Yeast composition for fermenting flower and fruit fragrance type lonicera caerulea fruit wine

By using a multi-strain synergistic fermentation of commercial brewing yeast D254, Kluyveromyces H421, and Schizosaccharomyces CICC 32484, the problems of single aroma and strong acidity in blueberry wine were solved, achieving aroma optimization and acidity reduction, thus improving the overall quality and health value of the fruit wine.

CN121652946APending Publication Date: 2026-03-13NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610132208.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-30
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

The current fermentation process of blueberry wine uses a single brewing yeast, resulting in a single aroma, strong acidity and astringency, and a lack of complexity, which affects the quality and consumer acceptance.

Method used

Commercial brewing yeast D254, along with self-isolated Kluyveromyces oryzae H421 and Schizosaccharomyces cerevisiae CICC 32484, were used for multi-strain synergistic fermentation. Through sequential inoculation, the acidity of honeysuckle wine was reduced and the aroma was optimized.

Benefits of technology

It significantly enhances the aroma complexity of honeysuckle wine, reduces malic acid content, improves taste, strengthens antioxidant capacity, and enhances the health value and sensory quality of the fruit wine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms and fermentation engineering, and particularly discloses a Pichia kluyveri strain H421, and the preservation number of the Pichia kluyveri strain H421 is CGMCC (China General Microbiological Culture Collection Center) NO.34649. The bacterial strain H421, commercial saccharomyces cerevisiae D254 and schizosaccharomyces pombe CICC 32484 are sequentially inoculated and fermented, the aroma of the brewed lonicera caerulea fruit wine is dominated by isoamyl acetate and phenethyl acetate, the brewed lonicera caerulea fruit wine is rich in various esters such as ethyl caprylate, ethyl caprate and diethyl succinate, and the characteristic flower and fruit aroma is jointly formed. The strain H421 has excellent alcohol resistance, acid resistance and SO2 resistance, and can adapt to the fermentation environment of the lonicera caerulea fruit wine. By adopting a multi-strain sequential inoculation fermentation method including the strain, the content of malic acid in the lonicera caerulea fruit wine can be remarkably reduced, and the variety and content of aroma substances are greatly increased, so that the problems of strong acerbity and single aroma of the lonicera caerulea fruit wine are effectively improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial and fermentation engineering technology, specifically to the isolation of an aroma-producing Pichia pastoris strain and its application in fermenting honeysuckle wine, and particularly to a brewing method that utilizes this strain for multi-strain synergistic fermentation to optimize the flavor of honeysuckle wine by reducing acidity and enhancing floral and fruity aromas. Background Technology

[0002] Blue honeysuckle fruit ( Lonicera caerulea L. As a natural wild berry, it has a sweet and slightly astringent taste and is rich in polyphenols, flavonoids, anthocyanins, and other recognized important bioactive substances, possessing health benefits such as antioxidant, anti-inflammatory, and metabolism-improving properties. Therefore, incorporating such substances into your daily diet is an effective strategy for promoting health and preventing chronic diseases.

[0003] Fresh honeysuckle berries are soft and juicy, with a delicate flesh structure and extremely thin skin, making them easily damaged by external forces, difficult to preserve and transport, and resulting in nutrient loss. Therefore, further processing honeysuckle berries into wine suitable for storage can not only preserve the nutritional components of the berries but also provide a certain guarantee for the economic income of fruit farmers.

[0004] Aroma is one of the important factors affecting the quality of fruit wine. The aroma of fruit wine is composed of various compounds, mainly involving esters, alcohols, acids, aldehydes, ketones, hydrocarbons, and other chemical substances. Among them, esters can impart unique aroma characteristics to fruit juice. Different aroma substances synergistically or antagonistically contribute to the aromatic quality of fruit wine. A balanced and complex aroma not only reflects the quality and value of fruit wine but is also one of the determining factors for consumer preference. In the honeysuckle wine of this invention, the relative content of esters is 61.84%, with isoamyl acetate and phenylethyl acetate being the dominant components, accounting for 12.80% and 36.84%, respectively. Studies have shown that when using brewer's yeast 1399 to ferment honeysuckle wine, the relative content of esters is 44.15%, with isoamyl acetate accounting for 3.01% and phenylethyl acetate accounting for 1.13% of the total aroma substances. Fermentation of honeysuckle berries with pomace was performed using a fruit wine-specific yeast from Angel Yeast Co., Ltd. The resulting honeysuckle berry wine contained 62.18% esters, with diethyl succinate (23.71%) and ethyl lauryl acetate (15.05%) being the main esters. Isoamyl acetate and phenylethyl acetate, which are abundant in these components as described in this invention, were not detected. Studies have used three fruit wine yeasts: LA-DE, LA-EC, and LA-FR to ferment honeysuckle berry wine. Yeast LA-DE showed the highest ester content in the fermented fruit juice, containing 20 different esters, with an ester content of 37.01%.

[0005] Non-brewing yeast ( non-Saccharomyces yeastsIt is known as the "flavor engineer" in the natural fermentation system due to its diverse metabolic characteristics. It can improve the aroma and flavor characteristics of fruit wine through the produced enzymes and secondary metabolites. A large number of studies have shown that the co-fermentation of non-Saccharomyces cerevisiae and Saccharomyces cerevisiae can enhance the sensory characteristics of fruit wine and improve its quality by increasing the content of aroma compounds such as esters, higher alcohols, and terpenes.

