Application of DNAL1 gene as a target in screening drugs for the prevention and treatment of Zika virus or dengue virus type 2 infection.

By screening the DNAL1 gene as a key host factor in a tree shrew model, and using CRISPR/Cas9 and siRNA technologies to inhibit DNAL1 gene expression, a DNAL1 gene expression inhibitor was developed. This solved the treatment challenges of Zika virus and dengue virus type 2 infections, achieving broad-spectrum antiviral activity and a high drug resistance barrier.

CN121653249BActive Publication Date: 2026-05-26INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
Filing Date
2026-02-09
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Currently, there are no effective drugs to treat Zika virus (ZIKV) and dengue virus type 2 (DENV-2) infections. Existing treatments are mainly symptomatic and supportive, and there is a lack of broad-spectrum antiviral drug targets. The difficulty in identifying key host factors with existing technologies has hindered the progress of vaccine and drug development.

Method used

Using CRISPR/Cas9 screening technology, the DNAL1 gene was screened as a key host factor in a tree shrew model. DNAL1 gene expression inhibitors were developed by inhibiting DNAL1 gene expression through small interfering RNA (siRNA) or knocking out the DNAL1 gene with CRISPR/Cas9, for the prevention and treatment of Zika virus and dengue virus type 2 infection.

Benefits of technology

DNAL1 gene expression inhibitors can significantly inhibit the replication of Zika virus and dengue virus type 2, providing broad-spectrum antiviral activity and a high drug resistance barrier, thus becoming a potential broad-spectrum antiviral drug target and filling the gap in existing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121653249B_ABST
    Figure CN121653249B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the DNAL1 gene as a target in screening drugs for the prevention and treatment of Zika virus or dengue virus type 2 infection, specifically the application of screening drugs for the prevention and / or treatment of Zika virus or dengue virus type 2 infection with the aim of inhibiting or knocking out the DNAL1 gene. The invention has found that the DNAL1 gene is a key host factor promoting the replication of Zika virus or dengue virus type 2, and that inhibiting the DNAL1 gene through siRNA or knocking out the DNAL1 gene through CRISPR / Cas9 can inhibit the replication of Zika virus or dengue virus type 2. The DNAL1 gene is a potential host factor for flaviviruses, and this invention provides a potential target for the prevention and / or treatment of Zika virus or dengue virus type 2 infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene technology, specifically relating to the application of the DNAL1 gene as a target in screening drugs for the prevention and / or treatment of Zika virus or dengue virus type 2 infection. Background Technology

[0002] Viral infections remain a significant threat to human health. Mosquito-borne viruses, including Zika virus (ZIKV) and dengue virus (DENV), have the potential to trigger large-scale outbreaks, causing enormous public health burdens and widespread socioeconomic impacts. Zika virus is an enveloped, single-stranded, positive-sense RNA virus belonging to the genus Flaviviridae in the family Flaviviridae, primarily transmitted by mosquitoes. ZIKV is a unique member of the flavivirus family, possessing neurotropic properties and capable of crossing important physiological barriers such as the blood-brain barrier, which is mainly composed of brain microvascular endothelial cells (BMECs). Therefore, ZIKV infection can lead to severe neurological complications, including congenital Zika syndrome and adult neurological syndromes, seriously endangering human health. Dengue virus also belongs to the flavivirus family and is similar to ZIKV in terms of genomic structure, transmission vectors, and endemic regions. DENV infection can lead to severe clinical manifestations, such as dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). DENV has four serotypes, among which dengue virus type 2 (DENV-2) has caused numerous outbreaks and can lead to fatal DHF and DSS. Currently, treatment for ZIKV and DENV infections is primarily symptomatic and supportive; no antiviral drugs have been approved for use against these infections. Furthermore, no preventative vaccine against ZIKV is available, and an effective DENV vaccine requires further development. Therefore, identifying novel drug targets against ZIKV and DENV could help address these challenges.

[0003] Novel antiviral drugs can target both viral proteins and host components. Direct-acting antiviral agents (DAAs) and host-targeting antiviral agents (HTAs) are currently the two main categories of antiviral drugs. HTAs, primarily targeting host factors (host functional genes) essential to the viral life cycle, are becoming an innovative direction in antiviral drug development. This is because broad-spectrum antiviral activity and a high resistance barrier are significant advantages of HTAs, effectively compensating for the main drawbacks of DAAs: easy induction of resistance and lack of broad-spectrum effectiveness. Some viruses may share host factors, and these conserved host factors are promising targets for developing broad-spectrum antiviral drugs and universal vaccines. Flavivir viruses are highly similar in life cycle, genomic structure, transmission vectors, and mammalian hosts, suggesting that these viruses may share certain host factors to promote viral infection. Furthermore, arboviruses such as ZIKV and DENV share the Aedes mosquito as their transmission vector, leading to the prevalence of multiple viruses in the same area. Compared to the control of single pathogens, integrated prevention and control strategies are clearly more economical and efficient, and broad-spectrum antiviral drugs are a crucial component in achieving integrated prevention and control strategies in endemic areas. In conclusion, the value of HTA-type broad-spectrum antiviral drugs is undeniable.

[0004] Currently, the number of drug targets for HTA remains limited. Identifying key host factors is helpful in developing new candidate targets for HTA. Whole-genome CRISPR / Cas9 screening technology is a high-throughput screening tool developed based on the CRISPR / Cas gene editing system. It can unbiasedly identify key host factors in viral infection, and can inhibit viral infection by inhibiting host-dependent host factors or activating host-restricting host factors. To date, the number of known key host factors involved in ZIKV infection remains limited, which has hindered the progress of vaccine and drug development to some extent. It is necessary to utilize CRISPR screening, which differs from previous research strategies targeting ZIKV, to discover novel host factors as drug targets and promote HTA development. Tree shrews... Tupaia belangeri Tree shrews (ZIKV) are small mammals that have long been proposed as suitable auxiliary and alternative non-human primates (NHPs) in biomedical research due to their close evolutionary relationship with primates and their susceptibility to a variety of human viruses, making them increasingly recognized as a valuable platform for studying human viral infections. Immunocompact adult tree shrews are susceptible to ZIKV and exhibit clinical and pathological manifestations similar to those in humans after infection; therefore, they are an ideal model for studying ZIKV infection and identifying key host factors.

