Method for creating brassica napus resistant plant by using R5 monomer addition line
By backcrossing the R5 monoclonal addition line with Brassica napus and screening with molecular markers, resistant Brassica napus plants were created, solving the problems of limited clubroot control and loss of resistance in existing technologies, and achieving rapid breeding and broad-spectrum resistance enhancement.
Patent Information
- Application Number
- CN202511917973.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-18
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies for preventing clubroot disease have limited effectiveness and high costs. Furthermore, relying on a single disease-resistant gene can easily lead to the loss of resistance, making it difficult to effectively breed clubroot-resistant rapeseed varieties.
By backcrossing the R5 monomeric addition line with rapeseed and combining it with molecular marker screening, plants with R5 chromosome breaks were obtained, and inoculation verification was performed to create resistant rapeseed plants.
This accelerated the process of introducing the radish R chromosome fragment into Brassica napus, pinpointed the disease-resistant region, provided new resistance resources, shortened the breeding time, and improved resistance to clubroot fungus in multiple regions.
Smart Images

Figure CN121667094A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker-assisted breeding, and in particular to a method for creating resistant Brassica napus plants using the R5 monomer addition line. Background Technology
[0002] Clubroot, often called "the cancer of cruciferous plants," is caused by Plasmodiophora brassicae Wor., a fungus belonging to the phylum Plasmodiomycota in the protozoan kingdom. It is a globally prevalent soil-borne disease that is an obligate parasitic fungus that damages cruciferous plants. Dormant spores of Plasmodiophora can survive in the soil for up to 20 years. In recent years, clubroot has spread rapidly and has become one of the most serious diseases affecting the production of cruciferous crops.
[0003] Currently, methods for preventing clubroot disease include agricultural control, chemical control, and biological control. While these methods offer some control, they increase production costs, pollute the environment, and have limited effectiveness, failing to fundamentally solve the problem of clubroot damage. In contrast, developing resistant varieties is the most economical and effective control method. Currently, resistance genes against clubroot fungus are mainly derived from European turnips and Chinese cabbage, making resources very limited. Furthermore, a single resistance gene can easily lead to the development of multiple physiological races, resulting in the loss of resistance in existing resistant varieties.
[0004] Radish (Raphanus) and Brassica are two very important closely related genera in the Brassicaceae family. Currently, resistance loci for clubroot disease in radish are being gradually discovered. For example, Kamei located a dominant resistance locus, Crs1, on radish chromosome R5, which is homologous to Crr3 in rapeseed. The artificially synthesized allotetraploid RRCC (Brassicoraphanus, 2n=36) has been identified as exhibiting immune resistance to multiple physiological races of clubroot pathogens and can serve as a bridge line for improving clubroot resistance in rapeseed. Subsequently, researchers screened for multiple resistance loci on radish chromosomes R8 and R9. Radish provides a valuable resistance resource for breeding clubroot-resistant varieties; therefore, distant hybridization can be used to create monosomal supplementary lines to introduce resistance loci into rapeseed, enriching germplasm resources and holding significant importance for genetic research and breeding work. Summary of the Invention
[0005] The purpose of this invention is to provide a method for creating resistant plants of Brassica napus using the R5 monosodium bromelain addition line, in order to solve the problems existing in the prior art. This invention can accelerate the process of introducing the radish R chromosome fragment into Brassica napus and can locate the disease resistance region. This invention also provides a new source of resistance and technical basis for breeding clubroot resistant varieties and shortens the breeding time.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides a method for preparing resistant plants of Brassica napus, comprising the following steps:
[0008] Using the R5 monosomy addition line (AACC-R5, 2n=39) as the male parent and the double 11 (Brassicanapus, AACC, 2n=38) of Brassica napus as the recurrent parent, backcrossing was performed to obtain backcross offspring;
[0009] Molecular marker screening was performed on the backcross progeny to obtain R5 chromosome break plants, which were then inoculated and verified to obtain the resistant Brassica napus plants.
[0010] Furthermore, the method for preparing the R5 monosodium arabinoline includes: crossing radish cabbage (Brassicoraphanus, RRCC, 2n=36) with Brassica napus (AACC, 2n=38) to obtain hybrid seed generation 1 (RACC, 2n=37).
[0011] Using the hybrid F1 as the male parent and the double 11 of Brassica napus as the recurrent parent, backcrossing and screening were performed to obtain the R5 monomeric addition line.