[0006] Malic acid is sensory sour. When its content is too high, malolactic fermentation is usually adopted in production to convert malic acid into mellow and stable lactic acid, reduce the acidity of wine, and improve the taste quality. Schizosaccharomyces pombe ( Schizosaccharomyces pombe ) can grow at a pH value as low as about 3 and is usually used for acid reduction of high-acidity grape juice. Studies have shown that its degradation rate of malic acid can reach 90%, making it an ideal strain for degrading malic acid. This characteristic gives it great application potential in degrading malic acid in blue honeysuckle wine.

[0007] Currently, most blue honeysuckle wines on the market are generally fermented with a single Saccharomyces cerevisiae. This method results in a single aroma layer in the wine body, lacking complexity, and the unique fruity aroma of blue honeysuckle will be damaged during fermentation. At the same time, the content of organic acids in blue honeysuckle fruits is too high, especially malic acid, resulting in a strong sour and astringent taste in its reprocessed products, especially fruit wine, with poor palatability, which restricts the industrial development.

[0008] Based on the current technical limitations, the present invention innovatively proposes a multi-strain co-fermentation system of commercial Saccharomyces cerevisiae D254, self-isolated Pichia kluyveri H421, and Schizosaccharomyces pombe CICC 32484. Through sequential inoculation, effective acid reduction and aroma optimization of blue honeysuckle wine are achieved. Summary of the Invention

[0009] The purpose of the present invention is to provide a Pichia kluyveri strain with ester-producing characteristics, good fermentation characteristics, and excellent tolerance, and to provide a fermentation method that effectively reduces the acidity of blue honeysuckle wine and improves the aroma complexity by using this strain. To solve the problems of strong sour and astringent taste, single aroma, and poor quality of blue honeysuckle wine in the prior art due to the use of a single Saccharomyces cerevisiae for fermentation.

[0010] To achieve the above purpose, the present invention is implemented by the following technical solutions:

[0011] On the one hand, the present invention provides a non-Saccharomyces cerevisiae with ester-producing characteristics and excellent tolerance. The non-Saccharomyces cerevisiae H421 belongs to the genus Pichia and is classified and named as Pichia kluyveri. It was deposited in the China General Microbiological Culture Collection Center on May 23, 2025, with the deposit number CGMCC NO.34649, and the address of the deposit unit is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0012] Furthermore, the present invention provides a method for brewing honeysuckle wine, including the step of fermenting honeysuckle wine using the strain H421.

[0013] Furthermore, the strain H421 was used for mixed fermentation with commercial brewing yeast D254.

[0014] Furthermore, after the mixed fermentation was completed, the yeast strain CICC 32484 was inoculated to carry out acid reduction fermentation.

[0015] Furthermore, the malic acid content was reduced by inoculating with Schizosaccharomyces cerevisiae CICC 32484, and the change in malic acid content was detected by liquid chromatography to determine the optimal fermentation time for reducing malic acid content as 48 h.

[0016] Furthermore, using single-strain fermentation of commercial brewing yeast D254 and mixed fermentation of D254+H421 as controls, the sensory quality, active ingredient content, and antioxidant effect of multi-strain synergistic fermentation of honeysuckle fruit wine were comprehensively evaluated.

[0017] Preferably, the honeysuckle wine obtained through the synergistic fermentation of the aforementioned multi-strain strains effectively reduces the malic acid content and forms a floral and fruity flavor profile dominated by isoamyl acetate and phenethyl acetate.

[0018] The advantages and beneficial effects of this invention can be seen from the above steps:

[0019] First, the Kluyveromyces strain H421 provided by this invention was isolated from a natural fermentation environment. Experiments have confirmed that it can still grow significantly under pH=2.0 conditions, and its tolerance to alcohol concentration can reach 7%, and its tolerance to SO2 concentration is as high as 300 mg / L, far exceeding the national standard limit (250 mg / L). This indicates that it can fully adapt to the high-acid production environment of honeysuckle wine and has good industrial application potential.

[0020] Secondly, sequential inoculation and fermentation of honeysuckle berry wine with multiple strains significantly enhances the variety and content of aroma compounds in the wine. Experiments showed that 30 volatile aroma compounds were detected in honeysuckle berry wine fermented with multiple strains, significantly higher than the 20 compounds in mixed-strain fermentation (D254+H421) and the 12 compounds in the control group (D254 single-strain fermentation). The proportion of esters increased from 37.26% in single-strain fermentation to 61.84%, and key floral and fruity aroma esters such as isoamyl acetate and phenethyl acetate, which were not present in single-strain fermentation, were produced, with contents reaching as high as 2471.39 μg / L and 7114.77 μg / L, respectively, thus improving the aroma quality of the honeysuckle berry wine.