[0005] The protein encoded by the DNAL1 (Dynein axonemal light chain 1) gene is called dynein axonal light chain 1 (DNAL1), belonging to the dynein family. It is a key subunit of the axonal dynein complex, primarily involved in cellular motility structures (cilia and flagella) and energy metabolism. Mutations or loss of function in the DNAL1 gene are a significant cause of primary ciliary dyskinesia (PCD). PCD is a complex autosomal recessive genetic disorder leading to a wide range of multisystemic manifestations, including chronic respiratory infections and asthenospermia. In the field of virology, research on DNAL1 is extremely limited. Some researchers have proposed that DNAL1 is an essential host protein for HIV and HSV-1 infection, but its specific function and mechanism of action in regulating the viral life cycle remain unclear. Currently, there are no studies on the role of the DNAL1 gene in ZIKV or other flavivirus infections. Summary of the Invention

[0006] This invention provides a novel use for the DNAL1 gene, namely, to screen drugs for the prevention and / or treatment of Zika virus infection or dengue virus type 2 infection by inhibiting or knocking out DNAL1 gene expression.

[0007] The sequence number of the human DNA L1 gene in NCBI is NM_031427.4.

[0008] The drug for preventing and / or treating Zika virus infection is a small interfering RNA (SRNA), with the DNAL1 gene serving as the target of the SRNA, which inhibits DNAL1 gene expression.

[0009] The drug for the prevention and / or treatment of dengue virus type 2 infection is a small interfering RNA (SRNA), with the DNAL1 gene serving as the target of the SRNA, which inhibits DNAL1 gene expression.

[0010] The small interfering RNA sequence is as follows:

[0011] hDNAL1-siRNA1-F: GCAATCCCTTGGAAGAGAA;

[0012] hDNAL1-siRNA1-R:TTCTCTTCCAAGGGATTGC.

[0013] hDNAL1-siRNA2-F:GAGAAGCTTTCACTGTCTA;

[0014] hDNAL1-siRNA2-R:TAGACAGTGAAAGCTTCTC.

[0015] hDNAL1-siRNA3-F:GCAACAACAATCAAAGAAG;

[0016] hDNAL1-siRNA3-R:CTTCTTTGATTGTTGTTGC.

[0017] hDNAL1-siRNA4-F:GGGATCCACATAATGAAGA;

[0018] hDNAL1-siRNA4-R:TCTTCATTATGTGGATCCC.

[0019] The drug of the present invention is composed of a DNAL1 gene expression inhibitor or knockout reagent, and may also contain one or more pharmaceutically acceptable excipients, or be compounded with other active ingredients to exert an inhibitory effect; in addition to being made into tablets, the preparation may also be made into various pharmaceutically acceptable forms such as pills, powders, capsules, granules, oral liquids and injections.

[0020] This invention has discovered that the DNAL1 gene is a key host factor that promotes Zika virus replication. Inhibiting DNAL1 gene expression by using DNAL1 gene expression inhibitors can suppress Zika virus replication. Knocking out the DNAL1 gene can inhibit Zika virus replication in brain microvascular endothelial cells and kidney cells, providing a target gene for the treatment of Zika virus infection. Therefore, the DNAL1 gene can be used for the prevention or treatment of Zika virus infection.

[0021] This invention has found that inhibiting human DNAL1 gene expression via small interfering RNA can suppress ZIKV replication. In human brain microvascular endothelial cells and A549 cells, inhibiting human DNAL1 gene expression with specific siRNA also suppressed ZIKV replication. This confirms that the DNAL1 gene is a candidate target for antiviral drugs against ZIKV, and that DNAL1 gene expression inhibitors can reduce ZIKV replication.

[0022] This invention has found that the DNAL1 gene is a potential host factor for panflavin viruses. Knocking out the DNAL1 gene can inhibit the replication of dengue virus type 2 (DENV-2) in kidney cells. Furthermore, inhibiting the expression of the human DNAL1 gene with specific siRNA in A549 cells also inhibited the replication of DENV-2, indicating that DNAL1 gene expression inhibitors can achieve the goal of reducing the replication of ZIKV and DENV-2.

[0023] Compared with the prior art, the beneficial effects of this invention are as follows:

[0024] 1. This invention discovers that the DNAL1 gene is a key host factor that promotes Zika virus replication and can serve as a potential target for treating Zika virus infection. Inhibition of the DNAL1 gene by siRNA or knockout of the DNAL1 gene by CRISPR / Cas9 can inhibit Zika virus replication. DNAL1 can serve as a target for drugs for the prevention and / or treatment of Zika virus infection. This invention provides an effective new approach for the preparation of drugs for the prevention and / or treatment of Zika virus infection.

[0025] 2. This invention discovers that the DNAL1 gene is a potential host factor for Zika virus. Inhibition of the DNAL1 gene via siRNA or knockout via CRISPR / Cas9 can suppress the replication of dengue virus type 2. DNAL1 gene expression inhibitors can simultaneously reduce the replication of both Zika virus and dengue virus type 2. This invention provides a prospective application of DNAL1 gene expression inhibitors in the treatment of Zika and dengue virus type 2 infections.

[0026] 3. Currently, there are no approved specific antiviral drugs for ZIKV or DENV infection, resulting in a severe lack of effective protection against the epidemic. The candidate drug target DNAL1 identified in this invention originates from the host. Due to its conserved gene sequence and association with multiple viral infections (ZIKV, DENV-2, HIV, and HSV-1), drugs designed targeting this target may have a high resistance barrier and broad-spectrum antiviral activity.

[0027] 4. This invention has established the feasibility of the DNAL1 gene as a drug target for treating ZIKV or DENV-2 infection at the cellular level, providing a potential target for the prevention and / or treatment of ZIKV or DENV-2 infection. Attached Figure Description

[0028] Figure 1 Results of CRISPR / Cas9 knockout screening of the whole genome of tree shrews;

[0029] Figure 2 The expression of three sgRNAs targeting the DNAL1 gene that were enriched during the screening process was determined.

[0030] Figure 3 The results of screening for inhibitors of DNAL1 gene expression, namely, four pairs of siRNAs targeting the DNAL1 gene to inhibit the mRNA expression level of the DNAL1 gene.

[0031] Figure 4 The results of viral load assays were obtained to show the effect of DNAL1 gene expression inhibitors on ZIKV replication.

[0032] Figure 5 The results of viral titer detection in the experiment on the effect of DNAL1 gene expression inhibitors on ZIKV replication;

[0033] Figure 6 To validate the expression level of DNAL1 protein in brain microvascular endothelial cells (BMECs) with stable DNAL1 gene knockout constructed by Western blot.

[0034] Figure 7 To validate the expression level of DNAL1 protein in stably knocked-out renal cells (RC) constructed using Western blot;

[0035] Figure 8 The results of viral load assay for the effect of DNAL1 gene knockout on ZIKV replication in BMEC cells;

[0036] Figure 9 The results of viral titer detection in experiments to determine the effect of DNAL1 gene knockout on ZIKV replication in BMEC cells;

[0037] Figure 10 The results of viral load assays to determine the effect of DNAL1 gene knockout on ZIKV replication in renal cells (RC);

[0038] Figure 11 The results of viral titer detection in experiments to determine the effect of DNAL1 gene knockout on ZIKV replication in renal cells (RC);

[0039] Figure 12 The results show the viral load of ZIKV in DNAL1 gene knockout cell lines.