[0012] Further, the molecular markers include molecular marker R5-28 with nucleotide sequences as shown in SEQ ID NO.1, molecular marker R5-22 with SEQ ID NO.2, molecular marker W2380 with SEQ ID NO.3, and molecular marker W4604 with SEQ ID NO.4.
[0013] Furthermore, the molecular marker screening includes:
[0014] Using the genomic DNA of the backcross progeny as a template, primer pairs were designed to amplify the molecular markers R5-28, R5-22, W2380, and W4604, respectively. The amplification products were collected and detected by electrophoresis.
[0015] When the amplification products of molecular markers R5-28 and R5-22 show no electrophoretic bands, while molecular markers W2380 and W4604 show electrophoretic bands, the backcross progeny is determined to be an R5 chromosome break plant.
[0016] Furthermore, the primer pair for amplifying the molecular marker R5-28 includes the upstream primer shown in SEQ ID NO.5 and the downstream primer shown in SEQ ID NO.6;
[0017] The primer pair for amplifying the molecular marker R5-22 includes the upstream primer shown in SEQ ID NO.7 and the downstream primer shown in SEQ ID NO.8;
[0018] The primer pair for amplifying the molecular marker W2380 includes the upstream primer shown in SEQ ID NO.9 and the downstream primer shown in SEQ ID NO.10;
[0019] The primer pair for amplifying the molecular marker W4604 includes an upstream primer as shown in SEQ ID NO.11 and a downstream primer as shown in SEQ ID NO.12.
[0020] Furthermore, the resistance is clubroot resistance.
[0021] The present invention also provides an application of the rapeseed resistant plant obtained according to the above method in improving the clubroot resistance of rapeseed.
[0022] The present invention also provides an application of the resistant Brassica napus plant obtained according to the above method in the breeding of Brassica napus.
[0023] The present invention discloses the following technical effects:
[0024] The method for creating resistant plants of Brassica napus provided by this invention involves backcrossing the Brassica napus-radish-kale R5 monoclonal addition line with the Brassica napus double 11 line. Molecular markers are used to screen the backcross progeny, obtaining plants with R5 chromosome breaks. These plants are then inoculated to verify resistance, thus obtaining resistant individual plants. Experimental results show that the resistant individual plants obtained using the method provided by this invention exhibit outstanding resistance to clubroot fungi from multiple regions due to the added R5 chromosome fragment. This invention can accelerate the process of introducing radish R chromosome fragments into Brassica napus and can pinpoint the resistance region. Furthermore, this invention provides new germplasm resources and technical basis for breeding clubroot-resistant varieties, shortening the breeding time. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 A cytological diagram of the R5 monomeric addition line (AACC-R5) of Brassica napus-radish kale;
[0027] Figure 2Figure 1 shows the resistance spectrum identification results of the R5 monomer addition system; where A represents the statistical data of the disease index of the inoculated bacteria; B represents the phenotypic diagram of the corresponding bacteria; PbZj represents *Plasmodiophora* isolated from Zhijiang, Hubei; PbWy represents *Plasmodiophora* isolated from Wuyuan, Jiangxi; PbNz represents *Plasmodiophora* isolated from Nanzhang, Hubei; PbYx represents *Plasmodiophora* isolated from Yuxi, Yunnan; PbHsp represents *Plasmodiophora* isolated from Huoshaoping, Hubei; PbXm represents *Plasmodiophora* isolated from Xinmin, Liaoning; PbFq represents *Plasmodiophora* isolated from Fengqing County, Lincang, Yunnan; PbJm represents *Plasmodiophora* isolated from Jingmen, Hubei; PbTc represents *Plasmodiophora* isolated from Tengchong, Yunnan; PbYunx represents *Plasmodiophora* isolated from Yunxian County, Lincang, Yunnan.
[0028] Figure 3 The figure shows the results of resistance verification of the fragmented single plants screened in this invention to clubroot bacteria isolated from different regions after self-crossing and inoculation; where A is the phenotypic diagram of the fragmented single plant inoculated with PbJm; B is the phenotypic diagram of the fragmented plant inoculated with PbXm; D1 (+) represents the addition of the R5 fragment; D1 (-) represents the absence of the R5 fragment.