[0021] Third, the multi-strain sequential inoculation fermentation process can efficiently degrade malic acid in honeysuckle wine. Experiments have shown that after fermentation with Schizosaccharomyces cerevisiae for 48 hours, the total malic acid content in the wine decreased from 1.92 mg / mL to 0.30 mg / mL, with a significant acid reduction effect of up to 84.53%, effectively solving the problem of excessive acidity and astringency in honeysuckle wine.

[0022] Fourth, the multi-strain synergistic fermentation method of the present invention can not only reduce acidity and enhance aroma, but also better preserve or transform the active ingredients (such as polyphenols, flavonoids, and anthocyanins) in honeysuckle berries, and give the product stronger antioxidant capacity, thus comprehensively improving the health value and sensory quality of honeysuckle berry wine. Attached Figure Description

[0023] Figure 1 The images show the microscopic morphology (A) of strain H421 in Example 2, and the color development results on TTC ethanol-producing medium (B) and tartrate glycerol-producing medium (C).

[0024] Figure 2 This is the phylogenetic tree of strain H421 constructed based on the 26S rDNA sequence in Example 2.

[0025] Figure 3 This is a radar chart showing the sensory rating of the aroma characteristics of the honeysuckle wine in Example 4.

[0026] Figure 4 This is a comparison chart of polyphenol content in different honeysuckle fruit wine samples in Example 5.

[0027] Figure 5 This is a comparison chart of the flavonoid content in different honeysuckle wine samples in Example 5.

[0028] Figure 6 This is a comparison chart of anthocyanin content in different honeysuckle wine samples in Example 5.

[0029] Figure 7 The values ​​represent the DPPH and ABTS free radical scavenging rates of different honeysuckle wine samples in Example 5.

[0030] Figure 8 The FRAP reduction capacity of different honeysuckle wine samples in Example 5. Detailed Implementation

[0031] The present invention will now be described in further detail with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0032] Example 1: Isolation and Screening of Yeast

[0033] 1. Strain Isolation

[0034] Wild grapes harvested from Tonghua City, Jilin Province, Jixi City, Heilongjiang Province, and Liaoyang City, Liaoning Province were used as the isolation source. 20 g of wild grape samples were added to YPD liquid medium (121℃, sterilized for 20 min) and cultured at 28℃ and 150 r / min for 2 days. The medium contained (g / L): glucose 20, peptone 20, and yeast extract 10.

[0035] The enrichment culture of the strain was serially diluted and plated onto Wallerstein Laboratory (WL) differential medium, and incubated at 28°C for 5 days. This medium contained (g / L): yeast extract 5g, acid-hydrolyzed casein 5g, glucose 5g, potassium dihydrogen phosphate 0.55g, potassium chloride 0.425g, calcium chloride 0.125g, magnesium sulfate 0.125g, ferric chloride 0.0025g, manganese sulfate 0.0025g, and bromocresol green 0.022g. Characteristic colonies were picked and repeatedly streaked on YPD solid medium for purification, and the bacterial cells were observed under a microscope. The purified strain culture was mixed with 30% glycerol at a 1:1 ratio and stored in cryovials at -80°C for later use.

[0036] 2. Strain screening

[0037] a. Screening for alcohol production capacity: The purified strain was streaked onto a chromogenic medium containing triphenyltetrazolium chloride (TTC). The strains with strong alcohol production capacity were screened by the intensity of the red color of the colonies. The upper layer of the medium contained (g / L): TTC 0.5, glucose 5, agar 15, and the lower layer contained (g / L): glucose 10, peptone 2, yeast extract 1.5, magnesium sulfate 0.4, potassium dihydrogen phosphate 1.0, citric acid 0.3, agar 15.

[0038] b. Screening for ester production capacity: The strains screened in step a were streaked onto a differential medium containing glycerol tribaniate and bromocresol purple. The strains with strong ester production capacity were further screened by the intensity of the yellow color of the colonies. The medium contained (g / L): glucose 20, peptone 20, yeast extract 10, glycerol tribaniate 15 (mL / L), bromocresol purple 0.04, and agar 15.

[0039] c. Fermentation rate screening: The strains screened in step b were inoculated at a rate of 4% into YPD liquid medium containing Durham tubes. The strains with faster fermentation rates were screened based on the rate at which the CO2 produced by the strains filled the inverted Durham tubes.

[0040] In summary, using the above methods, a total of 70 yeast strains were isolated and purified from the collected wild grape samples, of which 24 strains had potential fermentation capabilities.

[0041] Information on the isolates of strains with potential fermentation capabilities is shown in Table 1.

[0042] Table 1. Isolation source information of yeast strains with potential fermentation capabilities

[0043]

[0044] 3. Study on strain tolerance

[0045] Using D254 as a control, we continued to study the alcohol tolerance, acid tolerance, and SO2 tolerance of 24 yeast strains with potential fermentation capabilities.

[0046] a. Alcohol tolerance: After sterilizing YPD liquid medium at 121℃ for 20 min, anhydrous ethanol was added to the medium (operated in a clean bench) to adjust the alcohol content of the medium to 7%, 10%, 13%, and 16%. The strains were activated and subcultured at a 3% inoculum, and then inoculated into the medium with different alcohol contents at a 4% inoculum. The cultures were incubated at 28℃ for 48 h, and the OD600 value was measured using a microplate reader. The OD600 value of the strain in the culture medium characterizes its alcohol tolerance. A commercial yeast D254 was used as a control, and a blank test was performed. The experiment was conducted in triplicate with three replicates.