[0040] Figure 13 The results of viral load assay for the effect of DNAL1 gene knockout on DENV-2 replication in kidney cells;

[0041] Figure 14 The results of viral titer detection in experiments to determine the effect of DNAL1 gene knockout on DENV-2 replication in kidney cells;

[0042] Figure 15 The results of screening for inhibitors of human DNAL1 gene expression, namely, four pairs of siRNAs targeting the human DNAL1 gene to inhibit the mRNA expression level of the DNAL1 gene.

[0043] Figure 16 The results of the experiment on the effect of human DNA L1 gene expression inhibitor (siRNA2) on ZIKV replication in human BMEC cells were obtained by detecting viral load.

[0044] Figure 17The results of the experiment on the effect of human DNA L1 gene expression inhibitor (siRNA2) on ZIKV replication in human BMEC cells were obtained by detecting viral titers.

[0045] Figure 18 The results of the experiment on the effect of human DNA L1 gene expression inhibitor (siRNA2) on ZIKV replication in human A549 cells were obtained by detecting viral load.

[0046] Figure 19 The results of the experiment on the effect of human DNA L1 gene expression inhibitor (siRNA2) on ZIKV replication in human A549 cells were obtained by detecting viral titers.

[0047] Figure 20 Results of viral load assay for the effect of human DNAL1 gene expression inhibitor (siRNA2) on DENV-2 replication in human A549 cells.

[0048] Figure 21 The results of the experiment on the effect of human DNA L1 gene expression inhibitor (siRNA2) on DENV-2 replication in human A549 cells were obtained by detecting viral titers.

[0049] In the above illustration, a two-tailed t-test was used to compare the two sets of data. P <0.05 indicates a statistically significant difference between groups; a significant difference is indicated by an asterisk (*). P <0.05;** P <0.01; ***, P <0.001; ****, P <0.0001. Detailed Implementation

[0050] The following examples further illustrate the substantive content of the present invention, but the content of the present invention is not limited thereto. Unless otherwise specified, the methods in this example are conventional methods, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0051] Example 1: Identifying key host factors involved in Zika virus (ZIKV) infection through whole-genome CRISPR / Cas9 knockout screening in tree shrews.

[0052] To identify novel key host factors associated with Zika virus (ZIKV) infection, a genome-wide CRISPR / Cas9 knockout (GeCKO) screening was performed using a tree shrew model, including the following experimental steps:

[0053] 1. Construction of GeCKO lentiviral library: The whole genome of tree shrew species was obtained from the Ensemble database. Single guide RNAs (sgRNAs) were designed for all protein-coding genes at a ratio of 1:6. The sgRNAs were then cloned into the Cas9-lentiGuide-Puro vector to generate a plasmid library. The plasmids for this library were synthesized by GenScript (Nanjing, China). Furthermore, the library plasmids were packaged into lentiviral libraries in HEK-293T cells.

[0054] 2. Construction of the GeCKO cell library: The lentiviral library was transduced into tree shrew brain microvascular endothelial cells (BMECs) with a multiplicity of infection (MOI) of 0.3 to ensure that each cell was transduced with a lentivirus carrying a maximum of one sgRNA, thus theoretically generating mutant cells with only one candidate gene knocked out. Forty-eight hours after lentiviral library transduction, the transduced BMECs were screened using 6 μg / mL puromycin. After screening with antibiotic resistance, only successfully transduced mutant cells survived, ultimately forming a cell library in which each mutant cell had only one target gene knocked out, namely the tree shrew GeCKO cell library.

[0055] 3. ZIKV Infection and Screening: Three experimental groups were set up: ZIKV-uninfected library cells (Pc), ZIKV-infected library cells (Pn), and ZIKV-infected wild-type BMECs as a positive control. After ZIKV infection of Pn and positive control cells at MOI=5 for 1.5 hours, the inoculum was removed, and cells were cultured in DMEM / F-12 medium containing 2% fetal bovine serum and 1% penicillin-streptomycin at 37°C and 5% carbon dioxide. Cytopathic effect (CPE) was observed daily during screening. Cell survival in the Pn group was assessed based on the cytopathic effect observed in the positive control group, while the Pc group served as a negative control. On the third day after ZIKV infection, when CPE was clearly observed, the culture medium for both the Pn and positive control groups was changed daily to remove dead cells and maintain the proliferation of surviving cells.

[0056] 4. Cell Enrichment and Next-Generation Sequencing: When the positive control group cells showed complete cell endocytosis (CPE) and no significant cell survival, surviving cells from the Pn and Pc groups were collected. Next-generation sequencing was used to analyze the difference in sgRNA enrichment between the two groups to identify candidate genes. Specifically, genomic DNA was extracted from both groups of cells, the inserted sgRNA fragments were amplified, and next-generation sequencing was performed using an Illumina HiSeq 3000. Sequencing data were analyzed using the MAGeCK-RRA algorithm.

[0057] The filtering results are as follows Figure 1As shown, genome-wide CRISPR / Cas9 knockout library screening based on the tree shrew model revealed that the DNAL1 gene was significantly enriched in ZIKV-infected Pn cells compared to negative control Pc cells. Furthermore, as... Figure 2 As shown, three sgRNAs specifically targeting the DNAL1 gene were significantly enriched and increased in Pn cells. These results suggest that the DNAL1 gene is a potential key host factor involved in ZIKV infection.

[0058] Example 2: Screening for inhibitors of DNAL1 gene expression

[0059] Targeting the DNAL1 gene, we screened for specific siRNAs that effectively inhibit its expression, thus serving as inhibitors of DNAL1 gene expression.

[0060] 1. Small interfering RNA interferes with DNAL1 gene expression

[0061] ① Specific siRNA preparation: Targeting the DNAL1 gene, four pairs of candidate specific siRNAs were designed and synthesized by Gemma Biotechnology (Shanghai, China). The small interfering RNA sequences are as follows:

[0062] DNAL1-siRNA1-F: GGGCTGAATTTGTGAAGCT;

[0063] DNAL1-siRNA1-R:AGCTTCACAAATTCAGCCC.

[0064] DNAL1-siRNA2-F: CTGATGCCAAAGAGATAAA;

[0065] DNAL1-siRNA2-R:TTTATCTCTTTTGGCATCAG.

[0066] DNAL1-siRNA3-F:GAGAGTGCCTAGACTGAAA;

[0067] DNAL1-siRNA3-R:TTTCAGTCTAGGCACTCTC.

