Limonium bicolor gene LbYAB1 and application thereof

By studying the negative regulatory function of the LbYAB1 gene in *Limonium bicolor*, and using genetic engineering to regulate salt gland development, the problem of insufficient salt tolerance in crops was solved, salt tolerance was improved, and a new method for breeding salt-tolerant crops was provided.

CN121673379APending Publication Date: 2026-03-17SHANDONG NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511473711.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-15
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Most crops lack salt tolerance, leading to severe soil salinization that significantly impacts production and economic returns. Current technologies lack effective salt-tolerant gene resources for breeding salt-tolerant crops.

Method used

By studying the LbYAB1 gene of Limonium bicolor, it was found that it has a negative regulatory function in salt gland development. By using genetic engineering methods to overexpress or silence LbYAB1, the growth and development of salt glands and salt tolerance can be regulated. This includes using VIGS technology to silence LbYAB1 and constructing transgenic plants to improve salt tolerance.

Benefits of technology

By regulating the expression of LbYAB1, salt gland development and salt tolerance were significantly affected. Overexpression lines showed reduced salt tolerance, while silenced lines showed enhanced salt tolerance, providing a new pathway for cultivating salt-tolerant crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to the technical field of plant genetic engineering, and discloses a limonium bicolor gene LbYAB1 and application thereof. The new function of the LbYAB1 is found, firstly, the expression of the LbYAB1 in salt glands and leaf primordia is proved through RNA in-situ hybridization and a promoter driven GUS tissue staining technology, and the expression of the LbYAB1 is induced by treatment of 6-benzylaminopurine. Secondly, a genetic transformation technology is updated, a stable overexpressed LbYAB1 strain is obtained, and by exploring the LbYAB1 function of an overexpressed and silent strain, it is found that compared with a wild type, development of salt glands of the overexpressed strain is inhibited, the salt secreting capacity is weakened, and the salt tolerance is reduced; a silent strain shows an opposite phenotype, and a result proves that the LbYAB1 is a negative regulation factor for salt gland development. Overexpression of the gene in limonium bicolor and arabidopsis thaliana both leads to enhancement of salt sensitivity. The invention not only lays a foundation for further exploring and revealing the development mechanism of salt glands, but also opens up a new path for cultivating salt-tolerant crops.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and more specifically, to the LbYAB1 gene of *Limonium bicolor* and its applications. Background Technology

[0002] Soil salinization severely restricts crop production and impacts economic returns because most important crops lack the ability to tolerate high salt concentrations. Improving plant salt tolerance is crucial for the development and utilization of saline land. High concentrations of salt (such as sodium chloride) accumulated in saline soils trigger osmotic and ion stress, leading to oxidative stress and a series of secondary stresses. Normal plant physiological activities are severely affected by cellular oxygen metabolism disorders caused by dehydration, ion imbalance, reduced enzyme activity, and the accumulation of reactive oxygen species (ROS). To resist salt stress, plants respond to high-salt environments by monitoring environmental changes and altering ion transport and plant hormone signal transduction pathways.

[0003] Plants have evolved a variety of strategies to cope with salt stress. For example, various plant hormones respond to salt stress by regulating metabolism, with abscisic acid (ABA) playing a key role. In addition, cytokinins, jasmonic acid (JA), gibberellins (GAs), ethylene, and salicylic acid (SA) can also promote the accumulation of osmotic protectants, regulate osmotic balance, and enhance the activity of antioxidant enzymes under salt stress, thereby strengthening ROS scavenging capacity and mitigating the effects of salt damage. Notably, in addition to the above general strategies, halophytes have also evolved special salt tolerance characteristics, which can be further divided into true halophytes, pseudohalophytes, and halophilic halophytes. They can complete their life cycle under high salt stress exceeding 200 mM NaCl. Halophilic halophytes possess typical salt-secreting structures (such as salt glands), which can excrete excess toxic ions through leaves and stems to avoid salt poisoning. Research on the development of salt glands and salt tolerance mechanisms in halophilic plants will help discover salt tolerance-related genes and provide resources for breeding salt-tolerant crops.

[0004] Salt glands are typical epidermal structures, considered the fourth type of plant epidermal structure after trichomes, stomata, and catenary cells. Notably, many reported salt gland development genes share high homology with epidermal development genes, such as LbTTG1, LbNAC4, LbTRY, and LbCPC in *Limonium bicolor*. Furthermore, most genes regulating stomatal and trichome development encode transcription factors, suggesting that transcription factors may also be involved in the regulation of salt gland formation.

[0005] YABBY (YAB) transcription factors regulate distal cell fate determination during embryogenesis and organ development. YAB proteins belong to a subfamily of the zinc finger protein superfamily and possess two conserved domains: an N-terminal C2C2 zinc finger domain and a C-terminal YABBY domain. Members of the YAB family are involved in the initiation of the shoot apical meristem (SAM) in embryonic development. Arabidopsis thaliana (… Arabidopsis thaliana There are six YAB members: YAB1 (also known as FILAMENTOUS FLOWER [FIL]), YAB2, YAB3, YAB4 (also known as INNER NO OUTER [INO]), YAB5, and CRABS CLAW (CRC). YAB1 regulates floral organ formation and leaf development. YAB1 is mainly expressed in the adaxial region of developing leaves and floral organ primordia, participating in the determination of adaxial epidermal cell fate during embryogenesis and organogenesis, and regulating the initial development of the shoot apical meristem (SAM). In other plants such as millet... Setaria italica In *Camellia oleifera*, the YAB transcription factor DROOPING LEAF (SiDL) has been shown to negatively regulate the salt stress response (Guo et al., 2022). Camellia oleifera ) and tea trees ( Camellia sinensis In this study, the expression of multiple YAB family genes was suppressed under salt stress. However, the YAB gene family of *Limonium bicolor* has not yet been determined. Summary of the Invention

[0006] The purpose of this invention is to provide the LbYAB1 gene of *Limonium bicolor* and its applications.

[0007] As a plant with both ornamental and medicinal value, *Limonium bicolor* (also known as the two-colored blood-tonifying herb) Limonium bicolor *Limonium bicolor* is a typical halophyte that secretes excessive salt ions through multicellular salt glands on its leaf surface. Cytokinins are believed to be involved in salt gland development. Previous single-cell transcriptome sequencing (scRNA-seq) analysis revealed the developmental trajectory of *Limonium bicolor* salt glands from the initiation stage to the differentiation stage. By comparing scRNA-seq data with conventional RNA-seq data after 6-BA application, five cell subpopulations associated with salt gland development were identified. Combining scRNA-seq and genome annotation data, it was found that cytokinin-related genes control salt gland development, and multiple candidate transcription factors may be involved in this process.