[0047] The tolerance results are shown in Table 2. Strains D254, H17, H18, H32, G23, J1, and L4 showed significant growth at 7% alcohol concentration. Strain P1 showed no growth at 7% alcohol concentration. Strains H27, H421, T2-11, T2-22, C3Y, and P3 showed trace growth at 7% alcohol concentration. Strains H12, H14, H21, T3-6, G8-1, G9-1, G9-11, G10-1, G10-4, and G10-44 ceased growth at 7% alcohol concentration. With increasing alcohol concentration, the growth of the strains was significantly inhibited; even the commercial brewer's yeast D254 could not grow at 13% alcohol concentration. Considering its future application in honeysuckle wine, strains that do not grow at an alcohol concentration of 7% were excluded. Thirteen strains with alcohol tolerance of 7% or higher were selected: H421, H17, H18, H27, H32, T2-11, T2-22, G23, J1, C3Y, P1, P3, and L4, for further studies on their tolerance to acidity and SO2.

[0048] Table 2. Study on alcohol tolerance in yeast

[0049]

[0050] Note: "-" OD600≤0.1 No growth; "*" 0.1≤OD600≤0.3 Trace growth; "+" 0.3≤OD600≤0.5 Growth; "++" 0.5≤OD600≤1.0 Significant growth; "+++" OD600≥1.0 Abundant growth (OD600 is the value after subtracting the blank value)

[0051] b. Acidity tolerance: The pH of YPD liquid medium was adjusted with sodium hydroxide (1.0 mol / L and 0.5 mol / L) and hydrochloric acid (1.0 mol / L and 0.5 mol / L) to pH values ​​of 2.0, 2.5, 3.0, 3.5, and 4.0, respectively, and then sterilized at 121℃ for 20 min. Thirteen strains with alcohol tolerance of ≥7% were activated and subcultured at a 3% inoculum, and then inoculated into media with different pH values ​​at a 4% inoculum. After incubation at 28℃ for 48 h, the OD600 value was measured using a microplate reader. The OD600 value of the strain in the culture medium characterizes its acid tolerance. A commercial yeast D254 was used as a control, and a blank test was performed. The experiment was repeated in triplicate.

[0052] c. SO2 tolerance: Food-grade potassium metabisulfite (0.56%) was added to YPD liquid medium to achieve SO2 concentrations of 50, 100, 150, 200, 250, and 300 mg / L, respectively, and the medium was sterilized at 121℃ for 20 min. Thirteen strains with alcohol tolerance ≥7% were activated and subcultured at a 3% inoculum, and then inoculated at a 4% inoculum into media with different SO2 concentrations. The cultures were incubated at 28℃ for 48 h, and the OD600 value was measured using a microplate reader. The OD600 value of the strains in the culture medium characterizes their SO2 tolerance. Commercial yeast D254 was used as a control, and a blank test was performed. All experiments were conducted in triplicate with three replicates.

[0053] The SO2 and acidity tolerance results of strains H17, H18, H27, H32, H421, T2-11, T2-22, G23, J1, C3Y, P1, P3, and L4 are shown in Table 3. Except for strain C3Y, which showed minimal growth at an SO2 concentration of 300 mg / L, the other strains did not show significant inhibition as the SO2 concentration in the culture medium gradually increased from 50 mg / L to 300 mg / L. They could still grow significantly at an SO2 concentration of 300 mg / L, with strains H421, H17, and H18 even growing in large quantities.

[0054] The acid tolerance results are shown in Table 3. Strains H421, G23, P1, and P3 showed the strongest acid tolerance and could still grow significantly when the pH of the culture medium was as low as 2.0. Strains H17 and H18 showed the second strongest acid tolerance and could grow when the pH of the culture medium was 2.0. Some strains, H27, T2-11, T2-22, J1, and C3Y, could grow in small amounts when the pH of the culture medium was 2.0. As the pH of the culture medium decreased, the growth of the strains was inhibited. Among them, strains H32, L4, and D254 did not grow when the pH of the culture medium was 2.0.

[0055] Table 3. SO2 and acidity tolerance results of the strains

[0056]

[0057] Note: "-" OD600≤0.1 No growth; "*" 0.1≤OD600≤0.3 Trace growth; "+" 0.3≤OD600≤0.5 Growth; "++" 0.5≤OD600≤1.0 Significant growth; "+++" OD600≥1.0 Abundant growth (OD600 is the value after subtracting the blank value)

[0058] Example 2: Screening of aroma-producing strains

[0059] 1. Simulated fermentation experiment

[0060] The fermentation of honeysuckle fruit wine was simulated. A rapid sensory screening of the fermentation broth was conducted using a sensory method to determine the optimal aroma-producing strains. Using commercial brewing yeast D254 as a control, strains H17, H18, H27, H32, H421, T2-11, T2-22, G23, J1, C3Y, P1, P3, and L4 were inoculated into the honeysuckle fruit juice. After culturing at 25°C for 6 days, the sensory characteristics of the fermentation products from different strains were compared using a sensory method, comparing the aroma characteristics in terms of freshness, fruitiness, wine aroma, and off-odors, in order to screen for strains with rich aromas.