[0068] DNAL1-siRNA4-F: GCTAACCTGAATGGCTTAA;

[0069] DNAL1-siRNA4-R:TTAAGCCATTCAGGTTAGC.

[0070] ② Cell preparation: Resuscitate and passage BMEC cells normally. One day before transfection, count the cells in the logarithmic growth phase and inoculate them into 12-well cell culture plates overnight. The ideal cell confluence at transfection is approximately 30% and uniformly distributed.

[0071] ③ Culture medium preparation: To eliminate the effect of antibiotics on transfection, prepare complete culture medium without antibiotics in advance;

[0072] ④siRNA dilution: Centrifuge and dissolve the RNA powder in DEPC water to prepare a storage solution. Further dilute the RNA storage solution with serum-free diluent, mix thoroughly, and prepare an RNA dilution solution with a final volume of 25 μL;

[0073] ⑤ Dilution of transfection reagent: Dilute the transfection reagent Entranster with serum-free diluent. TM -R4000, mix thoroughly to prepare a transfection reagent dilution solution with a final volume of 25μL, and let stand at room temperature for 5 minutes;

[0074] ⑥ Preparation of transfection complex: Mix the RNA dilution buffer and the transfection reagent dilution buffer thoroughly and let stand at room temperature for 15 minutes;

[0075] ⑦ Transfect cells: Remove the old culture medium from the cell culture plate and wash the cells twice with PBS. Replace with 950 μL of antibiotic-free complete culture medium. Add 50 μL of the transfection complex to the cells containing 950 μL of culture medium and gently mix using the "one-line" method. Incubate at 37°C for 6 hours and observe the cell condition. If the cell condition is good, there is no need to change the culture medium; continue culturing until the sample collection time.

[0076] ⑧ Sample collection: Cell samples were collected 48 hours after transfection to verify gene expression;

[0077] A negative control group (NC-siRNA) was also set up, with the transfection method being the same as above. The negative control small interfering RNA sequence is as follows:

[0078] NC-siRNA-F:TTCTCCGAACGTGTCACGT;

[0079] NC-siRNA-R:ACGTGACACGTTCGGAGAA.

[0080] 2. Extraction of total RNA from cells: Total RNA was extracted from cell samples using the SevenFast® Total RNA Extraction Kit;

[0081] ① Lysis: Add 350 μL (<5 × 10⁻⁶) to the cell sample. 6 600 μL (cells) or 600 μL (5 × 10⁻⁶ cells) 6 -1×107 Cell lysis buffer, mix thoroughly by pipetting, centrifuge the lysate at 13000 rpm for 3 minutes, and carefully transfer the supernatant to a 1.5 mL EP tube;

[0082] ②Adsorption: Add an equal volume of 70% ethanol, immediately mix by blowing, transfer the mixture to the adsorption column, centrifuge at 13000 rpm for 1 min, and discard the waste liquid;

[0083] ③ Protein removal: Add 700 μL of protein removal solution, incubate at room temperature for 30 seconds, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid; if DNA residue is obvious, you can incubate at room temperature for 5 minutes after adding the protein removal solution and then centrifuge.

[0084] ④ Rinsing: Add 500 μL of rinsing solution, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid. Add another 500 μL of rinsing solution and repeat the rinsing process once more.

[0085] ⑤ Remove ethanol: Place the adsorption column back into the empty collection tube and centrifuge at 13000 rpm for 2 min;

[0086] ⑥ Elution: Place the adsorption column into a 1.5 mL RNase-free EP tube, add 30-50 mL of RNase-free H2O according to the expected RNA yield, incubate at room temperature for 1 min, centrifuge at 12000 rpm for 1 min, determine the RNA concentration, place on ice for subsequent experiments, or store at -80℃ for a long time.

[0087] 3. Real-Time One-Step RT-PCR reaction: The target gene was amplified and quantified using reverse transcription and real-time quantitative PCR with Takara one-step dye reagent.

[0088] ① Prepare the reaction system (20 μL)

[0089]

[0090] Note: All RNA samples need to be quantified to the same standard to eliminate the influence of different reverse transcription efficiencies on the results.

[0091] The primers used in this experiment were synthesized by Sangon Biotech (Shanghai, China), and their sequences are as follows:

[0092] GAPDH-F: GCTGGTGCCGAGTATGTTGTG;

[0093] GAPDH-R: AGTGATGGCGTGGACTGTGGT.

[0094] DNAL1-F: TCCATGCTTGCTAACTGCGA;

[0095] DNAL1-R:TCTCCTACTGCTTCCAGTCCA.

[0096] ② Set up the reaction program

[0097]

[0098] ③ Data processing: According to 2 -ΔΔCt The expression level of the target gene in the sample was calculated using a method that normalizes the expression level using GAPDH as an internal reference.

[0099] like Figure 3 As shown, compared with the negative control NC-siRNA, all four pairs of siRNAs targeting the DNAL1 gene inhibited DNAL1 gene expression 48 hours after transfection into BMEC cells. Among them, the DNAL1-siRNA1 pair of siRNAs showed the best inhibitory effect on DNAL1 gene expression, thus serving as a specific siRNA for inhibiting DNAL1 expression, i.e., an inhibitor of DNAL1 gene expression.

[0100] Example 3: Effect of DNAL1 gene expression inhibitor (siRNA1) on ZIKV replication

[0101] 1. ZIKV infection and sample collection

[0102] ①Small RNA interference with DNAL1 gene expression: DNAL1-siRNA1 screened in Example 2 was used to inhibit the expression of DNAL1 gene in BMEC cells. The transfection methods of negative control NC-siRNA and specific DNAL1-siRNA1 were the same as step 1 in Example 2.

[0103] ② Preparation of cell maintenance medium: Prepare DMEM / F-12 medium containing 2% fetal bovine serum as the cell maintenance medium after inoculation;

[0104] ③ Viral infection: Thaw the ZIKV virus stock solution on ice and set aside. Dilute the virus solution with maintenance medium according to the selected multiplicity of infection (MOI=0.01). Discard the cell culture medium and wash the cells twice with PBS to remove the influence of serum on virus adsorption. Add the diluted virus solution and incubate the cells and virus at 37°C for 1.5 hours.

[0105] ④ Change the medium: Discard the virus incubation medium, wash the cells with PBS to remove free virus particles, and then add cell maintenance medium to continue culturing the cells;

[0106] ⑤ Sample collection: Cell culture supernatant samples were collected 48 hours after ZIKV infection for viral load and viral titer determination.

[0107] 2. Viral load measurement

[0108] (1) Viral RNA extraction: Follow the instructions of QIAGEN viral RNA extraction kit.

