Salmonella lateral flow chromatography biosensor

The side-flow chromatography biosensor co-constructed by targeting antibacterial aptamers and nucleic acid nanozymes solves the problem of poor on-site detection performance in Salmonella detection, realizing rapid, sensitive and safe Salmonella detection and enhancing the analytical performance of paper-based sensors.

CN121674407AActive Publication Date: 2026-03-17MINISTRY OF AGRI & RURAL AFFAIRS FOOD & NUTRITION DEV INST
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610203336.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-12
Publication Date
2026-03-17
Estimated Expiration
2046-02-12

AI Technical Summary

Technical Problem

Existing Salmonella detection methods suffer from poor on-site detection performance, long processing time, and low safety, making it difficult to achieve rapid, sensitive, and safe detection.

Method used

A lateral flow chromatography biosensor co-constructed with a targeted antibacterial aptamer and a nucleic acid nanozyme is developed. The targeted antibacterial aptamer enables rapid recognition and capture of Salmonella, while the multifunctional nucleic acid nanozyme ensures stable signal output. This results in a "multifunctional, integrated" paper-based lateral flow chromatography biosensor with high sensitivity and biosafety.

Benefits of technology

It enables rapid, sensitive, and safe on-site detection of Salmonella, significantly enhancing the analytical performance and operational safety of paper-based sensors, and achieving visual detection within 5 minutes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674407A_ABST
    Figure CN121674407A_ABST
Patent Text Reader

Abstract

The invention provides a salmonella lateral flow chromatography biosensor. The invention particularly relates to a sandwich lateral flow chromatography sensor consisting of a nucleic acid nano enzyme and a bacteriostatic aptamer. When a target to be detected exists, the target to be detected is combined with the nucleic acid nano-enzyme probe on the combination pad, flows through the capillary action and is specifically intercepted by the Sal5-4-17nt aptamer when passing through the T line, and the redundant nucleic acid nano-enzyme probe continuously flows to the C line through the capillary action and is intercepted and captured through hybridization among nucleic acid sequences; therefore, after the color developing solution is added, obvious blue strips appear on T and C; when the to-be-detected target does not exist, the nucleic acid nano-enzyme probe is not intercepted by the T line and is intercepted only when the to-be-detected target passes through the C line, that is, only the C line has a blue band after the developing solution is added. The test paper can realize visual detection of salmonella within 5 minutes after probe dosage and hybridization sequence design and color developing solution and color developing time optimization, and meanwhile, the test paper has good biological safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of food safety testing technology and relates to a Salmonella lateral flow chromatography biosensor, specifically a lateral flow chromatography biosensor co-constructed with a targeted antibacterial aptamer and a nucleic acid nanozyme. Background Technology

[0002] salmonella( Salmonella Foodborne pathogens (Pseudomonas aeruginosa) are a common group of Gram-negative enteric bacteria that are transmitted to humans through food (undercooked poultry, eggs, dairy products, etc.), water, or contact with infected animals. They cause symptoms such as diarrhea, abdominal pain, fever, nausea, and vomiting, and are among the major pathogens causing foodborne illnesses globally, posing a continuous and serious challenge to human health and global public health. To address the health hazards posed by foodborne pathogen contamination, it is imperative to develop novel detection methods for foodborne pathogens to promptly identify contaminated food and control the potential spread of risk. Sideflow chromatography biosensors, using filter paper, cellulose membranes, etc., as substrates, drive liquid flow through capillary action, making them particularly suitable for developing low-cost, portable, disposable, and user-friendly on-site point-of-care testing devices.

[0003] With the continuous development of aptamer technology, it has gained widespread attention due to its flexibility, stability, ease of modification, and low cost. Particularly in Salmonella detection methods, aptamers have been found to possess excellent targeting and antibacterial functions. Salmonella aptamers are nucleic acid sequences that can specifically bind to Salmonella. They are generally obtained through SELEX screening, mainly including Cell-SELEX, MB-SELEX, agarose bead-SELEX, and capture-SELEX. Typically, specific screening of functional components on the bacterial surface can also be performed based on the application requirements of the Salmonella aptamers. Currently, more than 30 Salmonella aptamers have been screened, and the appropriate one can be selected based on the application scenario.

[0004] SipA protein is a key effector protein secreted by the type III secretion system (T3SS), which significantly enhances bacterial invasion efficiency by promoting host cell actin polymerization and membrane wrinkling. Studies have shown that SipA deficiency reduces bacterial invasion ability. Based on this, Shatila et al. developed an inhibitory aptamer targeting SipA protein, which utilizes its high affinity binding property to block SipA function, thereby inhibiting bacterial invasion (Single-stranded DNA (ssDNA) Aptamer targeting SipA protein inhibits Salmonella Enteritidis invasion of intestinal epithelial cells, International journal of biological macromolecules 148 (2020) 518-524.). The results showed that Apt17 exhibited high affinity for SipA protein, with a Kd value of 114.9 nM at 27°C and 63.4 nM at 37°C. The temperature dependence indicates that it binds more strongly at physiological temperatures. At the same time, Apt17 effectively inhibited the adhesion and invasion of Caco-2 cells by the two test strains, providing a potential novel intervention strategy for combating Salmonella infection.

[0005] Kadirvelu et al. discovered a novel, highly sensitive FRET (fluorescence resonance energy transfer) aptamer sensor for the rapid and specific detection of Salmonella paratyphi A (Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A, Spectrochimica acta. Part A, Molecular and biomolecular spectroscopy 243(2020) 118662.). The aptamer sequence, Sal1, was obtained through whole-cell SELEX screening, exhibiting high affinity and specificity. 3D structural modeling of this aptamer and interaction analysis with a potential target (bacterial DNA gyrase) showed that aptamer binding significantly alters the conformation and kinetics of DNA gyrase, potentially inhibiting its function and providing theoretical support for the aptamer's inhibitory mechanism. Furthermore, the aptamer sequence has a high GC content, suggesting the potential to form a complex secondary structure, the G4 chain.

[0006] Singhal et al. screened the high-affinity aptamer Sal5 using whole-cell SELEX technology and specifically recognized the Salmonella typhimurium trimer through hydrogen bonding / π-π interactions (Salmonella typhimurium detection and ablation using OmpD specific aptamer with non-magnetic and magnetic graphene oxide, Biosensors & bioelectronics 234 (2023) 115354). They then combined this with graphene oxide to successfully construct a multifunctional detection-killing platform.