[0061] The sensory evaluation results are shown in Table 4. Strains H421, T2-22, G23, J1, P1, P3, L4, and D254 have a fresh aroma, strains H17, H27, H421, and C3Y have a fruity aroma, strains H18, H32, and T2-11 have neither a fresh nor a fruity aroma, and all strains have an alcoholic aroma. Among them, the control strain D254, as a traditional commercial brewing yeast, has obvious fresh and alcoholic aromas in its fermentation broth, but no fruity aroma was found. Strain H421, on the other hand, showed a more obvious aroma advantage, possessing three aroma characteristics: fresh, fruity, and alcoholic.

[0062] Table 4 Sensory evaluation results of the fermentation broth of the strain

[0063]

[0064] Note: "√" indicates that the strain has the corresponding type of odor, and "-" indicates that the strain does not have the corresponding type of odor.

[0065] Therefore, based on the combined results of the tolerance study and sensory evaluation of strain H421, strain H421 was determined to be the optimal strain, namely, the strain H421.

[0066] 2. Molecular biological identification of H421

[0067] Genomic DNA of strain H421 was extracted using an alkaline lysis method and amplified using primers NL1 (5′-GCATATCAATAAGCGGAGGAAAAG-3′) and NL4 (5′-GGTCCGTGTTTCAAGACGG-3′). 5 μL of the PCR product was analyzed by agarose gel electrophoresis. The PCR product was sent to Beijing Ruiboxing Technology Co., Ltd. for 26S rDNA sequencing.

[0068] Figure 1 The microscopic morphology and initial screening colorimetric results of strain H421 are shown.

[0069] Figure 2 As shown, the sequencing results were compared and aligned using BLAST homology search on NCBI, and a phylogenetic tree was constructed.

[0070] Gene sequence of strain H421 (SEQ ID NO. .1) as follows: ACACCGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCTCACCTAGTGTGCGAGTTGTAAATTGCAGGTTGGAGTCTCGGGTTAGACGTGTGTGCAAGTCCCTTGGAACAGGGTGCCACTGAGG GTGAGAGCCCCGTAGCGTGCATGTCGACACCTGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAA GATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCTCGACATGGGATTTACGCATCGTTGCCTCTCGTGGGCGGCGCTCTGGGTTTTTCCTGGGCCAGCATCGGTTTTCGTTGCAGG ATAAGGACAATTGGAATGTGGCTCCTCGGAGTGTTATAGCCTTTTGTAGATGCTGCGTATGGGGACCGAGGGCTGCGGCGGACTCGTTTCGTCTCGGATGCTGGCACAACGGCGCAATACCGCCCGTCTAAACACACCCACGCACACAA

[0071] Combining morphological characteristics and molecular identification results, strain H421 and Kluyveromyces ( Pichia kluyveri The strains clustered together and were most closely related; strain H421 was identified as *Kluyveromyces*. Pichia kluyveri ).

[0072] Example 3 Inoculation and Fermentation

[0073] 1. Raw material processing

[0074] Extract juice from honeysuckle berries, adjust the sugar content of the juice to 20°Brix using edible white sugar, pasteurize (63℃, 30min), and after cooling, add 60 mg / L food-grade potassium metabisulfite for later use.

[0075] 2. Inoculation and fermentation

[0076] Control group (D254): Inoculated with only 3% commercial brewer's yeast D254 and fermented for 12 days.

[0077] Experimental group 1 (D254+H421): D254 and H421 were inoculated simultaneously at a 1:1 ratio (total inoculation amount 3%) and fermented together for 12 days.

[0078] Experimental Group 2 (H421+D254+Schizosaccharomyces cerevisiae): The inoculation method was the same as that of Experimental Group 1. After the main fermentation (first 12 days) was completed, Schizosaccharomyces cerevisiae CICC 32484 was added to continue fermentation. All fermentations were carried out at 20-25℃.

[0079] Example 4 Sensory quality and aroma compound analysis of honeysuckle fruit wine

[0080] 1. Sensory evaluation

[0081] A sensory evaluation team consisting of 10 professionals (5 men and 5 women) was formed. The sensory evaluation criteria for blueberry wine were formulated with reference to the national standard GB 15037-2006 "Wine". The overall sensory evaluation criteria for blueberry wine are shown in Table 5.

[0082] Table 5 Sensory Evaluation Criteria for Blueberry Wine

[0083]

[0084] The sensory evaluation results (Table 6) show that the total sensory evaluation score is 100 points. The control group (D254) scored 71 points, experimental group 1 (D254+H421) scored 78 points, and experimental group 2 (D254+H421+Schizosaccharomyces cerevisiae) scored 84 points. There was no significant difference in clarity and color among the three groups of honeysuckle wine. However, overall, experimental group 2 performed better in the core sensory aspects (aroma and taste). This may be due to the more abundant metabolites produced by the complex metabolic reactions of the strains during the synergistic fermentation process of multi-strain inoculation.