[0008] This invention focuses on YABBY transcription factors that are highly enriched in salt gland-associated cell populations and respond to cytokinin treatment. LbYAB1 (Lb2G09016), which is highly expressed in salt gland-associated cell clusters, was screened from seven LbYAB family genes, and its function was verified by overexpression and virus-induced gene silencing (VIGS) technology.

[0009] To achieve the objectives of this invention, in a first aspect, this invention provides the *Limonium bicolor* gene LbYAB1, which is a gene encoding either protein (a) or (b): (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2; or (b) A protein derived from (a) with the sequence shown in SEQ ID NO:2 substituted, deleted or added with one or more amino acids and having the same function.

[0010] The CDS sequence of gene LbYAB1 is as follows: i) The nucleotide sequence shown in SEQ ID NO:1; ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:1 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; iii) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS, followed by washing the membrane with the same solution; or, iv) Nucleotide sequences that have more than 90% homology with i), ii) or iii) and express the same functional protein.

[0011] The promoter sequence of the gene LbYAB1 is shown in SEQ ID NO:3.

[0012] Secondly, the present invention provides biological materials containing the gene LbYAB1, including but not limited to expression cassettes, transposons, plasmid vectors, viral vectors, or engineered bacteria.

[0013] Any of the following applications of the gene LbYAB1 or biological materials containing the gene LbYAB1: (1) Used to regulate the growth and development of salt glands and salt tolerance in halophytes; (2) Used to regulate the proline content in plants; (3) Used for the preparation of transgenic plants; (4) Used for plant variety improvement; Among them, the regulation described in (1) and (2) is negative regulation.

[0014] Preferably, the plant is *Limonium bicolor*.

[0015] Thirdly, the present invention provides a method for increasing the number of salt gland cells in *Limonium bicolor*, promoting salt gland development, improving salt tolerance and proline content, comprising using genetic engineering to weaken the *Limonium bicolor* gene LbYAB1, obtaining gene-weakened plants; the weakening includes knocking out, silencing or reducing gene expression.

[0016] The genetic engineering method is selected from one of the following: mutagenesis, site-directed mutagenesis, homologous recombination, and viral-induced gene silencing (VIGS), with VIGS technology being preferred.

[0017] In one specific embodiment of the present invention, the method for silencing the LbYAB1 gene of *Limonium bicolor* using VIGS technology includes: ligating a cloned fragment of the LbYAB1 gene (SEQ ID NO:4) to the multiple cloning site of a tobacco brittle virus vector to obtain a recombinant plasmid TRV2-LbYAB1, transforming it into *Agrobacterium* to obtain *Agrobacterium* containing the recombinant plasmid TRV2-LbYAB1, and using the *Agrobacterium* containing the recombinant plasmid TRV2-LbYAB1 to infect *Limonium bicolor* leaves.

[0018] Fourthly, the present invention provides any of the following applications of the transgenic plants obtained according to the method: i. Used in plant breeding; ii. Used for planting in saline-alkali land.

[0019] Furthermore, breeding methods can be selected from transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction, etc.

[0020] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention has discovered a novel function of LbYAB1. Firstly, through RNA in situ hybridization and promoter-driven GUS tissue staining, it was confirmed that LbYAB1 is expressed in salt glands and leaf primordia, and that its expression is induced by 6-benzylaminopurine (6-BA) treatment. Secondly, this invention updated the genetic transformation technology, obtaining lines that stably overexpress LbYAB1. By investigating the function of LbYAB1 in overexpressing and silenced lines, it was found that compared to the wild type, the development of salt glands in overexpressing lines was inhibited, salt secretion capacity was weakened, and salt tolerance was reduced; while the silenced lines exhibited the opposite phenotype. These results demonstrate that LbYAB1 is a negative regulator of salt gland development. Overexpression of this gene in *Limonium bicolor* and *Arabidopsis thaliana* both led to enhanced salt sensitivity. This invention not only lays the foundation for further research into the developmental mechanism of salt glands but also opens up new pathways for cultivating salt-tolerant crops. Attached Figure Description

[0021] Figure 1This image shows the expression levels of seven LbYAB genes in epidermal cells under control and 6-BA treatment conditions, as illustrated in a preferred embodiment of the present invention, using single-cell transcriptomics analysis. Deeper red indicates higher expression levels.

[0022] Figure 2 In a preferred embodiment of the present invention, Monocle3 was used to perform cell trajectory analysis on cell clusters associated with salt gland development.

[0023] Figure 3 The preferred embodiment of the present invention shows the positions of the seven LbYAB family members on the chromosome of *Limonium bicolor* (A) and the phylogenetic tree (B) constructed based on MEGA7 for the seven LbYABs and six Arabidopsis YABs.

[0024] Figure 4 The figures show the expression levels of various LbYABs at different developmental stages of *Limonium bicolor* based on RNA-seq data in a preferred embodiment of the present invention. A, undifferentiated stage; B, salt gland development stage; C, stomatal development stage; D, building block cell differentiation stage; E, mature stage. Red indicates higher expression.

[0025] Figure 5 This diagram illustrates the expression level of LbYAB1 in single-cell sequencing analysis in a preferred embodiment of the present invention. A: UMAP diagram of LbYAB1 expression in epidermal cell clusters of control and 6-BA-treated leaves. Darker red indicates higher expression levels. B: UMAP diagram of LbYAB1 expression after dividing epidermal cells into subpopulations. Arrows point to cell clusters associated with salt glands.

[0026] Figure 6 Bioinformatics analysis of LbYAB1 in a preferred embodiment of the present invention. A: DNA sequence of LbYAB1 and predicted amino acid sequence of its encoded protein. B: Schematic diagram showing the conserved YABBY domain in LbYAB1. C: Prediction of transmembrane domains of LbYAB1.

[0027] Figure 7 This invention provides a preferred embodiment for detecting the transcriptional activity of LbYAB1 in yeast cells. Yeast cells were transformed with pGBKT7, pGBKT7-VP16, pGBKT7-VP16-LbYAB1, or pGBKT7-LbYAB1, respectively. Positive transformants were screened on tryptophan-deficient SD medium, and transcriptional activity was detected on SD / -Trp / -His / -Ade +X-α-gal medium.