[0007] Based on previous research, this study uses the three representative primitive aptamers mentioned above as test targets. The aptamer sequences are then trimmed and optimized using molecular docking to achieve optimal recognition performance and antibacterial function. This approach also addresses the problems of poor performance, long processing time, and low safety in rapid on-site detection of Salmonella.

[0008] The main content of this invention is to achieve rapid identification and capture of Salmonella by targeting antibacterial aptamers, and to combine multifunctional nucleic acid nanozymes to achieve stable signal output of the lateral flow chromatography biosensor. At the same time, the two work together to inhibit bacteria and ensure the safety of the "multifunctional and integrated" paper-based lateral flow chromatography biosensor, thus obtaining a portable Salmonella detection device with high sensitivity, strong stability and biosafety. Summary of the Invention

[0009] Based on the shortcomings of existing technologies, the present invention aims to provide a Salmonella lateral flow chromatography biosensor with advantages such as simple operation, cost-effectiveness, and speed. The second objective is to provide a high-affinity aptamer sequence for Salmonella, which can serve as a sensing element for rapid Salmonella recognition and capture. The third objective is to provide a nucleic acid nanozyme with both targeted recognition and antibacterial functions, achieving visualized signal output of the target through its excellent enzyme-like activity. The fourth objective is to provide a method for preparing this nucleic acid nanozyme. The fifth objective is to provide a field application for rapid Salmonella detection.

[0010] The objective of this invention is achieved through the following technical solution: On the one hand, the present invention provides a nucleic acid aptamer sequence with Salmonella-specific recognition function.

[0011] The nucleic acid aptamer sequence is Sal5-4-17:ATGATCAGGAGTCATGC, as shown in SEQ ID NO.25.

[0012] On the other hand, the present invention provides a nucleic acid aptamer sequence with Salmonella-specific recognition function.

[0013] The nucleic acid aptamer sequence is Sal1-A: AGGGGTCTGGTGTCGGGCCGCGGGTCAGGG, as shown in SEQ ID NO. 10.

[0014] On the other hand, the present invention provides a nucleic acid aptamer sequence with Salmonella-specific antibacterial function.

[0015] The nucleic acid aptamer sequence is Sal1-C: GGGTCAGGGGGGTAAGGGA, as shown in SEQ ID NO.12.

[0016] On the other hand, the present invention provides a nucleic acid nanozyme, which is synthesized by hydrothermal method using a nucleic acid sequence as a template, and has peroxidase-like activity, capable of catalyzing color changes in TMB; The nucleic acid sequence consists of three parts: the 3' end is the hybridization complementation region, the 5' end is the aptamer region, and the middle is the nanozyme synthesis region, including SEQ ID NO.33 and SEQ ID NO.36; The hydrothermal synthesis conditions are Ag + :Pt 2+ Synthesized at a ratio of 1:1 at 100℃ for 5 h.

[0017] On the other hand, the present invention provides a Salmonella lateral flow chromatography biosensor, wherein the T line and the C line are respectively immobilized with nucleic acid sequence 1 and nucleic acid sequence 2; and the binding pad is infiltrated with nucleic acid nanozyme; The nucleic acid sequence 1 is 5'-CCCCCCCCATGATCAGGAGTCATGC-3', with a biotin molecule linked to the 5' end; The nucleic acid sequence 2 is 5'-CCCCCCCCCCGGGTTGTTTGTT-3', with a biotin molecule attached to the 5' end; or 5'-CCCCCCCCCGCGCGCGCGCGCGCGCGCGCG-3', with a biotin molecule attached to the 5' end.

[0018] The aforementioned nucleic acid nanozyme refers to a nanozyme synthesized using the above-mentioned nucleic acid sequence and a hydrothermal method.

[0019] On the other hand, the present invention provides a Salmonella lateral flow chromatography biosensor, and the method for detecting Salmonella in food using this biosensor includes the following steps: (1) The sample to be tested is mixed with the system buffer and dropped onto the sample pad of the side flow chromatography sensor, and migrates upward by capillary force; (2) When passing through the binding pad, the target to be tested binds to the nucleic acid nanozyme and continues to migrate. It is captured at the T line through the "sandwich" and retained at the C line through hybridization and complementary pairing; otherwise, the nucleic acid nanozyme is only retained at the C line. (3) Add color-developing solution to the test strip, observe the blue band after 2 minutes, and take a picture of the detection line with a smartphone to record the signal intensity, thereby judging the detection effect of Salmonella.

[0020] On the other hand, the nucleic acid aptamer sequence provided by this invention is applied in Salmonella detection methods.

[0021] On the other hand, the present invention provides the application of nucleic acid nanozymes in the Salmonella detection method.

[0022] On the other hand, the biosensor provided by this invention is used in the detection of Salmonella in food.

[0023] The beneficial effects of this invention are: To improve the sensitivity, timeliness, and biosafety of rapid on-site detection of Salmonella, this invention utilizes a targeted antibacterial aptamer to achieve rapid pathogen identification and capture, and coordinates with the cascade signal amplification effect of multifunctional nucleic acid nanozymes to construct a dual-function integrated lateral flow chromatography sensor for "detection-antibacterial" synthesis. This platform simultaneously performs visual detection and activity inhibition of target bacteria, significantly enhancing the analytical performance and operational safety of paper-based sensors.

[0024] (1) Through a cyclical process of structural simulation, molecular docking, and rational tailoring, three aptamer sequences with high affinity for Salmonella standard strains (ATCC 29213 and CMCC 50115) were successfully screened from the candidate library: Sal1-A, Sal1-G4, and Sal5-4-17. The Kd values ​​of Sal5-4-17 with ATCC 29213 and CMCC 50115 strains were 11.6 μM and 90.62 nM, respectively; the Kd values ​​of Sal1-A with ATCC 29213 and CMCC 50115 strains were 615.7 nM and 66.76 nM, respectively; and the Kd values ​​of Sal1-G4 with ATCC 29213 and CMCC 50115 strains were 762.1 nM and 7.9 nM, respectively. μM; meanwhile, Apt17-40nt and Sal1-C showed high antibacterial efficiencies, reaching 53.2% and 46.8%, respectively.

[0025] (2) A nanozyme with high enzyme activity was synthesized by hydrothermal method, which could catalyze a significant color change in TMB. The synthesis conditions and stability were optimized. The results showed that Ag@Pt-S1 synthesized with Ag:Pt=1:1 had the highest enzyme activity, and the synthesis conditions were 100℃ for 5 h. The nanozyme can tolerate a wide range of pH and temperature. Under room temperature conditions, the enzyme activity of the nanozyme remained basically unchanged for half a year. The nanozymes synthesized in four repeated batches all showed good catalytic activity, and there was no significant difference in catalytic ability.