[0085] Table 6 Sensory Evaluation Results

[0086]

[0087] 2. Odor-specific scoring

[0088] A sensory evaluation team consisting of 10 professionals (5 men and 5 women) was formed to conduct aroma-specific scoring according to Table 7 of the Blueberry Wine Aroma Scoring Standard, with a maximum score of 5 points for each item.

[0089] Table 7. Aroma Scoring Criteria for Blueberry Wine

[0090]

[0091] result Figure 3 Aroma-specific scoring radar charts showed no significant differences in acidity and sweetness among the three groups. Furthermore, all three experimental groups had relatively low vanilla scores, indicating that the resulting honeysuckle wines did not possess a pronounced vanilla aroma. However, experimental group 2 showed a clear advantage in berry and floral scores, with scores significantly higher than both the control group and experimental group 1, thus exhibiting a better aroma profile.

[0092] 3. Aroma component analysis

[0093] Volatile aroma compounds in the honeysuckle wine sample were analyzed by HS-SPME-GC-MS: 5 mL of wine sample and 1 g of sodium chloride were added to a 20 mL headspace vial, followed by 10 μL of 4-methyl-2-pentanol, an internal standard diluted 1000 times with ethanol. The mixture was then placed in a water bath (45℃, 30 min) for extraction.

[0094] The gas chromatography conditions were set as follows: the injection port temperature was 250℃, the temperature program was 40℃ for 2 min, then increased to 160℃ at a rate of 8℃ / min for 1 min, then increased to 230℃ at a rate of 10℃ / min for 5 min, and the carrier gas flow rate was set to 1.0 mL / min (splitless injection).

[0095] EI (Electron Impact) Ion Source: Ion source temperature, electron energy, interface temperature and scanning range are 230℃, 70eV, 250℃, and scanning range m / z 35~500, respectively.

[0096] MS images were retrieved using the NISTO8 spectral library, and the relative content of each aroma in the wine sample was quantitatively calculated using the GC front area normalization method.

[0097] Under the same conditions, the contents of various aroma compounds in the honeysuckle wine of the control group, experimental group 1, and experimental group 2 were detected by headspace-solid phase microextraction-gas chromatography-mass spectrometry, respectively. The results are shown in Table 8 (types and contents of volatile ester aroma compounds) and Table 9 (types and contents of volatile acids, alcohols, aldehydes, ketones, and hydrocarbons).

[0098] Table 8. Types and contents of volatile esters in honeysuckle wine

[0099]

[0100] Note: "-" indicates that it was not detected.

[0101] Table 9. Types and contents of volatile substances (acids, alcohols, aldehydes, ketones, and hydrocarbons) in honeysuckle berry wine

[0102]

[0103] Note: "-" indicates that it was not detected.

[0104] The volatile aroma components in honeysuckle berry wine were compared and analyzed using GC-MS technology. The results showed that 12 volatile aroma substances were detected in the control group, 20 volatile aroma substances were detected in experimental group 1, and 30 volatile aroma substances were detected in experimental group 2. This indicates that the sequential inoculation and fermentation of multiple strains in experimental group 2 enriched the flavor diversity of honeysuckle berry wine.

[0105] As shown in Tables 8 and 9, specifically, among the 30 volatile flavor compounds detected in test group 2, there were 12 esters, 5 alcohols, 5 acids, 4 aldehydes and ketones, and 4 hydrocarbons. The esters specifically included ethyl acetate, isoamyl acetate, 3-methyl-4-penten-1-ol acetate, ethyl octanoate, ethyl decanoate, diethyl succinate, phenylethyl acetate, ethyl laurate, ethyl myristate, ethyl cinnamate, ethyl palmitate, and ethyl linoleate. Among these, isoamyl acetate (banana aroma, 2471.39 μg / L) and phenylethyl acetate (rose aroma, 7114.77 μg / L) were the dominant components. Isoamyl alcohol (fermented aroma, fruity aroma, cognac aroma, 2548.63 μg / L) contributed significantly to the alcohol composition. Additionally, aldehydes and ketones, such as 1,1-diethoxyethane (acetal, imparting a fresh, aged aroma, 459.55 μg / L), were also generated. In contrast, the control group and experimental group 1 mainly contained amyl acetate and ethyl hexanoate, and the aforementioned key flavor compounds were not detected. In addition, experimental group 2 has a more comprehensive range of alcohols, acids and hydrocarbons.

[0106] In summary, the multi-strain sequential inoculation fermentation process in experimental group 2 can effectively broaden the aroma complexity of honeysuckle wine and synthesize more key floral and fruity esters, significantly optimizing its overall aroma characteristics.

[0107] Example 5: Evaluation of the content of active ingredients and antioxidant function of honeysuckle fruit wine

[0108] 1. Determination of active ingredient content in honeysuckle fruit wine

[0109] The polyphenol content in honeysuckle wine was determined by the Folin-Ciocalteu method, the flavonoid content was determined by the aluminum chloride method, and the anthocyanin content was determined by the pH differential method.

[0110] Figure 4 As shown, the polyphenol content in the honeysuckle wine fermented by sequential inoculation of multiple strains in experimental group 2 was 6.64 mg / mL, which was significantly higher than that in experimental group 1 (6.26 mg / mL), control group (6.17 mg / mL) and honeysuckle juice (5.94 mg / mL). Therefore, the fermentation process using sequential inoculation of multiple strains significantly increased the polyphenol content in honeysuckle wine.

