daily. Subcutaneous nodules in the tumor-bearing mice were measured periodically with calipers. Mice were administered saline once daily (saline group, n=7); rosiglitazone (1.5 mg / kg / mouse, low-dose group, n=7); rosiglitazone (3 mg / kg / mouse, medium-dose group, n=7); and rosiglitazone (6 mg / kg / mouse, high-dose group, n=7). Twenty-four days after transplantation, the subcutaneous tumor volume in the saline group was 100.22 ± 15.05 mm. 3 The volume of subcutaneous tumors in mice in the low-dose rosiglitazone group was 69.33 ± 9.54 mm. 3 The volume of subcutaneous tumors in mice in the rosiglitazone medium-dose group was 62.50 ± 15.33 mm. 3 The volume of subcutaneous tumors in mice in the high-dose rosiglitazone group was 33.29 ± 3.76 mm. 3 Twenty-eight days after transplantation, the volume of subcutaneous tumors in the saline group mice was 190.21 ± 39.81 mm. 3 The volume of subcutaneous tumors in mice in the low-dose rosiglitazone group was 125.53 ± 22.56 mm. 3 The volume of subcutaneous tumors in mice in the rosiglitazone medium-dose group was 77.49 ± 15.13 mm. 3 The volume of subcutaneous tumors in mice in the high-dose rosiglitazone group was 37.88 ± 6.42 mm. 3 Thirty-two days after transplantation, the volume of subcutaneous tumors in the saline group mice was 307.31 ± 66.99 mm. 3 The volume of subcutaneous tumors in mice in the low-dose rosiglitazone group was 188.13 ± 37.27 mm. 3 The volume of subcutaneous tumors in mice in the rosiglitazone medium-dose group was 103.19 ± 64.06 mm. 3 The volume of subcutaneous tumors in mice in the high-dose rosiglitazone group was 42.51 ± 8.77 mm. 3 The results are shown below. Figure 11A. Compared with the saline group, the volume of subcutaneous tumors in mice in the low-dose, medium-dose, and high-dose rosiglitazone groups was significantly reduced at 24, 28, and 32 days after transplantation. The experiment ended 32 days after transplantation, and tumor samples were collected and weighed using an electronic scale. The subcutaneous tumor weight was 617.21 ± 162.80 mg in the saline group, 461.93 ± 153.61 mg in the low-dose rosiglitazone group, 306.82 ± 72.58 mg in the medium-dose rosiglitazone group, and 109.70 ± 15.33 mg in the high-dose rosiglitazone group. (See attached results). Figure 11 B. Compared with the saline group, the subcutaneous tumor weight of mice in the medium-dose and high-dose rosiglitazone groups was significantly reduced. These results indicate that rosiglitazone gavage treatment can inhibit the growth of subcutaneous tumors in tumor-bearing mice.

[0062] Total protein was extracted from tumor samples in each group and subjected to Western blot analysis. After grayscale normalization using the internal reference protein β-actin, the MND1 expression level in subcutaneous tumors of mice in the saline group was 1.390±0.055, in the low-dose rosiglitazone group it was 1.306±0.119, in the medium-dose rosiglitazone group it was 1.147±0.111, and in the high-dose rosiglitazone group it was 0.664±0.064. Results are shown below. Figure 12 Compared with the saline group, the expression of MND1 protein was significantly reduced in mice in the medium-dose and high-dose rosiglitazone groups. These results indicate that rosiglitazone inhibits MND1 protein expression in a concentration-dependent manner.

[0063] (ix) Rosiglitazone treatment inhibited tumor growth in mice with orthotopic tumors, inhibited MND1 protein expression in orthotopic tumors in a concentration-dependent manner, and prolonged the survival time of mice. One week after transplantation into an immunodeficient BALB / c mouse orthotopic glioma model, mice were treated with rosiglitazone via gavage once daily. In vivo imaging was performed 28 days post-transplantation to detect the accumulation of bioluminescence in the mouse brain tumors. Mice were administered saline once daily (saline group, n=7); rosiglitazone (1.5 mg / kg / mouse, low-dose group, n=7); rosiglitazone (3 mg / kg / mouse, medium-dose group, n=7); and rosiglitazone (6 mg / kg / mouse, high-dose group, n=7). The bioluminescence intensity of brain tumors in mice in the saline group was 8.360±0.907×10^7 (p / s), in the low-dose rosiglitazone group it was 7.561±1.540×10^7 (p / s), in the medium-dose rosiglitazone group it was 5.680±0.856×10^7 (p / s), and in the high-dose rosiglitazone group it was 2.462±0.582×10^7 (p / s). See the results below. Figure 13 A. Compared with the saline group, the tumor luminescence intensity in mice in the medium-dose and high-dose rosiglitazone groups was significantly reduced. The experiment ended 32 days after transplantation of the orthotopic tumor model. Mouse brain tissue samples were collected, embedded, sectioned, and stained with hematoxylin-eosin (HE) to determine the size of the orthotopic glioma. The orthotopic tumor volume in the saline group was 56.25 ± 7.706 mm. 3 The orthotopic tumor volume in mice in the low-dose rosiglitazone group was 53.75 ± 8.269 mm. 3 The orthotopic tumor volume in mice in the rosiglitazone medium-dose group was 35.17 ± 6.882 mm. 3 The orthotopic tumor volume in mice in the high-dose rosiglitazone group was 14.48 ± 6.957 mm. 3 The results are shown below. Figure 13 B. Compared with the saline group, the orthotopic tumor volume of mice in the medium-dose and high-dose rosiglitazone groups was significantly reduced.

[0064] Total protein was extracted from tumor samples in each group and subjected to Western blot. After grayscale normalization using the internal reference protein β-actin, the MND1 expression level in mouse brain tumors was 1.211±0.058 in the saline group, 1.049±0.075 in the low-dose rosiglitazone group, 0.659±0.059 in the medium-dose rosiglitazone group, and 0.407±0.036 in the high-dose rosiglitazone group. Results are shown below. Figure 14A. Compared with the saline group, the expression of MND1 protein in mice in the medium-dose and high-dose rosiglitazone groups was significantly reduced. These results indicate that rosiglitazone inhibits MND1 protein expression in a concentration-dependent manner. Mouse survival time was recorded: the survival time of mice in the saline group was 29.86 ± 2.61 days, the survival time of mice in the low-dose rosiglitazone group was 29.43 ± 3.65 days, the survival time of mice in the medium-dose rosiglitazone group was 33.57 ± 3.41 days, and the survival time of mice in the high-dose rosiglitazone group was 39.45 ± 2.62 days. (See attached results) Figure 14 B. Compared with the saline group, the survival time of mice in the medium-dose and high-dose rosiglitazone groups was significantly prolonged. These results indicate that rosiglitazone gavage treatment can inhibit tumor growth in mice with orthotopic tumors, suppress MND1 protein expression in an orthotopic tumor in a concentration-dependent manner, and prolong the survival time of mice.

[0065] Those skilled in the art will also recognize, or be able to identify, many equivalents of the specific embodiments of the invention described herein using no more than conventional experiments. These equivalents are also included in the appended claims.

Claims

1. The use of rosiglitazone or a pharmaceutically acceptable salt thereof in the preparation of drugs for the treatment of gliomas.

2. Use of rosiglitazone or a pharmaceutically acceptable salt thereof in the preparation of pharmaceutical compositions for the treatment of gliomas.

3. A pharmaceutical composition for treating glioma, characterized in that, It contains the active ingredient rosiglitazone or a pharmaceutically acceptable salt thereof, as well as pharmaceutically acceptable excipients.