[0026] (3) A "sandwich" lateral flow chromatography sensor based on "nucleic acid nanozyme" probe, "antibacterial aptamer" recognition system, and "minimalist" single detection form was successfully constructed. After optimization of probe dosage, hybridization sequence design, colorimetric solution and colorimetric time, Salmonella can be visualized within 5 minutes. At the same time, the test strip has good biosafety. Attached Figure Description

[0027] Figure 1 Molecular docking and trimmed sequences of Apt17 aptamer with SpiA. (A) Molecular docking results of Apt17 with SpiA; (B) Molecular docking results of Apt17-40nt with SpiA; (C) Trimmed and optimized sequence; Note: Bases in the original sequence are labeled according to the molecular docking results, where blue borders indicate phosphate backbone interactions and red borders indicate base interactions.

[0028] Figure 2 Molecular docking results of Sal1 aptamer with DNA gyrase. (A) Molecular docking results of Sal1 with DNA gyrase; (B) Molecular docking results of Sal1-40nt with DNA gyrase; (C) Molecular docking results of Sal1-G4 with DNA gyrase; (D) Optimized cut sequence of Sal1.

[0029] Figure 3 Molecular docking results of Sal5 aptamer and OPDM. (A) Molecular docking results of Sal5 and OPDM trimer; (B) Molecular docking results of Sal5-40 nt and OPDM trimer; (C) Molecular docking results of Sal5-40 nt and OPDM trimer; (D) Sal5 trimmed and optimized sequence.

[0030] Figure 4 Affinity determination between aptamers and target bacteria. (A) Flow cytometry results; (B) Kd measurement results of aptamers.

[0031] Figure 5 Specificity analysis of aptamers and target bacteria.

[0032] Figure 6 Optimization of nanozyme synthesis conditions.

[0033] Figure 7 Stability assessment of nanozymes. A, C, E, G represent the stability results of Pt-S1; B, D, F, H represent the stability results of Ag@Pt-S1.

[0034] Figure 8 Synthesis of nucleic acid nanozymes.

[0035] Figure 9 Evaluation of the antibacterial activity of nanozymes in the presence of H2O2.

[0036] Figure 10 MIC determination of Ag@Pt nanozymes.

[0037] Figure 11 Electron microscopy results of nanozyme antibacterial activity. (A) and (B) are Salmonella control groups; (C) and (D) are Ag@Pt nanozyme treatment groups; (E) and (F) are Ag@Pt nanozyme + H2O2 treatment groups; the scale bar in (A), (C) and (E) is 2 µm, and the scale bar in (B), (D) and (F) is 200 nm, which are magnified views of the above images.

[0038] Figure 12 Elemental distribution on bacterial surfaces in different treatment groups. (A) Salmonella control group; (B) Ag@Pt nanozyme treatment group; (C) Ag@Pt nanozyme + H2O2 treatment group.

[0039] Figure 13 Detection principle of Salmonella side-flow chromatography biosensor.

[0040] Figure 14 Design of nucleic acid sequences for nanozyme probe synthesis.

[0041] Figure 15 SEM results of the test strips; (A) and (B) are bare test strips; (C) and (D) are test strips treated with pad treatment solution; (E) and (F) are results of Ag@Pt nanozyme treatment; scale bars are 100 μM and 20 μM, respectively.

[0042] Figure 16 Optimization of the detection system for the lateral flow chromatography sensor. (A) Optimization of the ratio between streptavidin and probe; (B) Optimization of nanozyme dosage; (C) Optimization of TMB chromogenic solution dosage; (D) and (E) Effects of binding pad and sample pad treatment on the complementary hybridization effect of C-line and nucleic acid nanozyme.

[0043] Figure 17Nucleic acid probe optimization for lateral flow chromatography biosensors. (A) Hybridization base optimization between C-line probe and nucleic acid nanozyme; (B) T-line sequence optimization.

[0044] Figure 18 Detection performance of Salmonella by lateral flow chromatography sensor. Detailed Implementation

[0045] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0046] The binding proteins corresponding to the three aptamers (Apt17, Sal1, and Sal5) selected in this invention are SpiA, DNAgyrase, and OMPD, respectively. The 3D structures of protein entries Q8VQB5, A0A5I8Z7Q2, and A0A0H3NBQ0 published in the Universal Protein Resource were used for molecular docking. The nucleic acid sequences used in the experiment are shown in Table 1. The Salmonella strains were obtained from laboratory collections, with strain numbers CMCC 50115 and ATCC29213.

[0047] Table 1-1 Nucleic Acid Sequences Table 1-2 Nucleic Acid Sequences Table 1-3 Nucleic Acid Sequences Example 1: The process of tailoring and optimizing Salmonella aptamers This invention employs molecular docking to guide and verify the interaction between aptamers and their binding targets, including key bases and forces. The folding structure of the aptamers was analyzed using 3d RNA_DNA (http: / / biophy.hust.edu.cn / new / 3dRNA / create). Protein results were downloaded from Uniport (https: / / www.uniprot.org / ), and two PDB files were uploaded to the HDOCK server (http: / / hdock.phys.hust.edu.cn / ) for molecular docking. The molecular docking results were then processed and analyzed using PyMOL.