[0029] Figure 4 This image shows the genotype identification results of resistant and susceptible single plants inoculated with PbJm bacteria; where A is marked by R5-28; B by R5-22; C by W2380; and D by W4604; lanes 1-40 represent resistant plants, and lanes 41-60 represent susceptible plants; M is the DLp 2000 DNA Ladder; P is the positive control; and N is the negative control.
[0030] Figure 5 This image shows the genotype identification results of resistant and susceptible single plants inoculated with PbXm bacteria; where A is marked by R5-28; B by R5-22; C by W2380; and D by W4604; lanes 1-33 represent resistant plants, and lanes 34-52 represent susceptible plants; M is the DLp 2000 DNA Ladder; P is the positive control; and N is the negative control. Detailed Implementation
[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0036] The radish cabbage of this invention has been disclosed in "Zhan Z, Nwafor CC, Hou Z, et al. Cytological and morphological analysis of hybrids between Brassicoraphanus, and Brassicanapus for introgression of clubroot resistant trait into Brassica napus L.PLoS One. 2017;12(5):e0177470. Published 2017 May 15." The applicant promises to distribute the above-mentioned biological material to the public within 20 years from the date of application of this invention.
[0037] Example 1
[0038] The synthetic allopolyploid material Brassicoraphanus (RRCC, 2n=36) was crossbred with Brassica napus (AACC, 2n=38) to obtain the F1 hybrid (RACC, 2n=37). Using the F1 hybrid as the male parent and Brassica napus (AACC, 2n=38) as the recurrent parent, backcrossing was performed to obtain the R5 monosomy addition line (AACC-R5, 2n=39).
[0039] Using the R5 monomeric addition line as the male parent and the Shuang 11 rapeseed as the recurrent parent, a backcross was performed to obtain backcross progeny, which were used for subsequent molecular marker screening and inoculation verification.
[0040] Example 2
[0041] 1. Cytological analysis of AACC-R5 monomeric addition line
[0042] After individual plants budded, the chromosome composition of the R5 monosomy addition line was verified using cytological methods, such as... Figure 1 As shown, the results indicate that the chromosome composition of the R5 monosomy hetero-attachment line is 39, i.e., AACC (2n=38) + R5 = 39, which further verifies the reliability of the monosomy hetero-attachment line.
[0043] 2. Resistance identification of the R5 monomer addition line
[0044] The main physiological races of *Plasmodiophora* in China are race 4, with PbZj representing *Plasmodiophora* isolated from Zhijiang, Hubei; PbWy representing *Plasmodiophora* isolated from Wuyuan, Jiangxi; PbNz representing *Plasmodiophora* isolated from Nanzhang, Hubei; PbYx representing *Plasmodiophora* isolated from Yuxi, Yunnan; PbHsp representing *Plasmodiophora* isolated from Huoshaoping, Hubei; PbXm representing *Plasmodiophora* isolated from Xinmin, Liaoning; PbFq representing *Plasmodiophora* isolated from Fengqing County, Lincang, Yunnan; PbJm representing *Plasmodiophora* isolated from Jingmen, Hubei; PbTc representing *Plasmodiophora* isolated from Tengchong, Yunnan; and PbYunx representing *Plasmodiophora* isolated from Yunxian County, Lincang, Yunnan.
[0045] Four materials—AACC-R5, H5R (Huashuang 5R, containing the resistance site PbBa8.1), the restorer line of Huayouza 62R (409R), and ZS11—were inoculated with the nine clubroot fungi mentioned above, excluding PbXm. ZS11 served as a susceptible control. For the PbXm inoculation experiment, resistant Chinese cabbage DW (which showed some resistance to *Xinminella*) served as the resistance control, and susceptible Chinese cabbage 91-12 served as the susceptible control. The results are as follows: Figure 2As shown in Figures A and B, the R5 monomeric supplementation line exhibited immune resistance to the aforementioned 10 *Plasmodiophora* strains, with a DI of 0 for all. H5R showed some sensitivity to *Plasmodiophora* strains from nine regions other than Zhijiang, Hubei Province, while 409R showed sensitivity to *PbYx*, *PbYx*, *PbFq*, *PbTc*, and *PbYunx*. However, the R5 monomeric supplementation line was resistant to *Plasmodiophora* strains isolated from all regions. In conclusion, the R5 monomeric supplementation line exhibits immune resistance to *Plasmodiophora* strains from multiple regions in China.