[0028] Figure 8This invention provides a preferred embodiment of the prediction of cis-acting elements in the LbYAB1 promoter and the change in LbYAB1 expression over time. A: Prediction of cis-acting elements in the LbYAB1 promoter. B: Change in LbYAB1 expression over time in *Limonium bicolor* under treatment with 6-BA, 2,4-D, GA3, SA, or NaCl. Plants were treated with 0.04 mg / L 6-BA, 0.1 mg / L 2,4-D, 0.02 mg / L GA3, 25 mg / L SA, or 200 mM NaCl, respectively. The expression level at 0 hours was set to 1. Data are the mean ± standard deviation of three replicates; different letters indicate significant differences at the P=0.05 level according to Duncan's multiple range test.

[0029] Figure 9 This image shows the GUS staining pattern (B) produced by the proLbYAB1:GUS reporter gene construct (A) in transgenic *Limonium bicolor* seedlings in a preferred embodiment of the present invention. Red arrows indicate LbYAB1 expression. Scale bar, 2 cm.

[0030] Figure 10 Phenotypic identification of *Limonium bicolor* plants overexpressing LbYAB1 in a preferred embodiment of the present invention. A: RT-qPCR analysis of LbYAB1 transcription levels in non-transgenic *Limonium bicolor* and 35S:LbYAB1 transgenic lines. B: Representative photographs of leaf salt gland density and morphology in transgenic LbYAB1-OE and WT plants. Images were taken under UV light. Scale bar, 100 μm. C: Quantification of salt gland density in regenerated shoots of LbYAB1-OE and WT lines. D: Representative photographs of leaf discs showing salt secretion capacity of WT and LbYAB1-OE lines using the leaf disc method. E: Quantification of salt secretion from leaf discs of WT and LbYAB1-OE lines. F: Na+ secretion rate of WT and LbYAB1-OE lines. G: Representative photographs of LbYAB1-OE and WT plants before and after treatment with 200 mM NaCl for 14 days. H: Total leaf area of ​​WT and LbYAB1-OE plants before and after NaCl treatment, as shown in the figure. I–M: NaCl concentration of WT and LbYAB1-OE lines after 200 mM NaCl treatment. + K + Malondialdehyde (MDA) and proline content. O: Visual assessment of leaf disc oxidative damage by DAB and NBT staining. N: Densitometry analysis of DAB and NBT staining measured using ImageJ. Data in A, C, E, F, H–L, and O represent mean ± standard deviation, and different letters indicate significant differences at the P=0.05 level according to Duncan's multiple range test.

[0031] Figure 11Phenotypic analysis of *Limonium bicolor* leaves with LbYAB1 silenced in a preferred embodiment of the present invention. A: Relative expression levels of LbYAB1 in pTRV::0 and pTRV::LbYAB1 plants determined by RT-qPCR. B: Representative photographs of salt gland density and morphology in the leaves of *Limonium bicolor* plants of pTRV::0 and pTRV::LbYAB1. pTRV::LbYAB1#7 is used as a representative VIGS plant. Images were taken under UV light. Scale bar, 100 μm. C: Total number of salt glands per leaf disc in pTRV::0, pTRV::LbYAB1#1, TRV::LbYAB1#6, and pTRV::LbYAB1#7 plants. D: Representative photographs of leaf discs showing the salt secretion capacity of WT and VIGS plants using the leaf disc method. E: Quantification of salt secretion in leaf discs of WT and VIGS plants. F: Na+ in WT and VIGS plants. + Secretion rate. G: Representative photographs of *Limonium bicolor* plants of pTRV::0 or pTRV::LbYAB1 before and after 14 days of irrigation with 200 mM NaCl. pTRV::LbYAB1#7 is used as a representative. H: Total leaf area of ​​WT and pTRV::LbYAB1 plants shown in the figure before and after NaCl treatment. I–L: NaCl levels of pTRV::0 and pTRV::LbYAB1 plants after treatment with 200 mM NaCl. + K + M: Visual assessment of oxidative damage by DAB and NBT staining. N: Analysis of DAB and NBT staining density using ImageJ. O: Relative expression levels of salt-conjugating LbCKX1, LbCKX3, and LbCKX5 in WT, LbYAB1-OE, pTRV::0, and VIGS plants. Red indicates highly enriched gene expression. P: Content of five cytokinins in WT, LbYAB1-OE, pTRV::0, and VIGS plants. Red indicates high concentration. Data in A, C, E, F, H–L, and N represent mean ± standard deviation, and different letters indicate significant differences at the P=0.05 level according to Duncan's multiple range test.

[0032] Figure 12This invention provides a preferred embodiment of the protein sequence alignment of LbYAB1 and AtYAB1, and the identification of LbYAB1 overexpression lines. (A) Protein sequence alignment of LbYAB1 and AtYAB1. (B) Screening of Arabidopsis seedlings carrying the 35S:LbYAB1-GUS transgene (herbicide resistance screening). (C) Detection of the 35S:LbYAB1-GUS transgene in transgenic Arabidopsis lines. (D) Relative expression level of LbYAB1 in Arabidopsis lines heterologously overexpressing LbYAB1. Data are the mean ± standard deviation of three replicates; different letters indicate significant differences at the P=0.05 level according to Duncan's multiple range test.

[0033] Figure 13 This is a preferred embodiment of the phenotype of Arabidopsis thaliana plants heterologously expressing LbYAB1. A: Representative photographs of Arabidopsis thaliana seeds from the WT and LbYAB1-OE lines germinating under different concentrations of NaCl. B: Germination rate of WT and transgenic Arabidopsis thaliana lines as a function of NaCl concentration. C: Root length of WT and transgenic Arabidopsis thaliana lines after 7 days of growth under specified NaCl treatment.

[0034] Figure 14 In a preferred embodiment of the present invention, the growth of transgenic Arabidopsis seedlings germinated for 4 days under control conditions was observed under various salt stress conditions. (A) Representative growth photographs of Arabidopsis seeds from the WT and LbYAB1-OE lines under 100 mM NaCl treatment. (B) Root lengths of WT and transgenic Arabidopsis lines after 4 days of growth under specified NaCl treatment. (C) The reduction rate of root length under 100 mM NaCl treatment relative to the control. Data represent the mean ± standard deviation of three replicates. Different letters indicate significant differences at the P=0.05 level according to Duncan's multiple range test.