[0048] Before optimizing and tailoring the Apt17 aptamer, it was first docked with SpiA to predict its key bases, providing theoretical guidance for subsequent tailoring. The specific docking results are shown in Figure 1A. It can be seen that the bases within a 5 Å range are 21-25, 44-47, 53-55, 64, and 66-78. Among them, the bases interacting with amino acid residues are 45C-685ARG; 67A-168GLY, 172SER; 69T-167THR, 169GLY, 227GLN; 72T-551ARG, 578ASN; 75A-566ARG; 76T-566ARG; and 78A-173LYS. However, the phosphate backbone at 45C functions, while 67A, 69T, 72T, 75A, 76T, and 78A, although functioning as bases, mostly have bond lengths ≥3 Å, meaning their hydrogen bonding is relatively weak. Only the 69T-169GLY bond has a 2.8 Å hydrogen bond (located in the downstream primer). Based on the above docking results, it is known that the downstream primer region of Apt17 has strong interactions with SpiA. To avoid the influence of upstream and downstream primers, molecular docking was also performed between Apt17-40nt and SpiA. The docking results are as follows. Figure 1 As shown in Figure B, the bases within the 5 Å range are: 9-17, 25, 26, 30-33, and 35-40. The bases interacting with amino acid residues are: 9A-235THR; 11C-239ARG, 527SER; 12G, 13C-528THR, 551ARG, 578ASN; 25A-502THR, 503ASP; 30T-506ASNs; 31A-506ASN, 588THR; 36T-165ASN; 37G-164LYS; and 39G-247GLN. Among these, 9A, 11C, 12G, 13C, 30T, and 31A interact with the phosphate backbone, while 25A, 36T, 37G, and 39G interact with the bases. Furthermore, surface simulations show that the SpiA protein encapsulates the aptamer structure. Based on the docking results, the Apt17-40nt aptamer was trimmed. First, the non-functional base at the 5' end of the sequence was deleted to form Apt17_1; then, a terminal complementary base was added to this structure to improve the stability of the secondary structure, forming Apt17_2; next, 25A was mutated to 25T to form Apt17_M(AT); then, the two consecutive phosphate backbone bases 30T and 31A located on the hairpin ring were deleted to form Apt17_D(TA); and finally, two mutated bases CG were randomly added to form Apt17_M(CG). The specific trimmed sequence secondary structure is as follows. Figure 1 As shown in C.

[0049] Similar to the Apt17 trimming strategy, molecular docking was performed on the Sal1 and Sal1-40nt sequences, respectively, with the following results: Figure 2 As shown in Figure 2A, the docking results of Sal1 with DNA gyrase indicate that the bases within a 5 Å range are 13, 15-19, 21-22, 28-31, 34, 36-39, 43-46, and 51-58. Among these, the bases interacting with amino acid residues are 17A-293ARG, 302ARG; 18C-302ARG; 28G-535SER; 29G-533LEU, 535SER; 31T-253LYS; 38T-518ARG; and 39C-518ARG. ;44C-129LYS;45G-512GLN;46-511ASP;55G-292LEU;56G-284LYS;57G-283ASP;The phosphate backbones that function are: 17A, 18C, 38T, 39C, 44C, 45G, 55G, and the bases that function are: 28G, 29G, 31T, 46C, 55G, 56G, 57G, and based on the bond lengths, they are likely hydrogen bonds. As shown in Figure 2B, the docking results of Sal1-40 nt with DNAgyrase indicate that the bases within a 5 Å range are 4, 7-8, 15, and 19-34. Among these, the bases interacting with amino acid residues are: 20G-321TYR, 329SER, 21C-322SER; 22G-322SER; 23G-323GLN, 605TYR; 24-606TYR; and 25T-617ARG. The phosphate backbones function at 20G, 23G, and 25T; the bases function at 21C, 22G, and 23G, and based on the bond lengths, these are likely hydrogen bonds. Furthermore, based on the secondary structure of the G4 chain obtained by Kadirvelu (Sal-G4), we also performed molecular docking analysis. Figure 2C), the bases within a 5 Å range are 1-18, of which the bases interacting with amino acid residues are 2G-284LYS, 308LYS; 3G-288GLY, 617ARG; 4C-284LYS, 617ARG; 6G-323GLN; 8G-285ARG; 14G, 15G-548TYR, 615ARG; 18G-611SER, 613GLY. The phosphate backbones function at 2G, 3G, 8G, and 14G, while the bases function at 4C, 6G, 14G, 15G, and G18, and based on bond lengths, these are likely hydrogen bonds. We used the Quick G4Hunter calculator (https: / / bioinformatics.cruk.cam.ac.uk / G4Hunter / ) to score the aptamer sequence. Based on the inference that scores above 1.75 generally indicate a G4 chain structure, we performed the following analysis on aptamer Sal1. Figure 2 The cut shown in Figure 2D has specific scores, as shown in Table 2. However, as can be seen from Figure 2D, this sequence is difficult to form a secondary structure, which may be due to the limitations of the prediction website's algorithm, which failed to predict complex secondary structures.

[0050] Table 2. G4 Huanter scores for nucleic acid sequences Similar to the aforementioned trimening strategy, molecular docking was performed between the Sal5 and Sal5-40nt sequences and the trimer and monomer OMPD, respectively. The results are as follows: Figure 3As shown in Figure 3A, the docking results of the Sal5 aptamer with the trimer OMPD protein are as follows: Bases 19A, 20T, 24C, 25A, 26G, 27G, 28A, 29G, 34G, 35C, 48T, 49T, 58C, and 75T interact with amino acids via hydrogen bonds, while 75T, 58C, 35C, 34G, 27G, 28A, 29G, 26G, 25A, and 24C are the bases that play a role. The specific amino acids are 81ASN, 224ASP, 225ARG, 227ASN, 235ASN, 277ALA, 279ASP, 295TYR, 309LYS, 317THR, 360LYS, 362SER, 363THR, and 364ASP. The analytical results are not entirely consistent with those in the literature. This may be due to individual differences caused by variations in analytical software and response calculation algorithms. Molecular simulation can only serve as a guide, not the sole basis for analysis. It also indirectly indicates that molecular docking techniques need to be verified against experimental results. In Figure 3B, removing the primer aptamer docking with the trimer protein reveals that only the 16C and 19T bases exhibit hydrogen bonding, with the interacting amino acids being 121TYR, 168TYR, 331ALA, and 341THR. Figure 3C shows that the bases 1C, 2A, 6G, 8C, 10T, 14A, 17A, 24A, 39G, and 40C exhibit hydrogen bonding. The corresponding amino acids are 12ILE, 41ASP, 62GLY, 78THR, 97ASN, 98ARG, 101SER, 102GLN, 121TYR, 127GLY, 128ARG, and 196TYR. Ten bases interacted with atoms in the amino acid, but specific analysis revealed that only 1C, 10T, and 17A interacted with the base groups, while the others interacted with phosphodiester bonds. Based on this, the Sal5 aptamer sequence was optimized and trimmed. The specific nucleic acid sequence secondary structure is shown below. Figure 3 As shown in D. The docking results show that the primer region may affect the binding effect of the aptamer to the target protein. Therefore, the region selected in the first trimming is the non-secondary structure region (including part of the primer region, Sal5-1-57nt), the second trimming is the primer removal region (Sal5-2-40nt), the third trimming is the secondary structure of a smaller region (Sal5-3-36nt), and the fourth trimming is the secondary structure of the smallest unit (Sal5-4-17nt).