[0046] 3. Development of molecular markers and their detection results
[0047] First, four molecular markers were used to detect backcross progeny obtained by UV irradiation, and single plants with R5 chromosome breaks were preliminarily screened. Inoculation tests on these broken single plants revealed that one single plant, D1, had a fragment of marker W2380 attached to the middle of marker W4604 at the end of the R5 chromosome. This fragment exhibited immunoresistance when inoculated with *Plasmodiophora* from Jingmen and Xinmin. The size of the attached fragment was 22.34 Mb.
[0048] The PCR amplification system was as follows: total reaction volume 10 µL, including 2 µL DNA template, 0.5 µL each of forward and reverse primers, 6 µL 2 × Taq Master Mix (Dye Plus), and 3 µL ddH2O.
[0049] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 51℃ annealing for 15 s, 72℃ extension for 5 min, 35 cycles; 72℃ extension for 5 min.
[0050] Subsequently, agarose gel electrophoresis was performed to detect the genotype bands.
[0051] The nucleotide sequence of R5-28 (SEQ ID NO.1) is as follows:
[0052] GTTTCCGTAGACACGACAAGGAGAAGGCGATGAGAGGAGGAAGATCAGACGGAGGCAAGAAGAAGCCAGTGATCGCTTTGGTCTGCATTGCAGCGGTACTTCTTGTTTTTGTATACCTCTTCTTCGGCTCTTCTAACCATGGAGCCTCAGCTATTGAGTACGGGAGAAAGCTTGGTTTGGGTGGTGATGATGATCCTACTACCAAAAAGGACGAGCCTTCTTCTACCTCCTCCTTTTATGTAGATGATAATGATGATGATGCCAATGGTTTCACTCCAAGAAGCTTCCCTGTGTGTGATGACCGCCACTCGGAGCTTATTCCTTGCTTAGACAGGAACCTCATTTACCAGATGAGACTGAAGCTTGACTTGTCTTTGATGGAGCATTATG。
[0053] Forward primer: GTTTCCGTAGACACGACAAG (SEQ ID NO.5);
[0054] Reverse primer: CATAATGCTCCATCAAAGAC (SEQ ID NO.6).
[0055] The nucleotide sequence of R5-22 (SEQ ID NO.2) is:
[0056] TGGCATTTTATTTGGTACGCCTACACTAATACATGTAAAAATTACACTAATGGCAATAACCTATGCTCTATTATTCAAATTAATAGAGCATAAAAATAGAGAAAATTAGATAGATAAAAAAGAAAAATACAAAAATTACAAAAACTTGAGTATTATTAACCATTTATTTATTAAATTAATTTATTTTTCTCTAAAATATTTAAATGCAAATTCAGATTCAAATTAATAAATTGTATAAAATTTATATTCCAATATTAAACCCAATTTTCCGTGC.
[0057] Forward primer (SEQ ID NO.7): TGGCATTTTATTTGGTACGC;
[0058] Downstream primer (SEQ ID NO.8): GCACGGAAAATTGGGTTTAA.
[0059] The nucleotide sequence (SEQ ID NO.3) of W2380 is as follows:
[0060] CGGCAAACTGCTATTCTATTGCTCAAACTTGAGGTGGTCTGGGTAACCAGACCGGAATAGAACAACCAACAAAAAATAACTTCCTATGGAAGGATCTAGCTGTCTTAGCTAAAGAATCTGAAGTCTGGTTATGCGCCCTTGGAACAAAAGTAATCTTGAAGTCCGGAAAGCAT ATGAGCAGTGTCTCTATCCTCTCTAATTCCATAGCAAAACTTGGCCAAGCATGTGGTTCCTTGATCATTGTAATCAAATCTTTGCAGTCTGTCCCGAAGTTCTGACATGTCGAATGCTGGAGCATGTTTTCCATTGCCCATCGCAGTGCTTCCACCTCTGAGTGTAGAGCTG.
[0061] W2380 upstream primer (SEQ ID NO.9): CGGCAAACTGCTATTCTATTGC;
[0062] W2380 downstream primer (SEQ ID NO.10): CAGCTCTACACTCAGAGGTG.