[0111] Figure 5 As shown, the flavonoid content in the honeysuckle wine of experimental group 2 was 5.06 mg / mL. Although there was no significant difference from that of experimental group 1 (4.89 mg / mL), it was significantly higher than that of honeysuckle wine fermented by D254 alone, the control group (4.64 mg / mL), and unfermented honeysuckle juice (4.05 mg / mL). Therefore, this may be because the unique metabolic pathway of Kluyveromyces H421 promotes the accelerated decomposition of by-products into small flavonoid molecules.

[0112] Numerous studies have confirmed that non-Saccharomyces cerevisiae, including Kluyveromyces kluyveromyces, can better hydrolyze bound flavonoids due to their unique enzymatic hydrolysis system, releasing more free active ingredients and thus significantly increasing the content of active ingredients in fruit juice or wine.

[0113] Figure 6 As shown, the highest anthocyanin content was found in the unfermented honeysuckle juice (1.88 mg / mL). This may be because the experimental procedure in the juice group was simple, keeping the anthocyanins in a relatively stable state and preventing them from being decomposed by light during fermentation, centrifugation, or other operations. The second highest anthocyanin content was found in the honeysuckle wine of experimental group 2 (1.53 mg / mL), which was significantly higher than the 1.25 mg / mL in the honeysuckle wine fermented solely by the control group D254. This may be because the Kluyveromyces H421 yeast has a different metabolic pathway, resulting in less destruction of anthocyanins and a higher retention rate.

[0114] 2. Antioxidant capacity of honeysuckle wine

[0115] a. Determination of DPPH scavenging rate: In a 96-well plate, the honeysuckle liqueur sample was mixed with DPPH solution and reacted at room temperature for 30 min. The absorbance of the sample was measured at 517 nm. The absorbance of the mixture of sample and DPPH solution is A1. The absorbance of the mixture of sample and ethanol is A2, and the absorbance of the mixture of ethanol and DPPH solution is A0. The scavenging rate of the compound is calculated using the following formula:

[0116] DPPH removal rate (%)

[0117] b. Determination of ABTS scavenging rate: In a 96-well plate, the honeysuckle liqueur sample was mixed with ABTS solution and reacted at room temperature for 5 min. The absorbance of the sample at 734 nm was measured. The absorbance of the mixture of sample and ABTS solution is A1; then, ethanol was used instead of the sample and mixed with ABTS solution, and the absorbance was measured as A0. The scavenging rate of the compound was calculated using the following formula:

[0118]

[0119] Figure 7 As shown, the scavenging rates of DPPH and ABTS in the honeysuckle wine fermented by sequential inoculation of multiple strains in experimental group 2 were 93.03% and 62.42%, respectively, significantly higher than those in the control group fermented with D254 alone and the honeysuckle wine fermented with mixed strains D254+H421 in experimental group 1. The polyphenols, flavonoids, and anthocyanins, which are present in higher amounts in experimental group 2, are known antioxidant functional components. Their active groups can directly contribute electrons or hydrogen atoms, thus exhibiting better scavenging effects against DPPH and ABTS.

[0120] c. FRAP reducing power determination: A mixture of 300 mmol / L acetate buffer, 10 mmol / L TPTZ solution, and 20 mmol / L FeCl3 solution at a volume ratio of 10:1:1 was prepared and reacted at 37°C for 10 min to obtain the FRAP working solution. An appropriate amount of FeSO4·7H2O was weighed and added to ultrapure water to prepare a 1.6 mmol / L FeSO4 stock solution. The stock solution was diluted to prepare FeSO4 standard solutions of concentrations of 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, and 1.6 mmol / L. 0.1 mL of each FeSO4 standard solution at different concentration gradients was added to 3 mL of the FRAP working solution, reacted at 37°C for 10 min, and the absorbance was measured at 593 nm. A linear regression equation was established with FeSO4 concentration as the x-axis and absorbance as the y-axis. Based on the experimental data, the regression equation was y = 0.4736x + 0.1166, R² = 0.996. 0.1 mL of honeysuckle berry wine sample was taken, and 3 mL of FRAP working solution was added. The mixture was reacted at 37°C for 10 min. VC was used as a positive control, and the absorbance was measured at 593 nm. Three parallel experiments were performed.

[0121] Figure 8 As shown, the ability of the samples to reduce ferric iron was calculated based on the standard curve, and the results were expressed as FeSO4 concentration (mmol / L). The higher the FRAP value, the more ferrous iron is generated after the antioxidant reduces ferric iron, i.e., the stronger the antioxidant activity of the sample. According to the results, the concentration of FeSO4 in the honeysuckle wine fermented by sequential inoculation of multiple strains in experimental group 2 was equivalent to 69.42 mmol / L, which was not significantly different from that in experimental group 1 (64.81 mmol / L), but significantly higher than that in the control group honeysuckle wine fermented by D254 alone (63.30 mmol / L).