[0109] ① Lysis: Prepare AVL buffer containing vector RNA according to the instructions. Add 560 μL of AVL buffer containing vector RNA and 140 μL of cell culture supernatant to a 1.5 mL EP tube, vortex for 15 seconds, briefly centrifuge to remove liquid from the cap, and incubate at room temperature for 10 minutes to lyse the virus particles;

[0110] ②Adsorption: Add 560 μL of anhydrous ethanol, mix by pulse vortex for 15 s, briefly centrifuge the tube to remove the liquid on the cap, then add the solution to the QIAamp Mini column in two portions, centrifuge at 8000 rpm for 1 min, put the QIAamp Mini column into a new 2 mL collection tube, and discard the old tube containing the filtrate.

[0111] ③ Add Buffer AW1: Add 500 μL of Buffer AW1 and centrifuge at 8000 rpm for 1 min. Place the QIAamp Mini column into a new 2 mL collection tube and discard the old tube containing the filtrate;

[0112] ④ Add Buffer AW2: Add 500 μL of Buffer AW2, centrifuge at 14000 rpm for 4 min, discard the old tube containing the filtrate, and place the QIAamp Mini column into a new RNase-free 1.5 mL EP tube;

[0113] ⑤ Elution: Add 60 μL of Buffer AVE equilibrated to room temperature, incubate at room temperature for 1 min, and then centrifuge at 8000 rpm for 1 min; at this point, more than 90% of the viral RNA on the column has been eluted into a new RNase-free 1.5 mL EP tube;

[0114] ⑥ Immediately determine the concentration of the extracted RNA using a UV spectrophotometer, place it on ice for subsequent experiments, or store it at -80℃ for a long period of time.

[0115] (2) Real-Time One-Step RT-PCR Reaction

[0116] ① Calculation of copy number and dilution of standard products:

[0117] After determining the concentration of the standard plasmid, the copy number is calculated using the formula: Copy number = 6.02 × 10⁻⁶. 23 Calculate the corresponding copy number using the formula: × (plasmid concentration) / (number of bases × 660). Dilute the standard plasmid copy number to 10. 10Then, it was serially diluted 10-fold using ddH2O to obtain 10 concentrations of 10... 10 10 9 10 8 10 7 10 6 10 5 10 4 10 3 10 2 10 1 Standards in copies / mL;

[0118] ② Preparation of the reaction system (20 μL): using Takara one-step probe method reagents;

[0119]

[0120] The primers and probes used in this experiment were synthesized by Sangon Biotech (Shanghai, China), and their sequences are as follows:

[0121] ZIKV-F:GGTCAGCGTCCTTCTAATAAACG;

[0122] ZIKV-R:GCACCCTAGTGTCCACTTTTTCC;

[0123] ZIKV-Probe: CTCTCCCATTATGCCTAGGCCAGCGGC.

[0124] ③ Set up the reaction program and collect fluorescence signals:

[0125]

[0126] ④ Data Processing: Construct a standard curve based on the copy number and Ct value of the standard sample. When R... 2 When a value greater than 0.99 confirms the usability of the standard curve, substitute the Ct value of the sample into the standard curve to calculate the viral load of the sample.

[0127] 3. TCID 50 Method for determining viral titer

[0128] ① Cell preparation: Vero cells in logarithmic growth phase were digested with trypsin to prepare a cell suspension. After cell counting, the cells were seeded into 96-well cell plates at a density of 1 × 10⁶ cells per well. 4 Individual cells. Once the cells have grown to a monolayer, they can be inoculated with the virus.

[0129] ② Virus dilution: Perform 10-fold serial dilutions of the virus solution using cell maintenance medium containing 2% FBS. Specifically, add 900 μL of maintenance medium to each 1.5 mL EP tube, then add 100 μL of the original virus solution to the first tube and mix well. At this point, the virus solution is diluted 10-fold.-1 Take 100 μL of virus solution from the first tube and add it to the second tube, then mix well. At this point, the virus solution is diluted to 10. -2 Dilute in this way, one after another;

[0130] ③ Virus inoculation: Wash the 96-well cell culture plate twice with PBS solution. Add 100 μL of cell maintenance medium containing 2% FBS to each well. Then, add virus dilution in descending order of dilution, 100 μL to each well. Each column has 8 replicates of the same dilution. The two ends of the 96-well cell culture plate are negative control columns, with 200 μL of cell maintenance medium containing 2% FBS added to each well. Incubate the cell culture plate at 37°C.

[0131] ④ Interpretation of results: Observe the cytopathic effect daily until no new lesion wells appear, then count the cytopathic effect and calculate the virus titer according to the Karber method.

[0132] See results Figure 4 and Figure 5 Under the same infection conditions (MOI=0.01, 48 hours after infection), the viral load and viral titer of ZIKV in BMECs transfected with DNAL1-siRNA1 were significantly reduced compared with cells treated with negative control siRNA (NC-siRNA). These results further confirm that DNAL1 is a key host factor promoting Zika virus replication, and that inhibiting DNAL1 gene expression can significantly reduce Zika virus replication.

[0133] Example 4: Construction of a stable cell line with knocked-out DNAL1 gene

[0134] To fully assess the impact of the DNAL1 gene on ZIKV replication, it is necessary to construct DNAL1 gene knockout cell lines using the CRISPR / Cas9 gene editing system. DNAL1-KO cell lines were constructed using brain microvascular endothelial cells (BMEC) and kidney cells (RC), respectively.

[0135] 1. sgRNA plasmid synthesis: In this experiment, sgRNA1 targeting the DNAL1 gene was selected from a tree sgRNA library and showed the highest fold enrichment across the entire genome. This tree sgRNA1 targeting the DNAL1 gene (5'-TTTATCTCTTTGGCATCAGA-3') was cloned into the eSpCas9-2A-Puro vector. The plasmid containing the specific sgRNA sequence used in this experiment was synthesized by GenScript (Nanjing, China).