[0063] The nucleotide sequence (SEQ ID NO.4) of W4604 is as follows:
[0064] GTCCTGTTAAATAGTGGCCTTATTTGTTTTCTCATTGGTCTCAGGTTTGTCCCCAAAATAAAATAGTGGAAATATGACAAGCAGCACAAAATAAACATACAAAACAACAAATGAATACAGAAACAAAATAGAATTACAACGTATCCTTACAGAAAGAACCTCATAAATTATACTTATTTTCATTT TTACCCCATTAATATTTTTTGGTTCATGGCCTAGATACAAGAGAGAAAAGTAGTAGTGATTAATATGGTTTAGCATGGTTTTCCGACCCGGCAATCCAATGCCTCCGGCGTATTTGGTAAGCTTTGAAACGGCCGAACCGTGTTTGGGCTTTATCATCTGTTGTCTAGAGTGTGAACACATGAACC.
[0065] W4604 upstream primer (SEQ ID NO.11): GTCCTGTTAAATAGTGGCC;
[0066] W4604 downstream primer (SEQ ID NO.12): GGTTCATGTGTTCACACTCTA.
[0067] 4. Indoor inoculation system—soil inoculation method
[0068] Root nodules were collected from the diseased area and stored at -20°C. Before use, the nodules were removed and allowed to thaw naturally at room temperature. After thawing, an appropriate amount of sterile water was added, and the nodules were thoroughly ground into a homogeneous slurry using a grinder. The slurry was then filtered through eight layers of gauze to remove residual tissue fragments, yielding a bacterial solution containing *Plasmodiophora stearothermii* spores. The spore concentration in the bacterial solution was determined using a hemocytometer, and the spore count was adjusted to 5 × 10⁻⁶ spores by adding sterile water. 7 The standard concentration of this spore suspension is [number] spores / mL. Storage of this spore suspension depends on the situation: for short-term use (within 12 days), it can be refrigerated at 4°C; for long-term storage, it should be frozen at -20°C.
[0069] The prepared standard concentration spore suspension was thoroughly mixed with the substrate soil, and then incubated in a dark incubator at 28°C for 2 days to complete the preparation of the mycotoxin soil. After incubation, the mycotoxin soil was evenly spread into each well of a 60-well tray, and then the germinated seeds were transplanted into the trays, with one seed placed in each well. Finally, the trays were transferred to a greenhouse for cultivation, where the environmental parameters needed to be strictly controlled: the light intensity was set at 200 mmol·m². -2 ·s -1The photoperiod is 16 hours of light and 8 hours of darkness, and the temperature is kept constant at 23°C.
[0070] 5. Investigation of clubroot disease resistance and susceptibility phenotypes
[0071] After the materials have been inoculated and cultured for 30 days, and all infected control plants have shown obvious symptoms of infection, a phenotypic survey will be conducted.
[0072] During the investigation, the experimental material to be tested was gently removed from the fungal soil, and the soil adhering to the roots was rinsed off with clean water to avoid damaging the root nodules or root system. Based on the actual morphology of the root nodules, the severity of the disease was divided into four levels, with the following criteria for each level:
[0073] Grade 0 indicates that no root nodules are formed in the root; Grade 1 indicates that only a few lateral roots have very small root nodules, and the main root shows no signs of disease; Grade 2 indicates that the number of root nodules increases, and medium-sized root nodules appear in both the main root and lateral roots; Grade 3 indicates that the main root is covered with large root nodules, and the lateral roots are basically absent.
[0074] This invention uses the disease index % to reflect the degree of resistance. The formula for calculating the disease index is as follows:
[0075] ;
[0076] Based on the disease index, the disease resistance and susceptibility are divided into 7 categories: DI=0 represents immunity; 0<DI≤5 represents high resistance; 5<DI≤10 represents resistance; 10<DI≤20 represents moderate resistance; 20<DI≤30 represents moderate susceptibility; 30<DI≤50 represents susceptibility; and 50<DI≤100 represents high susceptibility.
[0077] 6. Resistance identification of fragmented single plants
[0078] The main physiological race of *Plasmodiophora* in China is race 4, with PbJm and PbXm representing two different regions: Jingmen (JM) in Hubei Province and Xinmin (XM) in Liaoning Province, respectively. PbXm is more virulent than PbJm. Five materials—the restorer lines of D1(+), D1(-), H5R, Huayouza 62R (409R), and ZS11—were inoculated with PbJm and PbXm, respectively, with ZS11 serving as a susceptible control. The phenotypes after inoculation were as follows: Figure 3 As shown in A and B.