[0051] Example 2: Affinity determination of aptamers In this invention, the performance standards of the aptamer are evaluated using two indicators: affinity and antibacterial efficiency, to assess the binding efficiency and antibacterial ability of the aptamer to the target. Firstly, the method for determining affinity is as follows: 1. Activate the frozen strain in LB medium. After ensuring the strain's viability is restored, take 1 mL of logarithmic phase viable bacteria and measure the OD. 600nm = around 0.44, approximately 10 9 CFU / mL Salmonella was washed twice with washing buffer at 8000 rpm for 10 min and then resuspended in 1 mL binding buffer.

[0052] 2. Take 45 μL of bacterial culture and 5 μL of 1 μM aptamer sequence and incubate at 30℃ for 1 h. Then, centrifuge at 8000 rpm for 10 min and wash twice to remove unbound aptamers. Resuspend and dissociate in the buffer.

[0053] 3. After heat denaturation at 95℃ for 10 min, immediately place on ice for 5 min, centrifuge at 8000 rpm for 10 min, and collect the supernatant.

[0054] 4. Perform qPCR amplification. The 20 μL system includes 1 μL 10 μM F / R (final concentration 0.5 μM), 10 μL 2×Mix, 1 μL template, and 7 μL H2O. Amplification is performed under the following program: 95℃ for 5 min; 95℃ for 15 s; 58℃ for 20 s, for 40 cycles.

[0055] There are three primer pairs (F / R), determined based on the specific fragment to be amplified. A 0.1 nM template sequence was used as a positive control, and bacterial culture without aptamer incubation served as a negative control. The dissociation constant (Kd) was determined by data processing based on the Ct values ​​of the binding affinity between different concentrations of aptamers (10 μM, 5 μM, 1 μM, 0.5 μM, 0.1 μM, 0.01 μM) and the target.

[0056] Next are the experimental steps for verifying antibacterial efficiency: 1. 1 mL 10 6 CFU / mL CMCC50115 Salmonella was washed twice with washing buffer at 8000 rpm for 10 min and then resuspended.

[0057] 2. Take 45 μL of bacterial culture and incubate it with 5 μL of 10 μM Aptamer at 30℃ for 1 h.

[0058] 3. After diluting the above bacterial solution, take 100 μL and spread it, and incubate it at 37℃ for 12 h. Calculate the antibacterial efficiency by comparing the number of colonies in the experimental group with the number of colonies in the control group.

[0059] Since the optimized aptamers of Sal1 and Sal5 are affinity for the target protein, we used qPCR to verify their affinity. However, different amplification lengths and the secondary structure between primers and aptamers may affect the Ct values ​​of qPCR amplification. Therefore, we selected a 0.1 nM nucleic acid sequence as a control group to correct for Ct errors. The specific results are shown in Table 3. Table 3 shows that the binding concentrations of the Sal1 aptamers with CMCC50115 strain are ranked as follows: Sal1-AP > Sal1 > Sal1-G4-P > Sal1-BP > Sal1-CP; and with ATCC29213 strain, the binding concentrations are ranked as follows: Sal1-G4-P > Sal1-BP > Sal1-AP > Sal1-CP > Sal1. The affinity rankings of the two aptamers are inconsistent, which may be due to metabolic differences between strains. However, in terms of binding concentration, both aptamers have binding abilities reaching the nM level, showing good performance. Meanwhile, as shown in Table 3, the binding concentrations of the Sal5 series aptamers with the CMCC50115 strain were ranked as follows: Sal5-4-17nt > Sal5-3-36nt > Sal5-2-40nt > Sal5-1-57nt; and with the ATCC29213 strain, the binding concentrations were ranked as follows: Sal5-4-17nt > Sal5-3-36nt > Sal5-2-40nt > Sal5-1-57nt. The affinity rankings were consistent, but the Sal5 series aptamers showed a higher binding concentration with the CMCC50115 strain. To better characterize the binding ability of the aptamers to the target, we deleted the primer regions and synthesized fluorescently modified Sal1-A, Sal1-G4, and Sal5-4-17 sequences. Flow cytometry was used to determine the Kd values ​​between the aptamers and the ATCC29213 and CMCC50115 strains, and the results are shown in Figure 4. The Kd values ​​for Sal5-4-17 with ATCC29213 and CMCC50115 strains were 11.6 μM and 90.62 nM, respectively, consistent with the qPCR binding concentration calculations. The Kd values ​​for Sal1-A with ATCC29213 and CMCC50115 strains were 615.7 nM and 66.76 nM, respectively; and the Kd values ​​for Sal1-G4 with ATCC29213 and CMCC50115 strains were 762.1 nM and 7.9 μM, respectively. We also used qPCR technology to test the specificity of the aptamers. Figure 5 The specificity results shown indicate that the tailored and optimized aptamers have good specificity and can effectively distinguish between target and non-target bacteria. In subsequent experiments, appropriate aptamer sequences can be selected based on the type of target bacteria to be tested.

[0060] Table 3. Validation of the binding affinity between Sal1 and Sal5 series aptamers and target bacteria. Note: Ct* is the average of three measurements; ΔCt = Ct 待确定 -Ct 0.1nM模板 .

[0061] Furthermore, the Apt17 series aptamers target the SipA protein, a key effector protein influencing Salmonella invasion efficiency. The Sal1 sequence aptamer has a potential target of DNA gyrase, which may also affect Salmonella replication and infection. Therefore, the antibacterial efficacy of the Apt17-optimized aptamer and the Sal1 series aptamers was also validated. First, based on the growth curve of CMCC50115, it was determined that the logarithmic growth phase was reached at 12 hours of culture, at which point the OD... 600nm =0.447, and based on the colony count, the viable count at this time was determined to be approximately 2.0 × 10⁻⁶. 9 CFU / mL. The antibacterial efficiency was calculated based on the total bacterial count. The results showed that Apt17-40nt and Sal1-C had high antibacterial efficiencies, reaching 53.2% and 46.8%, respectively (Table 4). To further enhance the inhibitory effect on foodborne pathogens, we subsequently employed an aptamer-nucleic acid nanozyme approach to synergistically improve antibacterial activity.