[0035] Figure 15 Physiological parameters of Arabidopsis thaliana plants heterologously expressing LbYAB1 after salt irrigation were measured in a preferred embodiment of the present invention. A: Representative photographs of WT and transgenic Arabidopsis thaliana lines grown in soil or irrigated with 100 mM NaCl for 2 weeks. B–D: Fresh weight, dry weight, and total leaf area of ​​the whole WT and transgenic Arabidopsis thaliana plants shown in the figures. E–H: Na content in the whole WT and transgenic Arabidopsis thaliana plants shown in the figures. + K + MDA and proline content. I–L: Relative expression levels of salt stress-related marker genes as determined by RT-qPCR. Data represent the mean ± standard deviation of three replicates. Different letters indicate significant differences at the P=0.05 level according to Duncan's multiple range test. Detailed Implementation

[0036] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0037] Example 1: The LbYAB1 gene of *Limonium bicolor* and its function Salt-secreting plant, Hematoxylin and cylindrica (two-colored blood-tonifying herb) Limonium bicolor Salt glands on the leaf surface have the function of secreting salts and can grow in high-salt soils. YABBY (YAB) family transcription factors are involved in plant development and stress response. Single-cell transcriptome data showed that LbYAB1 (Lb2G09016) was highly expressed in cell populations related to salt gland development, and it is preliminarily speculated that it has the function of regulating salt glands.

[0038] Salt glands are typical complex epidermal structures whose development requires precise temporal and tertiary control. Based on preliminary gene function analysis of constitutive promoter-driven overexpression lines and the VIGS line, the role of LbYAB1 in salt gland development and salt tolerance has been preliminarily revealed. Given that LbYAB1 is also highly expressed in both meristematic and vascular tissues, it is believed that this gene may regulate salt gland development in the early stages.

[0039] I. Experimental Methods 1. Cultivation of plant materials Two-colored blood-tonifying herb ( Limonium bicolor Seeds were collected from the saline-alkali land of the Yellow River Delta (Dongying City, Shandong Province, China). Before sowing, seeds were surface-sterilized with 75% (v / v) ethanol and 6% (w / v) sodium hypochlorite solution, rinsed with sterile water, and then inoculated onto MS solid medium (PhytoTechnology Laboratories, M519) containing 30 g / L sucrose and 9 g / L agar, and cultured in a plant growth chamber. The wild type of Arabidopsis thaliana was Columbia-0 (Col-0) ecotype. Seeds were surface-sterilized with 75% (v / v) ethanol and sown on 1 / 2 MS solid medium, vernalized for 2 days in the dark at 4℃, and then vertically cultured in a plant growth chamber. After 7 days, seedlings were transplanted to nutrient soil for further cultivation. Cultivation conditions: 16-hour photoperiod / 8-hour dark, light intensity 600 μmol / m² / s, temperature 25 / 22℃ (day / night), relative humidity 70%. Salt tolerance was tested using three-week-old soil-cultured Col-0 and transgenic Arabidopsis seedlings, which were irrigated with 100 mM NaCl solution every other day for two weeks.

[0040] 2. Identification of the LbYAB gene family Based on the presence of the conserved YABBY domain in the encoded protein, a total of 7 domains were identified. LbYABFamily genes. Specific method: Using the YABBY protein sequence of *Limonium bicolor* as the query sequence, alignment was performed using NCBI BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). All gene sequences were evaluated using published RNA-seq data on leaf development, petiole development, and scRNA-seq data covering the entire process of salt gland development. LbYAB Gene expression levels.

[0041] 3. Bioinformatics analysis of LbYAB1 Based on known LbYAB1 The gene sequence was used as the query sequence and BLAST was performed on NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Protein physical parameters were predicted using Protparam (https: / / web.expasy.org / protparam / ); conserved domains were analyzed using the SMART online tool (http: / / smart.embl-heidelberg.de / ); a phylogenetic tree was constructed using MEGA 7.0 software for homology analysis; and the LbYAB1 promoter cis-regulatory elements were analyzed using the PlantCARE online tool (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ).

[0042] 4. Analysis of LbYAB1 expression pattern Wild-type and different Limonium bicolor line seedlings were cultured on MS basal medium or in medium supplemented with 300 mM NaCl (Sigma, SRSG-S9888), 0.04 mg / L 6-BA (Coolaber, CB2611), 0.1 mg / L 2,4-D (Coolaber, CC3511), 0.02 mg / L GA3 (Yuanye Biotechnology, S18001), or 25 mg / L SA (SCRSTANDARD, SCCT-801386), and samples were collected within 72 hours. LbTUBULIN was used as an internal control gene (Table 1), and the relative expression level of LbYAB1 was detected by RT-qPCR. qPCR primers were designed using Beacon Designer software (Table 1). The reaction system was prepared according to the ChamQ™ UniversalSYBR qPCR Master Mix kit (Vazyme).

[0043] 5. Verification of transcriptional activation activity Gene-specific primers (Table 1) were designed to clone the full-length coding sequence of LbYAB1 into the pGBKT7 and pGBKT7-VP16 vectors (purchased from Coolaber Technology Co., Ltd.). Empty vectors pGBKT7, pGBKT7-VP16, pGBKT7-VP16-LBYAB1, or pGBKT7-LBYAB1 were transformed into Y2HGold yeast cells. Positive single clones were selected from transformants on SD / −Trp medium. After liquid culture, the OD600 was adjusted to 0.2 and serially diluted, then spotted onto SD / −Trp medium and SD / −Trp / −His / −Ade medium containing X-α-gal.