[0136] 2. Plasmid transfection: Using DNA transfection reagent (Entranster) TMTransfect 0.4 μg of sgRNA plasmid into BMEC or RC cells using the H4000 method. The specific steps for plasmid transfection are as follows: ① Cell preparation: Resuscitate and passage cells normally. One day before transfection, count cells in the logarithmic growth phase and incubate them overnight in 12-well cell culture plates. The ideal cell confluence at transfection is approximately 60% and uniform distribution. ② Plasmid dilution: Centrifuge and dissolve the plasmid powder in DEPC water to prepare a storage solution. Further dilute the storage solution with serum-free diluent according to the recommended dosage in the manufacturer's instructions, mix thoroughly, and prepare a plasmid dilution solution with a final volume of 25 μL. ③ Transfection reagent dilution: Dilute the transfection reagent with serum-free diluent according to the recommended dosage in the manufacturer's instructions, mix thoroughly, and prepare a transfection reagent dilution solution with a final volume of 25 μL. Incubate at room temperature for 5 minutes. ④ Transfection complex preparation: Mix the plasmid dilution solution and the transfection reagent dilution solution thoroughly and incubate at room temperature for 15 minutes. ⑤ Transfect cells: Remove the old culture medium from the cell culture plate and wash the cells twice with PBS. Replace with 450 μL of complete culture medium containing antibiotics. Add 50 μL of the transfection complex to the cells in the 450 μL medium and gently mix using a "single-line" method. Incubate at 37°C for 6 hours and observe the cell condition. If the cells are in good condition, it is not necessary to change the culture medium.

[0137] 3. Selection of polyclonal cells for resistance: 24 to 48 hours after transfection, cells were selected with 6 μg / mL puromycin to obtain polyclonal knockout cells.

[0138] 4. Limiting dilution screening of single clones: 48 hours after transfection, single clone knockout cells were screened using the limiting dilution method and passaged further. The specific steps were: cell counting and dilution of the multiclonal knockout cells to prepare a cell suspension with a cell density of 10 cells / mL. Then, 100 μL of the diluted cell suspension was seeded into each well of a 96-well plate. Cell growth in each well was observed daily, and cell colonies formed by single cell growth were marked. Once the single clone cell colony had grown to a confluent monolayer in the 96 wells, the culture was expanded.

[0139] 5. Monoclonal cell identification: In the multiple candidate monoclonal cell lines generated, the expression level of DNAL1 protein was detected by Western blot to evaluate the knockout effect of DNAL1 gene.

[0140] ①Total protein extraction from cells: Wash the cell samples twice with pre-cooled PBS, aspirate the liquid, add RIPA cell lysis buffer containing PMSF protease inhibitor, place the well plate on ice, tap the well plate, lyse for 30 min, transfer the lysis buffer to 1.5 mL EP tube, centrifuge at 12500 rpm and 4℃ for 7 min, collect the supernatant, and store on ice or at -80℃ for later use;

[0141] ② Protein Quantification and Denaturation: Protein was quantified using the BCA method, following the instructions of the Beyotime BCA Protein Assay Kit: Mix 2 µL of protein lysis buffer with 18 µL of PBS to obtain the protein sample. Prepare BCA standards using the diluents provided in the kit, with concentration gradients of 0, 5, 10, 15, 20, and 25 μg / mL. Prepare BCA working solution at a ratio of A:B = 50:1, adding 200 µL of working solution to each well. Add 20 µL of different concentrations of standards or the protein sample to be tested to each well of a 96-well clear plate, followed by 200 µL of BCA working solution, and mix thoroughly by shaking. Incubate the 96-well plate at 37°C for 30 minutes and measure the absorbance at 562 nm. Plot a standard curve by comparing the absorbance of different concentrations of BCA standards with their concentrations. Substitute the absorbance of the protein sample into the standard curve to calculate the concentration of the protein sample to be tested. Dilute the protein sample with PBS as needed for the experiment, add 5× loading buffer in proportion, mix well, and boil in a metal bath at 100°C for 15 minutes to fully denature the protein. Store the denatured protein sample on ice or at -80°C for later use.

[0142] ③ PAGE Gel Preparation: Follow the instructions of the Omni-Easy™ One-Step PAGE Gel Preparation Kit. Using a 1.0mm thick glass plate as an example: Assemble the glass plate according to the instructions, ensuring a good seal. Add 2.7mL each of the lower gel solution and lower gel buffer to the mixing cup, add 60mL of modified coagulant, mix thoroughly, and then add the mixture to the glass plate. The distance between the liquid surface and the upper edge of the short glass plate should be 0.5cm longer than the comb teeth. Leave a small amount of liquid in the mixing cup to assess the gel solidification. No liquid sealing is required. Continue preparing the upper gel mixture by mixing 1mL each of the upper gel solution and colored upper gel buffer, then adding 20μL of modified coagulant and mixing thoroughly. Pour the mixture into the upper layer of the separating gel; leave a small amount of liquid in the mixing cup to assess the gel solidification. Insert 10-well or 15-well comb teeth as needed. Allow to stand at room temperature for approximately 15 minutes until solidified. Remove the comb teeth and the gel is ready for electrophoresis.

[0143] ④ Electrophoresis: Place the solidified gel plate in the electrophoresis tank, add an appropriate amount of 1× electrophoresis buffer, and remove the comb teeth; add an appropriate amount of protein sample to each well, and add protein markers to both ends; electrophoresis at a constant voltage of 80V for about 30 minutes until the protein marker bands appear, and then maintain a constant voltage of 120-150V until the end.

[0144] ⑤ Transfer: The protein on the gel was transferred to the PVDF membrane using a semi-dry transfer method; the 0.45 μm PVDF membrane was activated with methanol, and the gel strips were cut according to the size of the target protein and transferred under constant current.

[0145] ⑥ Sealing: The above PVDF membrane was sealed with TBST solution containing 5% skim milk powder and incubated on a shaker at room temperature for 2 hours;

[0146] ⑦ Primary antibody incubation: Remove the blocking solution, rinse the membrane with 1×TBST, place the membrane in the primary antibody diluted in the specified ratio, and incubate overnight at 4°C;

[0147] ⑧ Membrane washing: Recover the primary antibody dilution solution and freeze it. Wash the membrane three times with 1×TBST, 5 min each time.

[0148] ⑨ Secondary antibody incubation: Place the membrane in horseradish peroxidase-labeled anti-mouse IgG or anti-rabbit IgG antibody diluted in the specified proportion and incubate on a shaker at room temperature for 2 hours;

[0149] ⑩ Development: After washing the membrane 3 times with 1×TBST, develop it with a Millipore chemiluminescence kit. Mix solution A and solution B in a 1:1 ratio, wet the PVDF membrane, incubate in the dark for 10 seconds, and then develop.

[0150] Select the single-clonal cell line with the best knockout effect for stable passage to establish DNAL1 gene knockout cell line, and store it in liquid nitrogen for later use.

[0151] The results of the Western blot analysis are shown below. Figure 6 and Figure 7 This indicates that a stable BMEC or RC cell line with the DNAL1 gene knocked out (DNAL1-KO) has been successfully obtained.

[0152] Example 5: Effects of DNAL1 gene knockout on ZIKV replication in BMEC and RC cells

[0153] Using the DNAL1-KO BMEC or RC cell lines constructed in Example 4, the ZIKV replication levels of wild-type BMEC or RC cells and DNAL1 gene-deficient BMEC and RC cells were compared.