[0062] Table 4 Antibacterial efficiency of aptamers Example 3: Synthesis and Characterization of Nucleic Acid Nanozymes Nanozymes were synthesized using a hydrothermal method. Specifically, a DNA template sequence (20 μM, 10 μL), 1 mM K2PtCl4 (1 mM, 15 μL), and AgNO3 (1 mM, 15 μL) were added to 60 μL of sodium citrate buffer. After vigorous shaking for 1 min, the mixture was heated in a metal bath at 100°C for 60 min to prepare the hydrothermal nanozyme, which was then stored at 4°C for later use. The initial Pt content during the Pt nanozyme synthesis process was first analyzed. 2+ The concentration was optimized, and K₂PtCl₄ with final concentrations of 0.05, 0.1, 0.2, 0.3, and 0.5 mM were selected. Figure 6 A indicates that as Pt... 2+ Increased concentration of Pt nanozymes increases their ability to catalyze TMB, and OD is enhanced under DNA template-free conditions. 652nm The value increases faster. The OD of TMB is catalyzed by Pt-S1 nanozymes and Pt nanozymes. 652nm The difference can be compared to know ( Figure 6(B) At low concentrations, Pt-S1 nanozymes exhibit higher enzyme-like activity than Pt nanozymes; however, at high concentrations, the nanozyme activity is higher than that of Pt-S1 nanozymes. This phenomenon may be due to the fact that the DNA template is Pt at low concentrations. 2+ It provides a coordination binding site, which is more conducive to its nucleation and quickly initiates the nanozyme synthesis step; however, under high concentration conditions, the role of the DNA template weakens and may even hinder the synthesis of nanozymes with higher enzyme activity.

[0063] In addition, Ag is one of the most commonly used antibacterial elements. Besides destroying bacterial cell walls and cell membranes and inactivating bacteria, Ag... + It can also kill bacteria by inhibiting bacterial respiration through the generation of large amounts of reactive oxygen species (ROS). Furthermore, Ag@Pt nanozymes also exhibit good TMB catalytic activity; therefore, we further optimized the Ag:Pt ratio of Ag@Pt nanozymes to obtain even better catalytic performance. Figure 6 As shown in Figure C, the enzyme activity of Ag@Pt nanozymes gradually increases as the Ag:Pt ratio decreases, and the enzyme activity of Ag@Pt nanozymes synthesized with DNA templates is higher than that of Ag@Pt nanozymes synthesized with only metal ions. When Ag:Pt=1:1, the function of DNA templates is more obvious.

[0064] To simplify the synthesis process, the temperature and time were optimized. Nanozymes were synthesized at room temperature, 37℃, 60℃, 90℃, and 100℃, respectively, with the following results: Figure 6 As shown in E. High temperature is a necessary condition for nanozyme synthesis. The synthesized nanozymes exhibit the highest activity at 100℃, therefore, 100℃ was used for all subsequent nanozyme synthesis conditions. However, the experimental results for optimizing synthesis time (10 min, 30 min, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 8 h, 10 h) show that... Figure 6 F), the activity of the nanozyme gradually increases with time, and it also gradually increases under conditions without a nucleic acid template. Therefore, according to ΔOD... 652nm It can be determined that the optimal growth time for Pt-S1 is 6 hours, while the optimal growth time for Ag@Pt-S1 is 5 hours.

[0065] Based on the above research results, we synthesized 0.1 mM Pt-S1 and Ag@Pt-S1 nanozymes with an Ag:Pt ratio of 1:1, and evaluated their stability in four aspects. The results are as follows: Figure 7 As shown. Compared to natural enzymes, the newly synthesized nanozymes can exert catalytic activity under extreme acid-base conditions. Figure 7It can be seen that the Pt-S1 nanozyme exhibits good enzyme-like activity stability within a pH range of 2.0–11.0, while Ag@Pt-S1 also exhibits good enzyme-like activity stability within a pH range of 5.0–11.0. Although its ability to catalyze color changes in TMB decreases under pH conditions of 2.0–4.0, its catalytic activity still exists. Furthermore, the operating temperature of the nanozyme is also crucial for its subsequent applications. Figure 7 CD analysis revealed that the newly synthesized nanozyme exhibited good stability at temperatures ranging from -80℃ to 90℃, demonstrating a significant temperature advantage compared to proteases. Furthermore, storage time is crucial for subsequent nanozyme transportation and application; accelerated aging experiments were conducted to determine the storage time. Figure 7 According to EF, the enzyme activity of nanozymes remained essentially unchanged within six months under room temperature conditions. Furthermore, in batch stability experiments, all four synthesized nanozymes exhibited good catalytic activity, with no significant difference in catalytic ability among them.

[0066] Based on this, four types of nucleic acid nanozyme probes were designed, and eight nanozymes were synthesized using Sal1-G4-S1-C1, Apt17-40nt-S1-C1, Sal1-G4-S1-C2, and Apt17-40nt-S1-C2 templates. Sal1-G4 and Apt17 were aptamer sequences with good performance obtained in Example 2. S1 was the template for synthesizing the nucleic acid nanozymes, and C1 and C2 were complementary sequences to the control lines on the subsequent lateral flow chromatography sensor. To simplify labeling, Sal1-G4 was simplified to SalG4, and Apt17-40nt was simplified to Apt17. Figure 8 It can be seen that all four nucleic acid templates synthesized nanozymes with enzyme-like activities. The enzyme-like activity ranking of Pt nanozymes was: Pt-Apt17-S1-C1 > Pt-SalG4-S1-C2 > Pt-SalG4-S1-C1 > Pt-Apt17-S1-C2; the enzyme-like activity ranking of Ag@Pt nanozymes was: Ag@Pt-SalG4-S1-C2 > Ag@Pt-SalG4-S1-C1 > Ag@Pt-Apt17-S1-C1 > Ag@Pt-Apt17-S1-C2. Furthermore, as shown in Table 5, the synthesized nucleic acid nanozymes exhibited good Michaelis constants (Km). m ) and maximum reaction rate (V max This can be used as a subsequent visualization signal probe. Although the aptamer, complementary sequence, and nucleating sequence are separated by an A-rich sequence, the experimental results show that the nucleic acid sequence also affects the activity of the nanozyme, and further adjustments will be needed based on the experimental results in subsequent applications.