[0044] Table 1 List of primers used Primer name Sequence (5'-3') AIM LbYAB1 Probe AGUCCAAAAUGAAUGUGUGGGAAGUGUGCC hybridization RT-LbYAB1-S CTCCCATTCCAGTTTCTT qPCR RT-LbYAB1-A AAGTTATTATTGCCGTTG qPCR LbTubuli-S GGTTGAGTGAGCAGTTCAC internal control of qPCR LbTubuli-A GATAACCAGCCACACCTTAGC internal control of qPCR AtACTIN real-time Sense GGTAACATTGTGCTCAGTGGTGG internal control of qPCR AtACTIN real-time Antisense AACGACCTTAATCTTCATGCTGC internal control of qPCR 1300-S GAGAGAACACGGGGGACGAGCTCG pCambia1300 general purpose primer 1300-A TGGTGCAGATGAACTTCAGGGT pCambia1300 general purpose primer LbYAB1-S TCCTTCGCAAGACCCTTCCTCTA Identification of PCR LbYAB1-A ACTTCCAACTCCGCCTGCCATAT Identification of PCR LbYAB1-1300-S cggggatcctctagagtcgacATGGTGACGGTTCGGTGCG Sequencing and colony PCR of constructed pCAMBIA1300 vectors LbYAB1-1300-A gcccttgctcaccatgtcgacGTAGGGTAAGACGCCGACATTT Sequencing and colony PCR of constructed pCAMBIA1300 vectors BD-LbYAB1-S tcagaggaggacctgcatatg ATGGTGACGGTTCGGTGCG Sequencing and colony PCR of constructed pGBKT7 vectors BD-LbYAB1-A ttcggcctccatggccatatg TCAGTAGGGTAAGACGCCGACA Sequencing and colony PCR of constructed pGBKT7 vectors LbYAB1 promoter S TCAAGCCCTCGTGATGAAGCG The PCR of the LbYAB1 promoter LbYAB1 promoter A CTTGAATAAGCTTGCACTTGG The PCR of the LbYAB1 promoter LbYAB1 promoter-3301S gacctgcaggcatgcaagctt TCAAGCCCTCGTGATGAAGC Sequencing and colony PCR of constructed pCAMBIA3301 vectors LbYAB1 promoter-3301A ttaccctcagatctaccatgg CTTGAATAAGCTTGCACTTGGAAC Sequencing and colony PCR of constructed pCAMBIA3301 vectors 3301S TCGGTACCCGGGGATCCTC pCAMBIA3301 of the forward primer for identifying LbYAB1pA GCATAAAGCCATATTATTAG The reverse primer for identifying RT-YAB-S CACCATCACTTATAACCACTTCTC qPCR RT-YAB-A ACTCCGCCTGCCATATTG qPCR RT-CKX1-S GCCATACATTACAACAACTC qPCR RT-CKX1-A TGAATCTTAGCCGTCTGA qPCR RT-CKX3-S CGCCATCTACTACGACTA qPCR RT-CKX3-A CCTTCAACAATCACCTCAA qPCR At SOS1-RT-S ATTTTGATGCAGTCAGTGGATG qPCR At SOS1-RT-A GCAAGCAGATTCTAGTCTTTCG qPCR At SOS2-RT-S GCGAACTCAATGGGTTTTAAGT qPCR At SOS2-RT-A CTTACGTCTACCATGAAAAGCG qPCR At SOS3-RT-S CCGGTCCATGAAAAAGTCAAAT qPCR At SOS3-RT-A CTCTTTCAATTCTTCTCGCTCG qPCR At P5CS1-RT-S AGCTTGATGACGTTATCGATCT qPCR At P5CS1-RT-A AGATTCCATCAGCATGACCTAG qPCR LbYAB1-TRV-S gtgagtaaggttaccgaattcATGGTGACGGTTCGGTGCG Sequencing and colony PCR of constructed pTRV2 vectors LbYAB1-TRV-A gagacgcgtgagctcggtaccGATCTGATGAGAAGTGGTTATAAGTGATG Sequencing and colony PCR of constructed pTRV2 vectors 6. Instant transformation of the two-colored blood-replenishing herb. The LbYAB1 promoter was cloned using wild-type *Limonium bicolor* as a template, replacing the 35S promoter in the pCAMBIA3301-35S-GUS vector. The construct was transformed into *Agrobacterium* strain EHA105. Root and leaf tissues of 1-2 month old aseptically cultured *Limonium bicolor* were immersed in *Agrobacterium* suspension (MS liquid medium) for 20 minutes. After aspirating the surface liquid, the tissues were transferred to MS solid medium containing 0.05 mg / L 6-BA, 10 g / L glucose, and 2 μL / mL AS. Culture conditions included: photoperiod 16 / 8 hours, light intensity 0 μmol / m² / s, temperature 25 / 22℃, humidity 70%. After 3 days, the materials were stained in GUS solution at 25-37℃ for 12 hours, destained with anhydrous ethanol until chlorophyll was completely removed, and observed under a dissecting microscope (Nikon, Japan).

[0045] 7. Two-color blood-tonifying herb Cut-Dip-Budding (CDB) conversion Take leaves (with intact petioles) and roots from 1-2 month old plants. Root treatment uses two methods: 1) Immersion in Agrobacterium rhizogenes (… Agrobacterium rhizogenes strain K599 1) Incubate bacterial suspension (12-16 hours, OD600>1.0) for 30 minutes; 2) Apply Agrobacterium-containing cultured on plates directly to the cut surfaces of roots or petioles to ensure bacterial adhesion. The treated explants are co-cultured on moist vermiculite, with roots laid flat and petioles inserted vertically (2-3 cm deep), covered with plastic film to maintain high humidity. Regenerated shoots are screened by PCR and confirmed to have transgenic integration by Sanger sequencing before being transplanted into soil for acclimatization into stable transgenic plants.

[0046] 8. Virus-induced gene silencing (VIGS) of LbYAB1 in *Limonium bicolor* A specific fragment of the LbYAB1 coding sequence from 1 to 300 bp (SEQ ID NO:4) was ligated into the pTRV-RNA2 expression vector. The construct was transformed into Agrobacterium GV3101 competent cells. Leaves of *Limonium bicolor* were infiltrated with a mixture of *Agrobacterium* bacterial suspensions containing pTRV-RNA1 and pTRV-RNA2 (purchased from Shanghai Zeye Biotechnology Co., Ltd.) and cultured in the dark for 2 days. Phenotypic characteristics were observed when the next true leaf was fully mature.

[0047] 9. Phenotypic observation and physiological analysis of leaves of pTRV::0 and pTRV::LbYAB1 plants Leaf discs with a diameter of 10 mm were obtained from VIGS silent lines and control plants using a perforator. After rinsing the leaf disc surface with distilled water, the number of salt glands (N) in each leaf disc was calculated using a differential interference microscope. The formula for calculating the number of salt glands is: salt gland density (glands / cm²) × leaf area (cm²). After the leaf discs were blotted dry with filter paper, they were placed in a petri dish (back side up) containing 30 mL of 200 mM NaCl (pH 6.0), covered with mineral oil, and incubated at 20°C for 24 hours. The secreted droplets formed on the back of the leaf discs were collected using a micropipette. The volume (V) of the secreted droplets in each leaf disc was measured, and the Na content in the liquid was detected using a Dionex ICS-1100 ion chromatography system (Dionex Corp, USA). + Concentration (C). Na from a single salt gland + The secretion rate (pmol / gland / hour) was calculated using the formula: V × C / (N × time). The experiment was performed in triplicate. ROS accumulation in all leaf discs was assessed using nitroblue tetrazolium (NBT) and 3,3-diaminobenzidine (DAB) staining.