[0154] 1. ZIKV infection and sample collection

[0155] ① Cell preparation: Resuscitate and passage wild-type BMEC cells (or RC cells) and DNAL1-KO cells. Digest cells with trypsin to prepare a cell suspension. Take 10µL of the cell suspension, mix it with trypan blue staining solution, and add it to a cell counting chamber for counting. Dilute the cell suspension according to the experimental purpose and inoculate it into 12-well cell culture plates. Generally, seeding should be done 16 hours before infection, and infection is recommended when the cell confluence is about 90%.

[0156] ② Preparation of cell maintenance medium, virus infection, medium change and sample collection: ZIKV virus was inoculated into cells at MOI = 0.01, 0.1 and 1 respectively, and the rest of the methods were the same as in Example 3;

[0157] 2. Viral load determination: The method is the same as step 2 in Example 3;

[0158] 3. TCID 50 Virus titer determination: The method is the same as step 3 in Example 3;

[0159] Results for the BMEC cell line can be found in [link to results]. Figure 8 and Figure 9 Under ZIKV infection with different MOIs, the viral load and viral titer in the cell culture supernatant of DNAL1 gene-deleted BMEC cells (DNAL1-KO) were significantly reduced compared with wild-type BMEC cells (WT), indicating that knocking out the DNAL1 gene can significantly reduce Zika virus replication.

[0160] Results for the RC cell line can be found in [link to results]. Figure 10 and Figure 11 Under ZIKV infection with different MOIs, compared with wild-type kidney cells (WT), the viral load and viral titer in the cell culture supernatant of DNAL1 gene-deleted kidney cells (DNAL1-KO) were significantly reduced, indicating that knocking out the DNAL1 gene can significantly reduce Zika virus replication.

[0161] Example 6: Multi-step growth curves of ZIKV in DNAL1 gene knockout BMEC cell lines

[0162] Using the DNAL1-KO BMEC cell line constructed in Example 4, the proliferation of ZIKV in DNAL1 gene knockout cells was further evaluated.

[0163] 1. ZIKV infection and sample collection

[0164] ① Cell preparation: Resuscitate and passage wild-type BMEC cells and DNAL1-KO cells. Digest cells with trypsin to prepare a cell suspension. Mix 10 µL of the cell suspension with trypan blue staining solution and add it to a cell counting chamber for counting. Dilute the cell suspension according to the experimental purpose and inoculate into 24-well cell culture plates. Generally, seeding should be done 16 hours before infection, and infection is recommended when the cell confluence is approximately 90%.

[0165] ②Preparation of cell maintenance medium, viral infection and medium replacement: The method is the same as in Example 3;

[0166] ③ Sample collection: Starting 24 hours after ZIKV infection, collect cell culture supernatant samples every 24 hours until the cells die due to complete cytopathic effect. After aliquoting, freeze the samples at -80℃.

[0167] 2. Viral load determination: The method is the same as step 2 in Example 3.

[0168] See results Figure 12Compared with wild-type BMEC cells (WT) infected with ZIKV, the replication level of ZIKV in DNAL1-KO cells with the DNAL1 gene deletion was reduced at all time points, indicating that knocking out the DNAL1 gene can continuously reduce Zika virus replication.

[0169] Example 7: Effect of DNAL1 gene knockout on DENV-2 replication in RC cells

[0170] Using the DNAL1-KO RC cell line constructed in Example 4, the DENV-2 replication level in wild-type RC cells and DNAL1 gene-deficient RC cells was compared.

[0171] 1. DENV-2 infection and sample collection

[0172] ① Cell preparation: Resuscitate and passage wild-type RC cells and DNAL1-KO cells. Digest cells with trypsin to prepare a cell suspension. Mix 10 µL of the cell suspension with trypan blue staining solution and add it to a cell counting chamber for counting. Dilute the cell suspension according to the experimental purpose and inoculate into 12-well cell culture plates. Generally, seeding should be done 16 hours before infection, and infection is best done when the cell confluence is about 90%.

[0173] ② Preparation of cell maintenance medium, DENV-2 infection, medium change and sample collection: DENV-2 virus was inoculated into cells at MOIs of 0.001, 0.01 and 0.1 respectively. The remaining methods are the same as step 1 in Example 3.

[0174] 2. Viral load determination: This experiment used primers and probes targeting DENV-2, and the rest of the methods were the same as step 2 in Example 3.

[0175] The primers and probes used in this experiment were synthesized by Sangon Biotech (Shanghai, China), and their sequences are as follows:

[0176] DENV-2-F: AATTAGAGAGCAGATCTCCTGATGAA;

[0177] DENV-2-R: AGCATTCCAAGTGAGAATCTCTTTGT;

[0178] DENV-2-Probe: CTGTTGTACAGTCGACACGCGGTTTCTC.

[0179] 3. TCID 50 Virus titer determination: The method is the same as step 3 in Example 3.

[0180] See results Figure 13 and Figure 14Under DENV-2 infection with different MOIs, the viral load and viral titer in the cell culture supernatant of DNAL1 gene-deficient renal cells (DNAL1-KO) were significantly reduced compared with wild-type renal cells (WT), indicating that knocking out the DNAL1 gene can significantly reduce the replication of dengue virus type 2.

[0181] Example 8: Screening for inhibitors of human DNA L1 gene expression

[0182] Using the human DNAL1 gene as a target, we screened for specific siRNAs that effectively inhibit its expression, thus serving as inhibitors of human DNAL1 gene expression.

[0183] 1. Small RNAs interfere with human DNA L1 gene expression

[0184] ① Specific siRNA preparation: Four pairs of candidate specific siRNAs were designed and synthesized by Gemma Biotechnology (Shanghai, China) targeting the human DNA L1 gene. The specific small interfering RNA sequences are as follows:

[0185] hDNAL1-siRNA1-F: GCAATCCCTTGGAAGAGAA;

[0186] hDNAL1-siRNA1-R:TTCTCTTCCAAGGGATTGC.

[0187] hDNAL1-siRNA2-F:GAGAAGCTTTCACTGTCTA;

[0188] hDNAL1-siRNA2-R:TAGACAGTGAAAGCTTCTC.

[0189] hDNAL1-siRNA3-F:GCAACAACAATCAAAGAAG;

[0190] hDNAL1-siRNA3-R:CTTCTTTGATTGTTGTTGC.

[0191] hDNAL1-siRNA4-F:GGGATCCACATAATGAAGA;

[0192] hDNAL1-siRNA4-R:TCTTCATTATGTGGATCCC.

[0193] A negative control group (NC-siRNA) was also set up, and the negative control small interfering RNA sequence was:

[0194] NC-siRNA-F:TTCTCCGAACGTGTCACGT;

[0195] NC-siRNA-R:ACGTGACACGTTCGGAGAA.