[0067] Table 5. V of nucleic acid nanozymes max and Km Measurement Next, the antibacterial properties of the nanozymes were studied. Considering that both nanozymes exhibit good peroxidase-like activity, and that peroxidase-like enzymes can catalyze the production of reactive oxygen species from H₂O₂, thereby disrupting the intracellular redox balance, further antibacterial experiments were conducted. The results are as follows: Figure 9 As shown, the antibacterial activity of Pt nanozymes increased after the addition of 0.4 mM H2O2, but this was mainly due to the addition of H2O2. This demonstrates that although Pt nanozymes possess peroxidase-like activity, their ability to catalyze H2O2 is counteracted by their other properties, preventing them from exerting their antibacterial function. Conversely, the antibacterial effect of Ag@Pt nanozymes was further enhanced compared to before the addition of H2O2, and this was further improved based on MIC measurements (…). Figure 10 We were able to determine that Ag@Pt-Apt17-S1-C1 had the best antibacterial effect at a lower concentration, and that 50 μL of 2μM nanozyme (concentration based on DNA template concentration) could completely inhibit the growth of Salmonella CMCC 50115.

[0068] Based on the above research, we used SEM to more intuitively characterize its antibacterial effect, and the results are as follows: Figure 11 As shown in the figure, the untreated control group all showed intact bacterial states, while the experimental group treated with Ag@Pt nanozymes showed obvious presence of nanoparticles on the bacterial surface, and the cells exhibited obvious collapse, shrinkage, and cell wall destruction. Furthermore, in the experimental group treated with both Ag@Pt nanozymes and H2O2, the stress changes in bacteria were more severe, and the bacterial morphology became shorter. We also performed energy dispersive spectroscopy (EDS) analysis on their elemental distribution, and the results are shown in the figure. Figure 12 The C, N, O, and Pt elements are clearly distributed on the bacterial surface, while the Ag element is relatively dispersed and does not accumulate on the bacterial surface. This may be because the Ag@Pt nanozyme exerts its antibacterial function mainly through the release of Ag. + accomplish.

[0069] Example 4: Design Principles of Sideflow Chromatography Biosensors This invention constructs a "sandwich" lateral flow chromatography sensor based on a "nucleic acid nanozyme" probe, an "antibacterial aptamer" recognition system, and a "minimalist" single-detection method. Combined with a smartphone, it forms a portable, visualized detection system. The experimental principle design is described in [link to experimental design]. Figure 13Based on the aptamer optimization results, the Sal5-4-17nt aptamer was selected as the recognition element for Salmonella. When the target is present, it binds to the nucleic acid nanozyme probe on the binding pad and flows through capillary action. When it passes through the T line, it is specifically intercepted by the Sal5-4-17nt aptamer, while the excess nucleic acid nanozyme probe continues to flow through capillary action to the C line, where it is captured by hybridization between nucleic acid sequences. Therefore, after the addition of the chromogenic solution, obvious blue bands appear at both the T and C lines. When the target is not present, the nucleic acid nanozyme probe is not intercepted at the T line, but is only intercepted when it passes through the C line. That is, after the addition of the chromogenic solution, only the C line will show a blue band.

[0070] Example 5: Optimization of Sensor Detection Performance The following eight nucleic acid sequences were selected for hydrothermal synthesis of Ag@Pt nanozymes. In the nucleic acid sequences, S1 is the nanozyme synthesis sequence, the C region of the 3' segment is the hybridization complementation region of the control line, and the 5' end region is the aptamer region. Specific sequence design is as follows: Figure 14 As shown, the Sal1-G4 and Apt17-40nt aptamer sequences were used as one end of the sandwich, forming an aptamer sandwich with the Sal5-4-17nt aptamer. Simultaneously, two hybridization complementation regions were involved in the C region: one GC-rich sequence (C1) to improve the stability of base pairing, and the other AC-rich sequence (C2) to reduce the influence of the base sequence on the synthesis of the nucleic acid nanozyme. For the C and T lines, complementary sequences of different lengths and support regions were selected, with three alternative sequences designed for each line. Before optimizing the reaction conditions, we first performed preliminary SEM characterization of the nanozyme and test strip binding effect. Figure 15 The results showed that Ag@Pt nanozymes were adsorbed on the test strip after nanozyme treatment, indicating that nucleic acid nanozymes can be used as visual probes for lateral flow chromatography test strips.

[0071] To improve the analytical performance of the method, we first optimized the ratio of streptavidin to nucleic acid. We selected Cprobe2-3 and Ag@Pt-SalG4-S1-C2 for condition optimization, determining the streptavidin-probe ratio to be 1:1, 1:2, 1:3, and 1:4. Figure 16A indicates that the binding effect is optimal when the ratio of streptavidin to probe is 1:1, and Ag@Pt nanozyme deposition can be observed even without chromogenic catalysis. While nanozyme deposition cannot be visually distinguished at ratios of 1:2 and 1:3, obvious color changes can be observed through nanozyme catalysis, further demonstrating that nanozymes can amplify signals and improve detection sensitivity. Next, the amount of nanozyme was optimized. 5, 10, 20, and 40 μL of Ag@Pt-Apt17-S1-C1 were selected for incubation with the C-probe1-3 line, and the results are as follows. Figure 16 As shown in B, 20 μL of nanozyme was subsequently used for incubation. The chromogenic solution used was Beyotime's ultra-sensitive TMB chromogenic solution. Experiments were conducted with 5, 10, 20, 40, and 60 μL of the solution. Results showed that color development was completed in 2 minutes, with a total solution volume of 10 μL. Figure 16 C). Next, the binding pad (pad treatment solution) and sample pad (PBS) were treated, and the reaction conditions were determined by the complementary hybridization effect of the C line with the nucleic acid nanozyme. During the experiment, the pad-treated test strip absorbed water faster and ensured a uniform flow rate, which was also conducive to hybridization between nucleic acid chains, thereby capturing the nucleic acid nanozyme. The experimental results show that ( Figure 16(D, E) The combination of C probe2-3 with Ag@Pt-SalG4-S1-C2 and the combination of C probe2-3 with Ag@Pt-Apt17-S1-C2-2 can achieve capture, and the streptavidin to probe ratio is 1:1. Among them, Ag@Pt-SalG4-S1-C2 has the best capture effect. At this time, the number of hybridization bases of C probe2-3 is 22 nt, the number of C region bases in Ag@Pt-SalG4-S1-C2 is 12 nt, and the number of C region bases in Ag@Pt-Apt17-S1-C2-2 is 22 nt. In addition, the combination of C probe1-3 with Ag@Pt-SalG4-S1-C1-2 and C probe1-3 with Ag@Pt-Apt17-S1-C1-2 can also achieve capture. Furthermore, Ag@Pt-SalG4-S1-C1-2 and Ag@Pt-Apt17-S1-C1-2 have all achieved hybridization with different streptavidin to probe ratios, indicating good capture performance. At this time, the number of hybridization bases in C probe1-3 is 22 nt, the number of C region bases in Ag@Pt-SalG4-S1-C1-2 is 22 nt, and the number of C region bases in Ag@Pt-Apt17-S1-C1-2 is 22 nt. The results above indicate that the synthesis of nucleic acid nanozymes may affect the hybridization efficiency between the bases in the C region of the nanozyme and the probe. Based on these results, the combination of C probe2-3 with Ag@Pt-SalG4-S1-C2 and the combination of Cprobe1-3 with Ag@Pt-Apt17-S1-C1-2 were selected for subsequent experiments.