[0048] Previous studies have found that 100 mM NaCl significantly promotes the growth of *Limonium bicolor*, while 200 mM NaCl treatment does not significantly inhibit biomass compared to the control. Therefore, this invention uses 200 mM NaCl treatment to evaluate the growth effects of overexpressed (OE) and silenced lines. OE, VIGS, and control plants with similar growth were selected and irrigated with 200 mM NaCl solution for two weeks. The malondialdehyde (MDA) content in seedlings was determined using the thiobarbituric acid (TBA) method; the proline content was determined using the ninhydrin colorimetric method (quantified by absorbance); electrolyte leakage rate was measured using a conductivity meter (DSD-307A, Leici, Shanghai); and cytokinin content (calculated using standards) was determined by HPLC-MS (QTRAP 5500, ABSCIEX, USA). All indicators were measured in triplicate.

[0049] 10. Arabidopsis heterologous expression The pCAMBIA1300-35S::LbYAB1-GFP vector was constructed using the ClonExpress II one-step cloning kit (Vazyme). Agrobacterium GV3101 containing the construct was transformed into Arabidopsis thaliana via inflorescence immersion. T0 generation seeds were collected and sown on 1 / 2 MS medium containing hygromycin (50 mg / L). The relative expression level of LbYAB1 was detected by RT-qPCR, and high-expressing plants were screened and propagated to the third generation to obtain homozygous lines (T3). Three lines with different expression levels were selected for further experiments.

[0050] 11. Measurement of physiological indicators Germination rate (GR) = (Number of normally germinated seeds after 24 hours of culture / Total number of seeds tested) × 100%. Root length was the length of the taproot of seedlings after 5 days of culture, measured using ImageJ software. Plant ion content was determined using a flame photometer JC-YZ-600 (Juchuang Group, Qingdao). MDA and proline content were determined according to previous reports.

[0051] 12. Statistical Analysis Statistical analysis was performed using Excel 2010, and plotting was done using SigmaPlot 14.0 and Graphpad Prism 10.1.2. The standard deviation (SD) was calculated for each experiment with three replicates. ANOVA was performed first to analyze the significance of differences, followed by Duncan's test. In Duncan's multiple range test, different letters indicated a significant difference at the p = 0.05 level.

[0052] II. Experimental Results 1. LbYAB1 is highly enriched in salt gland cell populations and is induced by treatment with 6-BA and NaCl. Previous single-cell transcriptome (scRNA-seq) data showed that the LbYAB gene is involved in epidermal-associated cell populations (... Figure 1 ) and salt gland-associated cell population ( Figure 2 High expression in ) Through genomic analysis, 7 LbYAB family genes were located on 8 chromosomes of *Limonium bicolor*. Figure 3 A). Phylogenetic analysis showed that the protein encoded by Lb2G09016 had the highest homology with AtYAB1 ( Figure 3 B). Therefore, Lb2G09016 was named LbYAB1. Expression profiling based on RNA-seq and scRNA-seq showed that LbYAB1 was the most highly expressed member of the family during the early stages of salt gland development. Figure 4 scRNA-seq data further showed that LbYAB1 was most enriched in the epidermal-associated cell population after 6-BA treatment. Figure 5 A), and is highly expressed in salt gland development-related cell clusters (A),Figure 5 B). Pseudo-temporal analysis of salt gland developmental cell clusters using Monocle3 showed that LbYAB1 may be highly expressed in the early stages of salt gland development. Figure 2 Therefore, it is speculated that LbYAB1 may be involved in the development of salt glands.

[0053] According to the published genome of *Limonium dichromatum*, the full-length mRNA of LbYAB1 (726 bp open reading frame) encodes 242 amino acids. Figure 6 A). The predicted protein's N-terminus contains a typical low-complexity YABBY domain ( Figure 6 B), without transmembrane structure ( Figure 6 C), which conforms to the characteristics of a transcription factor. To verify its transcriptional activity, we expressed LbYAB1 itself and its fusion protein with the strong transcriptional activator VP16 of herpes simplex virus (HSV) through yeast transcriptional activity assays. Figure 7 All strains grew normally in SD / -Trp medium, but only the Y2HGold strain expressing VP16 and VP16-LbYAB1 could grow in SD / -Ade / -His / -Trp medium. Yeast strains expressing LbYAB1 could not grow in this deficient medium, indicating that LbYAB1 lacks transcriptional activation activity. Notably, strains expressing VP16-LbYAB1 grew weaker than strains expressing VP16 alone, suggesting that LbYAB1 may inhibit the transcriptional activation activity of VP16, thus possessing transcriptional repression function.

[0054] Promoter analysis showed that LbYAB1 contains cis-acting elements related to plant hormones and abiotic stress ( Figure 8 A). RT-qPCR analysis revealed that, after 72 hours of treatment with 200 mM NaCl, 0.04 mg / L 6-BA, 0.1 mg / L 2,4-D, 0.02 mg / L GA3, and 25 mg / L SA, LbYAB1 showed the most rapid response to 6-BA (significant increase in expression from 6 to 12 hours), while the response to other hormones was slower, with only a slight upregulation during NaCl treatment. Figure 8 B).

[0055] 2. LbYAB1 is specifically expressed in the salt glands of the petiole of *Limonium bicolor*. Given that the LbYAB1 promoter contains multiple cis-elements related to early leaf development ( Figure 8 A), we constructed the proLbYAB1:GUS vector and transformed *Limonium bicolor* (A). Figure 9 A). Histochemical staining showed that GUS activity was concentrated in the petiole region ( Figure 9 B), and specific GUS signals were observed in the petiole salt glands (B), Figure 9(C and D).

[0056] RNA in situ hybridization and chemical histological staining experiments jointly confirmed that LbYAB1 is specifically expressed in petiole salt glands and highly expressed in the apical meristem. These results suggest that LbYAB1 may be involved in the early differentiation of leaves and the development of salt glands in *Limonium bicolor*.

[0057] 3. Overexpression of LbYAB1 can inhibit salt gland development and reduce salt tolerance. To investigate the function of LbYAB1 in *Limonium bicolor*, we constructed overexpression lines using the Cut-Dip-Budding (CDB) method. By quantitatively detecting the LbYAB1 expression level in transgenic plants, we screened out two high-expression lines, OE1 and OE2. Figure 10 A), and to evaluate its salt gland development and salt secretion characteristics. The autofluorescence properties of the salt glands under ultraviolet light (330-380 nm) were utilized ( Figure 10 B), statistical analysis revealed that the number of salt glands in both overexpression lines was significantly less than that in the wild type ( Figure 10 C).