[0196] ② Cell preparation: Resuscitate and passage human BMEC (hBMEC) cells normally. One day before transfection, count the cells in the logarithmic growth phase and inoculate them into 12-well cell culture plates. Incubate overnight, so that the cell confluence is about 30% and the cells are evenly distributed at the time of transfection.

[0197] ③ The transfection and sample collection methods for the negative control NC-siRNA and the specific hDNAL1-siRNA are the same as step 1 in Example 2.

[0198] 2. Extraction of total RNA from cells: The method is the same as step 2 in Example 2.

[0199] 3. Real-Time One-Step RT-PCR reaction: The method is the same as step 3 in Example 2.

[0200] The primers used in this experiment were synthesized by Sangon Biotech (Shanghai, China), and their sequences are as follows:

[0201] hGAPDH-F: GCACCGTCAAGGCTGAGAAC;

[0202] hGAPDH-R: TGGTGAAGACGCCAGTGGA.

[0203] hDNAL1-F: CCTGGTAAAAGACTGGGCTG;

[0204] hDNAL1-R: GGCACTCTCTTGGTTGCTTC.

[0205] like Figure 15 As shown, compared with the negative control NC-siRNA, all four pairs of siRNAs targeting the human DNAL1 gene inhibited the expression of the human DNAL1 gene 48 hours after transfection into BMEC cells. Among them, the hDNAL1-siRNA2 pair of siRNAs showed the best inhibitory effect on the expression of the human DNAL1 gene. All four pairs of siRNAs can act as inhibitors of the expression of the human DNAL1 gene.

[0206] Example 9: Effect of human DNA L1 gene expression inhibitor (siRNA2) on ZIKV replication in hBMEC cells

[0207] 1. ZIKV infection and sample collection

[0208] ① Small RNA interference with DNAL1 gene expression: The expression of the human DNAL1 gene in hBMEC cells was inhibited using the specific siRNA2 screened in Example 8. The transfection methods for the negative control NC-siRNA and the specific hDNAL1-siRNA2 were the same as step 1 in Example 2;

[0209] ②ZIKV was used to infect hBMEC cells transfected with two siRNAs for 48 hours at the multiplicity of infection (MOI=0.001). The virus inoculation and sample collection methods were the same as in step 1 of Example 3.

[0210] 2. Viral load determination, the method is the same as step 2 in Example 3;

[0211] 3. TCID 50 The viral titer was determined by the same method as step 3 in Example 3;

[0212] See results Figure 16 and Figure 17 Under the same infection conditions (MOI=0.001, 48 hours after infection), compared with cells treated with negative control siRNA (NC-siRNA), hBMECs transfected with hDNAL1-siRNA2 showed significantly reduced viral load and viral titer of Zika virus. These results further confirm that DNAL1 is a key host factor promoting Zika virus replication, and that inhibiting human DNAL1 gene expression can reduce Zika virus replication.

[0213] Example 10: Effect of human DNA L1 gene expression inhibitor (siRNA2) on ZIKV replication in A549 cells

[0214] 1. ZIKV infection and sample collection

[0215] ① Small RNA interference with DNAL1 gene expression: The expression of the human DNAL1 gene in A549 cells was inhibited using the specific siRNA2 screened in Example 8. The transfection methods for the negative control NC-siRNA and the specific hDNAL1-siRNA2 were the same as step 1 in Example 2;

[0216] ②ZIKV was used to infect A549 cells transfected with two siRNAs for 48 hours at the multiplicity of infection (MOI=0.001). The virus inoculation and sample collection methods were the same as in step 1 of Example 3.

[0217] 2. Viral load determination, the method is the same as step 2 in Example 3;

[0218] 3. TCID 50 The viral titer was determined by the same method as step 3 in Example 3;

[0219] See results Figure 18 and Figure 19 Under the same infection conditions (MOI=0.001, 48 hours after infection), compared with cells treated with negative control siRNA (NC-siRNA), A549 cells transfected with hDNAL1-siRNA2 showed significantly reduced viral load and viral titer of Zika virus. This further confirms that inhibiting human DNAL1 gene expression can reduce Zika virus replication.

[0220] Example 11: Effect of human DNA L1 gene expression inhibitor (siRNA2) on DENV-2 replication in A549 cells

[0221] 1. DENV-2 infection and sample collection: The expression of human DNAL1 gene in A549 cells was inhibited using the specific siRNA2 screened in Example 8. The transfection methods for the negative control NC-siRNA and the specific hDNAL1-siRNA2 were the same as in step 1 of Example 2. DENV-2 virus was inoculated into the cells at an MOI of 0.01. The virus infection and sample collection methods were the same as in step 1 of Example 3.

[0222] 2. Viral load determination is the same as step 2 in Example 7;

[0223] 3. TCID 50 The viral titer was determined by the same method as step 3 in Example 3;

[0224] See results Figure 20 and Figure 21 Under the same infection conditions (MOI=0.01, 48 hours after infection), the viral load and viral titer of DENV-2 were significantly reduced in A549 cells transfected with hDNAL1-siRNA2 compared with cells treated with negative control siRNA (NC-siRNA). This further confirms that inhibiting human DNAL1 gene expression can also reduce dengue virus type 2 replication.

[0225] In summary, inhibiting the DNAL1 gene via siRNA or knocking out the DNAL1 gene via CRISPR / Cas9 can suppress the replication of Zika virus or dengue virus type 2. The DNAL1 gene can serve as a target for drugs used to prevent and treat Zika virus and dengue virus type 2 infections.

Claims

1. The application of small interfering RNA targeting the DNAL1 gene in the preparation of drugs for the prevention and / or treatment of Zika virus infection, characterized in that: DNAL1 gene is a target of small interfering RNA (small interfering RNA), which inhibits DNAL1 gene expression. The small interfering RNA sequence is: hDNAL1-siRNA2-F:GAGAAGCTTTCACTGTCTA; hDNAL1-siRNA2-R:TAGACAGTGAAAGCTTCTC.

2. The application of small interfering RNA targeting the DNAL1 gene in the preparation of drugs for the prevention and / or treatment of dengue virus type 2 infection, characterized in that: DNAL1 gene is a target of small interfering RNA (small interfering RNA), which inhibits DNAL1 gene expression. The small interfering RNA sequence is: hDNAL1-siRNA2-F:GAGAAGCTTTCACTGTCTA; hDNAL1-siRNA2-R:TAGACAGTGAAAGCTTCTC.

Citation Information

Patent Citations

  • New application of RNF6 gene

    CN121137012A

  • Treatment and prevention of HIV infection

    US20100273859A1