[0122] Example 6: Determination of malic acid content

[0123] The malic acid content in honeysuckle wine was determined by liquid chromatography. 1 mL of honeysuckle wine from the control group, experimental group 1, and experimental group 2 (taken once every 24 h) was added, diluted to 10 mL with purified water, shaken well, centrifuged at 10,000 rpm for 15 min (4℃), and then filtered through a 0.22 μm needle filter for later use.

[0124] The treated sample solutions were analyzed under the same chromatographic conditions. The chromatographic peaks of L-malic acid and D-malic acid were determined based on their respective retention times, and their peak areas were recorded. These peak areas were then substituted into their respective standard curve equations to calculate the concentrations (C, mg / mL) of L-malic acid and D-malic acid in the sample solution. The actual malic acid content in the sample was calculated using the following formula:

[0125] Malic acid content (mg / mL) = (C × V × n) / m

[0126] In the formula:

[0127] C: Analyte concentration (μg / mL) calculated from the standard curve.

[0128] V: Sample final volume (mL)

[0129] n: Sample dilution factor

[0130] m: Sample volume (mL)

[0131] Table 10 shows that the L-malic acid content in the control group was 1.94 mg / mL and the D-malic acid content was 0.24 mg / mL, while the L-malic acid content in experimental group 1 was 1.81 mg / mL and the D-malic acid content was 0.11 mg / mL. There was no significant difference in malic acid content between the two groups. However, in experimental group 2, because Schizosacchariformis was added after the main fermentation to reduce acidity, the L-malic acid content in the resulting honeysuckle wine was reduced to 0.30 mg / mL, and D-malic acid was not detected. The rate of reducing malic acid exceeded 80%, which was a significant effect.

[0132] Table 10 Malic acid standard curve and content

[0133]

[0134] Note: "-" indicates not detected.

[0135] The Kluyveromyces strain H421 and its sequential co-fermentation method with Saccharomyces cerevisiae and Saccharomyces cerevisiae provided by this invention can effectively solve the technical problems of strong acidity and astringency and single aroma in honeysuckle wine. The resulting honeysuckle wine has suitable acidity, rich and complex aroma, good preservation of active ingredients, and significantly improved overall quality.

[0136] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A yeast composition for brewing honeysuckle liqueur, characterized in that, Contains Kluyveromyces (Kluyveromyces) Pichia kluyveri Strain H421, with accession number CGMCC NO.34649, and Saccharomyces cerevisiae ( Saccharomyces cerevisiae ).

2. The method for isolating and screening Pichia pastoris H421 according to claim 1, characterized in that, The method mainly includes the following steps: (1) Yeast was enriched and cultured using wild grapes harvested from Tonghua City, Jilin Province, Jixi City, Heilongjiang Province and Liaoyang City, Liaoning Province as the isolation source. The strains were repeatedly purified by streaking using YPD solid medium combined with microscopic morphology. (2) The strain purified in step (1) was screened for alcohol production capacity by triphenyltetrazolium chloride (TTC) colorimetric method, ester production capacity by glycerol hydrolysis colorimetric method, and fermentation rate by Durham tube method to obtain strains with potential fermentation capacity. (3) Conduct tolerance studies and sensory evaluation of fermentation broth on the target strains screened in step (2) to obtain aroma-producing strains; (4) The strain finally screened in step (3) was subjected to molecular biological identification and confirmed to be Kluyveromyces oryzae (Kluyveromyces oryzae). Pichia kluyveri ), thus obtaining strain H421.

3. A method for brewing honeysuckle fruit wine, characterized in that, Includes the following steps: (1) Preparation of honeysuckle fruit fermentation broth; (2) Inoculate the fermentation broth from step (1) with Kluyveromyces yeast ( Pichia kluyveri H421 and brewer's yeast ( Saccharomyces cerevisiae The strain H421 was subjected to primary fermentation, and its preservation number was CGMCC NO.34649. (3) After the main fermentation is completed, acid reduction fermentation is carried out.

4. The method according to claim 3, characterized in that, The acid-reducing fermentation is carried out by inoculating *Schizosaccharomyces cerevisiae* (Saccharomyces cerevisiae). Schizosaccharomyces pombe The process is carried out using the Saccharomyces cerevisiae CICC 32484.

5. The method according to claim 3 or 4, characterized in that, The brewing yeast is commercial brewing yeast D254.

6. The method according to claim 4, characterized in that, The acid-reducing fermentation time is 48 hours.

7. The method according to claim 6, characterized in that, The malic acid content in the fermented honeysuckle wine was reduced from 1.92 mg / mL to 0.30 mg / mL, with a reduction rate of over 80%.

8. A kind of honeysuckle fruit wine, characterized in that, Brewed by any one of claims 3 to 6.

9. The honeysuckle fruit wine according to claim 8, characterized in that, Its aroma is a combination of floral and fruity esters dominated by isoamyl acetate (2471.39 μg / L) and phenethyl acetate (7114.77 μg / L), and also contains other esters such as ethyl acetate, ethyl octanoate, ethyl decanoate, diethyl succinate, and ethyl laurate.

10. The honeysuckle wine according to claim 8, characterized in that, Its polyphenol content, flavonoid content, anthocyanin retention rate, and in vitro antioxidant activity were all significantly higher than those of the control group inoculated only with the aforementioned Saccharomyces cerevisiae.