[0058] To verify whether changes in the number of salt glands affect salt secretion capacity, we floated leaf discs of the control and overexpression lines in 200 mM NaCl for salt secretion analysis. After 24 hours, the number of salt glands secreted by the two overexpression lines (…) Figure 10 D) and salt secretion ( Figure 10 E) were significantly lower than the wild type, although Na + There was no significant difference in secretion rate. Figure 10 F). Two weeks after irrigating with 200 mM NaCl ( Figure 10 G) Salt tolerance was assessed. To eliminate the effect of developmental delay, the leaf area growth rate before and after NaCl treatment was calculated. The results showed that the leaf area growth rate of the overexpression line was significantly lower than that of the wild type. Figure 10 H). After treatment, the Na content in the leaves of the overexpressing strains increased. + The content was significantly higher than that of the wild type ( Figure 10 I), and K + The content showed the opposite trend, with the change being particularly significant in the high-expression line LbYAB1-OE2. Figure 10 J). The electrolyte leakage rate of the overexpression line under salt treatment was significantly higher than that of the wild type ( Figure 10 K) indicates that it is suffering from more severe ion stress.

[0059] Malondialdehyde (MDA) is an indicator of the degree of oxidative damage, while proline can alleviate osmotic stress caused by NaCl. Compared with the wild type, the LbYAB1-OE2 line accumulated more MDA in its leaves. Figure 10 L) and less proline ( Figure 10M). ROS accumulation was detected by staining with 3,3-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT). Figure 10 (N), it was found that the LbYAB1-OE2 strain produced slightly more H2O2 and O. 2− ( Figure 10 The results indicate that LbYAB1 overexpression weakens antioxidant capacity under salt stress. These results collectively demonstrate that LbYAB1 overexpression can inhibit salt secretion function and increase Na+ in *Limonium bicolor* seedlings. + The content and salt sensitivity further confirmed that salt secretion capacity and salt tolerance are closely related to salt gland development.

[0060] 4. Silencing the LbYAB1 gene can enhance salt gland development and salt tolerance. To further investigate the function of LbYAB1, a mature virus-induced gene silencing (VIGS) technology system, already established in *Limonium bicolor*, was used. Analysis was performed using RT-qPCR. Figure 11 A) Three silencing lines with the lowest LbYAB1 transcription levels (TRV:LbYAB1#1, #6, and #7) were selected. These lines exhibited similar phenotypes. Figure 11 B), the number of salt glands in the B group was higher than that in the empty vector control group TRV:0 ( Figure 11 C). Among them, the TRV:LbYAB1#7 strain had the lowest LbYAB1 expression level and the highest number of salt glands, indicating that LbYAB1 may regulate salt gland development in a dose-dependent manner. This phenomenon also exists in LbYAB1 overexpression lines.

[0061] We assessed the salt secretion capacity and salt tolerance of all VIGS plants and the TRV:0 control group. Compared with TRV:0, the LbYAB1 silent lines had larger salt-secreting vacuoles ( Figure 11 D), but Na + The secretion rate was not affected by gene silencing. Figure 11 E and F). In terms of salt gland development, TRV:LbYAB1#7 had the highest salt secretion among all VIGS lines ( Figure 11 E). To assess the effect of LbYAB1 silencing on salt tolerance, we irrigated the plants with 200 mM NaCl for two weeks ( Figure 11 G). After NaCl treatment, the leaf area growth rate of the silent lines was significantly higher than that of the TRV:0 control group ( Figure 11 H). By detecting Na + K + Salt tolerance physiological indicators such as malondialdehyde (MDA) and proline content ( Figure 11 (IL) It was found that all VIGS lines accumulated less Na during salt treatment than the TRV:0 control group. + ( Figure 11I) and more K + ( Figure 11 J), while generating fewer MDAs (J), Figure 11 K) and more proline ( Figure 11 These results indicate that knocking down LbYAB1 transcription levels effectively alleviates ion and osmotic stress induced by NaCl treatment. Oxidative damage caused by ROS accumulation was detected by NBT and DAB staining, and the staining intensity of the VIGS line was lower than that of the control group (L). Figure 11 The lower levels of ROS (M and N) in the leaves indicate lower ROS accumulation and less oxidative damage. The enhanced salt tolerance of the silenced LbYAB1 line may stem from its higher salt gland density and salt secretion capacity, further confirming the negative regulatory role of LbYAB1 in salt gland development and salt tolerance.

[0062] LbYAB1 expression can be rapidly induced by 6-BA and is enriched in salt gland cell populations after 6-BA treatment. Figure 11 This suggests that LbYAB1 may be a key link in the regulation of salt gland development by cytokinins. Furthermore, we examined the transcriptional levels of the cytokinin degradation genes CYTOKININ OXIDASE 1 (LbCKX1, LbCKX3, and LbCKX5) in the LbYAB1 overexpression and silenced lines constructed in this invention. All tested LbCKX genes were upregulated in the overexpression lines and downregulated in the silenced lines. That is, in the absence of cytokinin treatment, LbYAB1 regulates salt gland development by positively regulating the cytokinin degradation pathway. To verify this hypothesis, we measured the cytokinin content of different lines. The results were as expected: the VIGS line accumulated more tZR-type cytokinin than the control group, while the overexpression lines accumulated less IP, IPR, cZ, tZR, and DHZ-type cytokinins than the wild type. Based on the salt gland development phenotypes of overexpressed and silenced lines, we believe that LbYAB1 may affect the development of salt glands in Limonium bicolor by regulating cytokinin metabolism pathways.

[0063] 5. LbYAB1 enhances salt sensitivity during Arabidopsis thaliana germination and seedling stages. Although LbYAB1 significantly inhibits salt gland development and enhances salt stress sensitivity in *Arabidopsis thaliana*, we still wanted to explore the potential effects of heterologous expression of this gene in the non-halophyte *Arabidopsis thaliana*. LbYAB1 shares only 37.0% overall sequence identity with its closest *Arabidopsis thaliana* homolog, but exhibits high sequence identity in the YABBY domain region. Figure 5 A).

[0064] To investigate whether heterologous expression of LbYAB1 affects salt tolerance in Arabidopsis thaliana, we introduced the 35S:LbYAB1 transgene into a Col-0 background (… Figure 12B). PCR verification confirmed the presence of the transgene ( Figure 12 After detecting expression levels using C) and RT-qPCR, three lines with low (T1), medium (T2), and high (T3) expression levels were selected for phenotypic and physiological index analysis. Figure 12 D).

[0065] Five days after sowing Col-0 and transgenic lines in 1 / 2 MS medium (containing 0, 50, 100, and 150 mM NaCl), all transgenic lines were more sensitive than the wild type. Figure 12 A), specifically manifested as delayed germination ( Figure 13 B) and root length shortening ( Figure 13 C). Transplanting seedlings germinating from the control group to a 100 mM NaCl environment further verified the salt sensitivity of the transgenic lines: similar inhibitory effects were observed in all lines, and the root length reduction rate was higher than that of the wild type. Figure 13 ).