[0079] Using primers with nucleotide sequences as shown in SEQ ID NO.5-SEQ ID NO.12, the R5-28, R5-22, W2380, and W4604 markers in four materials—D1, H5R, Huayouza 62R restorer lines (409R), and ZS11—were detected after inoculation for genotyping. The results of PbJm inoculation are as follows: Figure 4Results of AD and PbXm inoculation were as follows Figure 5 As shown in AD.
[0080] The resistance statistics are shown in Tables 1 and 2. Combined with the results of the above indoor inoculation experiments and genotype identification, it is evident that self-pollinated plants of D1 containing the fragment between the W2380 and W4604 markers exhibit immune resistance to both *P. jingmen* (PbJm) and *P. xinmin* (PbXm). In conclusion, D1(+) is a *Brassica napus*-type rapeseed material with radish fragments exhibiting immune resistance to *P. jingmen* and *P. xinmin*, the physiological races of *P. jingmen* and *P. xinmin*, in China, with stronger resistance than H5R.
[0081] Table 1. Statistics on clubroot resistance of fragmented single plants in grafted with PbJm.
[0082]
[0083] Note: D1(+) indicates that the R5 fragment has been appended, and D1(-) indicates that the R5 fragment has not been appended.
[0084] Table 2. Statistics on clubroot resistance of fragmented single plants inoculated with PbXm.
[0085]
[0086] Note: D1(+) indicates that the R5 fragment has been appended, and D1(-) indicates that the R5 fragment has not been appended.
[0087] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method of making a resistant Brassica napus plant, characterized in that, The method comprises the following steps: The R5 monosomic addition line is prepared by crossing Raphanobrassica with Brassica napus Huashuang No. 5 to obtain hybrid F1 generation; The R5 monosomic addition line is prepared by crossing the hybrid F1 generation with Brassica napus Zhongshuang 11 as a recurrent parent.
2. The method of claim 1, wherein, The method for preparing the R5 monosomic addition line comprises the following steps: The R5 monosomic addition line is prepared by crossing the hybrid F1 generation with Brassica napus Zhongshuang 11 as a recurrent parent.
3. The method of claim 1, wherein, The molecular marker comprises a nucleotide sequence as shown in SEQ ID NO. 1, a molecular marker R5-28, a nucleotide sequence as shown in SEQ ID NO. 2, a molecular marker R5-22, a nucleotide sequence as shown in SEQ ID NO. 3, a molecular marker W2380, and a nucleotide sequence as shown in SEQ ID NO. 4, a molecular marker W4604.
4. The method of claim 3, wherein, The molecular marker screening comprises the following steps: The genomic DNA of the backcross progeny is used as a template, and a primer pair is designed to amplify the molecular marker R5-28, the molecular marker R5-22, the molecular marker W2380 and the molecular marker W4604, respectively, the amplification products are collected, and the amplification products are subjected to electrophoresis detection; When the amplification products of the molecular marker R5-28 and the molecular marker R5-22 have no electrophoretic bands, and the amplification products of the molecular marker W2380 and the molecular marker W4604 have electrophoretic bands, the backcross progeny is determined as an R5 chromosome breakage plant.
5. The method of claim 4, wherein, The primer pair for amplifying the molecular marker R5-28 comprises an upstream primer as shown in SEQ ID NO. 5 and a downstream primer as shown in SEQ ID NO. 6; The primer pair for amplifying the molecular marker R5-22 comprises an upstream primer as shown in SEQ ID NO. 7 and a downstream primer as shown in SEQ ID NO. 8; The primer pair for amplifying the molecular marker W2380 comprises an upstream primer as shown in SEQ ID NO. 9 and a downstream primer as shown in SEQ ID NO. 10; The primer pair for amplifying the molecular marker W4604 comprises an upstream primer as shown in SEQ ID NO. 11 and a downstream primer as shown in SEQ ID NO.
12.
6. The method according to any one of claims 1 to 5, wherein, The resistance is resistance to clubroot.
7. A Brassica napus resistant plant obtained by the method according to any one of claims 1-6, for use in improving the resistance of Brassica napus to clubroot.
8. A Brassica napus resistant plant obtained by the method according to any one of claims 1-6, for use in breeding Brassica napus.