[0072] Because the background value was high during the aforementioned system optimization process, the number of complementary bases for hybridization between the nucleic acid nanozyme and the probe was optimized to reduce the background value. C-lines were modified using C Probe 1-1, C Probe 1-2, C Probe 1-3, and C Probe 2-1, C Probe 2-2, C Probe 2-3, respectively. The optimal hybridization region between the C region and the probe of Ag@Pt-Apt17-S1-C1-2 is 22 nt (C Probe1-3). If the number of complementary bases is less than this, Ag@Pt-Apt17-S1-C1-2 nuclease cannot be captured. The optimal hybridization region between the C region and the probe of Ag@Pt-SalG4-S1-C2 is 12 nt (C Probe2-1), and the binding efficiency decreases with increasing probe base number. In the control group, Ag@Pt-SalG4-S1-C2 was partially captured by C Probe1-1, which may be due to weak complementary pairing between the aptamer bases and the probe on the C line. Figure 17A). Subsequently, experiments were conducted using the combination of C probe2-1 and Ag@Pt-SalG4-S1-C2, and the combination of Cprobe1-3 and Ag@Pt-Apt17-S1-C1-2. Finally, the Sal5-4-17 aptamer was selected as the Salmonella capture probe for the T-line sequence, and 4, 8, and 12 nt spacer sequences were optimized (sequence names: T Probe-1, T Probe-2, and T Probe-3) to ensure that the spacing between the aptamer and the paper substrate was sufficient to accommodate the spatial conformational changes of the aptamer. The results are as follows. Figure 17 As shown in B, the aptamer capture effect is optimal when the interval sequence is 8 nt.

[0073] Example 6: Sensor Detection Performance Under optimal conditions, the sensitivity of the Salmonella lateral flow chromatography biosensor was validated by selecting the combinations of C probe2-1 and Ag@Pt-SalG4-S1-C2 and C probe1-3 and Ag@Pt-Apt17-S1-C1-2, respectively. The results showed that the visual detection line for the C probe1-3 and Ag@Pt-Apt17-S1-C1-2 combination was 10. 2 The visual detection line for the CFU / mL C probe2-1 and Ag@Pt-SalG4-S1-C2 combination is 10. 3 CFU / mL Figure 18 ).

Claims

1. A nucleic acid aptamer sequence having a Salmonella-specific recognition function, characterized in that, The nucleic acid aptamer sequence is Sal5-4-17: ATGATCAGGAGTCATGC, as shown in SEQ ID NO.

25.

2. A nucleic acid aptamer sequence having Salmonella-specific recognition function, characterized in that, The nucleic acid aptamer sequence is Sal1-A: AGGGGTCTGGTGTCGGGCCGCGGGTCAGGG, as shown in SEQ ID NO.

10.

3. A nucleic acid aptamer sequence having a Salmonella-specific bacteriostatic function, characterized by, The nucleic acid aptamer sequence is Sal1-C: GGGTCAGGGGGGTAAGGGA, as shown in SEQ ID NO.

12.

4. A nucleic acid nanosclever, characterized in that, The nucleic acid nanometer enzyme is synthesized by using a nucleic acid sequence as a template by a hydrothermal method, has peroxidase-like activity, and can catalyze TMB to change color. The nucleic acid sequence is composed of three parts, the 3' end is a hybrid complementary region, the 5' end is an aptamer region, and the middle is a synthesis region of the nanometer enzyme, including SEQ ID NO. 33 and SEQ ID NO.

36.

5. The nucleic acid nanosensor of claim 4, wherein, The conditions for hydrothermal synthesis were Ag + : Pt 2 = 1 : 1, 100°C for 5 h.

6. A Salmonella lateral flow chromatographic biosensor, characterized in that, The T line and the C line respectively fix the nucleic acid sequence 1 and the nucleic acid sequence 2, and the combination pad infiltrates the nucleic acid nanometer enzyme. The nucleic acid sequence 1 is 5'-CCCCCCCCATGATCAGGAGTCATGC-3', and a biotin molecule is connected to the 5' end. The nucleic acid sequence 2 is 5'-CCCCCCCCCGGGTTGTTTGTT-3', and a biotin molecule is connected to the 5' end; or 5'-CCCCCCCCCGCGCGCGCGCGCGCGCGCGCG-3', and a biotin molecule is connected to the 5' end. The nucleic acid nanometer enzyme refers to the nucleic acid sequence of claim 4 and a hydrothermal synthesis method.

7. A method for detecting Salmonella in food using the biosensor of claim 5, characterized in that, The steps are: (1) The sample to be tested is mixed with the system buffer and added dropwise to the sample pad of the lateral flow chromatographic sensor, and migrates upward by capillary force; (2) When passing through the combination pad, the target to be tested is combined with the nucleic acid nanometer enzyme and continues to migrate, is captured at the T line by "sandwich sandwich", and is intercepted at the C line by hybrid complementary pairing; otherwise, the nucleic acid nanometer enzyme is only intercepted on the C line; (3) Add color developing solution to the test paper, observe the blue strip after 2 min, take a photo of the detection line by using a smart phone, record the signal intensity, and then judge the detection effect of Salmonella.

8. The application of the aptamer sequence of claims 1-3 in a Salmonella detection method.

9. The application of the nucleic acid nanometer enzyme of any one of claims 4-5 in a Salmonella detection method.

10. The application of the biosensor of claims 6-7 in the detection of Salmonella in food.

Citation Information

Patent Citations

  • Method for detecting Salmonella on basis of technique for amplifying nanogold-labeled and silver-enhanced signals

    CN101776688A

  • Salmonella sandwich DNA hybridization rapid detection probe, kit, and detection method

    CN105063204A

  • Detection method for salmonella enteritidis and detection kit

    CN106868158A

  • Preparation method and sensing application of nucleic acid nano-enzyme

    CN114807146A