[0066] The same treatment method as for *Limonium bicolor* was used, and Arabidopsis thaliana seedlings were irrigated with 100 mM NaCl for two weeks. Figure 14 A). After salt treatment, the fresh weight / dry weight of the transgenic lines ( Figure 15 (B and C) and leaf area ( Figure 15 D) All were below Col-0. Na+ levels in all transgenic lines under salt stress + The content is higher than that of wild type, K + The content is lower than that of wild type ( Figure 15 (E and F), but only the T3 line reached statistical significance. Figure 15 (I) indicates that LbYAB1 expression exacerbates ROS damage. Meanwhile, the proline content in the transgenic lines is lower than that in Col-0 ( Figure 15 G), which may exacerbate its osmotic stress. The expression levels of salt stress response marker genes SALT OVERLY SENSITIVE 1 (AtSOS1), AtSOS2, AtSOS3, and DELTA1-PYRROLINE-5-CARBOXYLATE SYNTHASE 1 (AtP5CS1) were examined. Figure 15 (KL), found that these genes were generally downregulated in transgenic lines after NaCl treatment. It is noteworthy that during seed germination and seedling stages ( Figure 15 Salt tolerance indices of *Limonium bicolor* (BH) all showed a dose-dependent effect of LbYAB1, which is consistent with our findings in LbYAB1 overexpressing lines of *Limonium bicolor* (BH). Figure 15 ) and silent strains ( Figure 10 The observations are consistent with those in ).

[0067] This invention aims to reveal the developmental program and regulatory mechanism of salt glands in Limonium bicolor. The identified LbYAB1 gene is highly expressed in the apical meristem and salt glands, and experiments have shown that this gene negatively regulates salt gland development and salt tolerance.

[0068] (1) LbYAB1 is a key family member that responds to salt gland development and cytokinin. Cytokinin treatment significantly promotes salt gland development. With the release of the *Limonium bicolor* genome sequence and annotation, as well as the scRNA-seq dataset covering all developmental stages of the salt gland, many candidate genes potentially involved in salt gland development continue to emerge. The YAB family, containing DNA-binding domains, is a plant-specific family of transcription factors involved in the regulation of plant growth and abaxial leaf characteristics.

[0069] Among the seven LbYAB family genes, scRNA-seq data showed that LbYAB1 was expressed most highly in the salt gland cell population. Figure 11 ), and its expression is strongly induced by cytokinins ( Figure 5 B). This expression pattern is consistent with our previous reports on 6-BA promoting salt gland development. The study found that the expression of the gene encoding the cytokinin-degrading enzyme was upregulated in LbYAB1 overexpression lines, while it was downregulated in silenced lines. Figure 8 O), indicating that LbYAB1 may regulate cytokinin levels ( Figure 11 LbYAB1 controls salt gland development through a feedback regulatory loop with cytokinins. Studies have shown that YAB1-related proteins in rice may also participate in the feedback regulation of GA biosynthesis. Previous research has shown that exogenous treatment with various plant hormones can affect salt gland development; we hypothesize that other plant hormones may also regulate salt gland development through LbYAB1, providing an important direction for LbYAB1 function research.

[0070] (2) Conservatism and uniqueness of LbYAB1 Cross-species conservation of gene function can be reflected in similar expression patterns. RNA in situ hybridization and LbYAB1 promoter-driven GUS histochemical staining showed that LbYAB1 is specifically expressed in the shoot apical meristem and young leaf petioles of *Limonium bicolor*. Figure 11 B). The role of YAB family members in the evolution of vascular plants; this invention provides important evidence for explaining cross-species conservation.

[0071] Recent studies have shown that most YABs are involved in drought and cold tolerance, such as those in rice and lotus. Regarding salt response, *Platycodon grandiflorus* (*Platycodon spp.*)... Figure 9The expression of the YAB gene family in *Limonium bicolor* is downregulated. Given that salt glands are unique organs for salt tolerance in halophilic plants, previous studies have not shown YABs' involvement in salt gland development. In *Limonium bicolor*, YAB1 exhibits specificity in salt gland development and salt tolerance, which differs from previous reports of YABs in other species. This invention demonstrates, through overexpression and gene silencing, that LbYAB1 negatively regulates salt gland development, salt secretion, and salt tolerance in *Limonium bicolor*. Platycodon grandiflorus and Figure 10 Figure 11 Overexpression strains show reduced salt gland number and decreased salt secretion, leading to decreased Na+. + Increased accumulation of proline exacerbates ion stress; simultaneously, lower proline content compared to the wild type intensifies osmotic stress symptoms; increased ROS production exacerbates oxidative stress. Conversely, LbYAB1-silenced plants exhibit enhanced salt tolerance. Salt secretion capacity and salt tolerance are determined by salt gland development, and these results indicate that LbYAB1 negatively regulates salt gland development and salt tolerance.

[0072] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A Limonium bicolor gene LbYAB1, characterized in that, It is a gene encoding a protein (a) or (b) as follows: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; or (b) a protein derived from (a) with one or several amino acids substituted, deleted or added in the sequence shown in SEQ ID NO: 2 and having equivalent function.

2. A biological material containing the gene of claim 1, wherein the biological material is an expression cassette, a transposon, a plasmid vector, a viral vector or an engineered bacterium.

3. Any of the following applications of the gene of claim 1 or the biological material of claim 2: (1) for regulating the growth and development of salt glands and salt tolerance of halophytes secreting salt; (2) for regulating the proline content of plants; (3) for preparing transgenic plants; (4) for plant variety improvement; The regulation in (1) and (2) is negative regulation. The plant is Limonium bicolor. wherein The gene LbYAB1 of Limonium bicolor is weakened by genetic engineering means, and a gene-weakened plant is obtained; the weakening includes knocking out, silencing or reducing the expression of the gene; the gene LbYAB1 of Limonium bicolor is the same as that in claim 1.

4. Use according to claim 3, characterized in that, The genetic engineering means is selected from one of mutagenesis, site-directed mutagenesis, homologous recombination and virus-induced gene silencing.

5. A method for increasing the number of salt gland cells, promoting the development of salt glands, increasing salt tolerance and proline content in Limonium bicolor salt gland cells, characterized by, 7. Any of the following applications of the transgenic plant obtained by the method of claim 5 or 6:

6. The method of claim 5, wherein, i. for plant breeding; ii. for planting in saline-alkali land. The breeding method is selected from transgenesis, crossing, backcrossing, selfing or vegetative propagation. ​ ​ 8. Use according to claim 7, characterized in that, ​