Crassostrea hongkongensis VgR gene as well as shRNA-VgR sequence and application thereof

By screening and constructing the shRNA-VgR sequence of the VgR gene in Hong Kong oysters, precise regulation of reproductive development in Hong Kong oysters was achieved, solving the technical problem of improving reproductive performance, improving ovulation stability and fertilized egg development efficiency, and reducing costs.

CN121674409APending Publication Date: 2026-03-17BEIBU GULF UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511945737.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-22
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

In the existing technology, there are problems such as uneven maturity of oocytes, unstable natural ovulation rate, low development efficiency of high-quality fertilized eggs and low attachment rate of high-quality seedlings in the breeding process of Hong Kong oyster seedlings. There is a lack of effective molecular regulation methods, making it difficult to improve reproductive performance and germplasm optimization.

Method used

The VgR gene of Hong Kong oyster was screened and cloned, and the shRNA-VgR sequence was designed and constructed. The shRNA-VgR interference vector was introduced into Hong Kong oysters via adductor muscle injection to specifically silence VgR gene expression and regulate its physiological processes, including controlling the number and timing of ovulation.

Benefits of technology

It achieves precise regulation of the reproductive development of Hong Kong oysters, improves the stability of ovulation and the development efficiency of fertilized eggs, and is suitable for widespread application. It also reduces costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674409A_ABST
    Figure CN121674409A_ABST
Patent Text Reader

Abstract

The invention discloses a Crassostrea hongkongensis VgR gene and an shRNA-VgR sequence and application thereof, a VgR gene segment is obtained by screening and cloning from a Crassostrea hongkongensis transcriptome, shRNA is designed and synthesized according to the Crassostrea hongkongensis VgR gene sequence, and the shRNA is named as shRNA-VgR. The method comprises the following steps: introducing the VgR gene into Crassostrea hongkongensis by injecting adductor muscle to interfere and inhibit the expression of the VgR gene in the Crassostrea hongkongensis, detecting the expression and location distribution change of the interfered VgR gene, the activity change of related signal channel key genes and key enzymes regulated by the VgR gene, the morphological structure change of related tissues, the cell apoptosis condition and the like, and identifying the Crassostrea hongkongensis in the Crassostrea hongkongensis. And systematically analyzing the effect of the VgR gene and the regulatory pathway thereof in the physiological process of the crassostrea hongkongensis and the regulatory mechanism thereof. The injection dosage is small, the cost can be reduced, and regulation and control of VgR-guided related signal channels on physiological functions of crassostrea hongkongensis can be effectively influenced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to Hong Kong oysters ( Crassostrea hongkongensis In the field of physiological regulation, specifically involving a type of Hong Kong oyster. VgR Genes and their shRNA-VgR sequences and applications. Background Technology

[0002] Hong Kong Oysters ( C. hongkongensis Oysters belong to the phylum Mollusca, class Bivalvia, order Pearbilales, family Ostreidae, and genus Crassula. They are warm-water mollusks suitable for growth in nearshore waters and are a major economically farmed mollusk in the southern coastal areas of my country. Currently, the breeding of Hong Kong oyster seedlings mainly relies on two methods: semi-artificial collection of seedlings from natural sea areas and artificial seedling breeding. However, in the process of seedling breeding and germplasm improvement, there are still shortcomings in reproduction that urgently need to be addressed, such as uneven maturity of oocytes, unstable natural ovulation rate, low development efficiency of high-quality fertilized eggs, and low attachment rate of high-quality seedlings. These shortcomings seriously restrict the development of its large-scale aquaculture industry.

[0003] The protein encoded by the vitellogenin receptor (VgR) gene is a core molecule regulating the reproductive development of aquatic organisms. It participates in key physiological processes such as oocyte maturation and gonadal differentiation by mediating the uptake and transport of vitellogenin. In Pacific oysters (…),… C. gigas ), comb-scallop ( Chlamys farreri Litopenaeus vannamei ( ) Litopenaeus vannamei In various aquatic economic species, including the Hong Kong oyster, the VgR gene and its regulatory pathways have been confirmed to play an irreplaceable role in reproductive cycle regulation and fertility enhancement. Currently, regarding the Hong Kong oyster... VgR Research on the functional characteristics, regulatory mechanisms, and associations of genes with oocyte maturation and ovulation remains incomplete. There is a lack of elucidation of the molecular mechanisms underlying their reproductive limitations, and no research has yet been established based on… VgR The lack of a gene-regulated reproductive capacity enhancement technology system makes it difficult to specifically improve the reproductive performance of Hong Kong oysters at the molecular level, and also fails to provide theoretical support for its germplasm optimization.

[0004] To date, most studies using RNAi technology to explore gene function in plants and animals employ the dsRNA method. While this method can interfere with and inhibit gene expression, it requires high injection doses, expensive synthesis kits, and long required gene sequences. Due to its high cost, this method is not widely applicable in production practices. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Hong Kong oyster. VgR Genes, their shRNA-VgR sequences, and applications. This invention screens and obtains *Oyster hainanensis*. VgRGene, and found that the gene and its regulatory pathway involved in biological physiological processes, while using shRNA interference technology to develop shRNA-VgR sequence, which can specifically silence VgR The expression of the gene, so as to provide an effective tool for exploring the function and regulation mechanism of VgR gene in physiological processes of Crassostrea hongkongensis.

[0006] In order to achieve the above object, the technical scheme designed by the present application is as follows: The present application provides a kind of Crassostrea hongkongensis VgR Gene, and the nucleotide sequence is as shown in SEQ ID NO:1.

[0007] The above-mentioned gene VgR encodes protein VgR, and the amino acid sequence is as shown in SEQ ID NO:2.

[0008] The present application also provides a kind of above-mentioned gene VgR or the application of the above-mentioned protein VgR in regulating related signal pathway involved in physiological processes (such as reproductive development, growth metabolism) of Crassostrea hongkongensis.

[0009] The present application also provides a kind of recombinant PLKO.1-VgR-2 interference vector plasmid of Crassostrea hongkongensis VgR gene, the recombinant PLKO.1-VgR-2 interference vector plasmid can express shRNA-VgR sequence, and shRNA-VgR sequence includes shRNA-VgR sense strand and shRNA-VgR antisense strand;Wherein, The nucleotide sequence of the shRNA-VgR sense strand is as shown in SEQ ID NO.3; The nucleotide sequence of the shRNA-VgR antisense strand is as shown in SEQ ID NO.4.

[0010] The present application also provides a kind of above-mentioned shRNA-VgR sequence in the application of controlling the ovulation frequency and time of Crassostrea hongkongensis.

[0011] The present application also provides a kind of injection preparation for regulating physiological processes of Crassostrea hongkongensis, and the preparation includes the above-mentioned recombinant PLKO.1-VgR-2 interference vector plasmid.

[0012] The present application also provides a kind of above-mentioned injection preparation in the application in physiological processes of Crassostrea hongkongensis.

[0013] The present application also provides a kind of application of the above-mentioned injection preparation in controlling the ovulation frequency and time of Crassostrea hongkongensis, and the steps of the method are as follows: 2 to 3 years old Crassostrea hongkongensis is soaked in MgCl2 sea water for anesthesia treatment, injection is carried out through closed muscle, and cultivation is carried out after injection is completed.

[0014] Further, the injection concentration of the recombinant PLKO.1-VgR-2 interference carrier plasmid is 500 ng / µL, and the injection dose is 100 µL.

[0015] The application also provides the injection preparation as described above in screening VgR application of the gene function related to Hong Kong oysters.

[0016] Principles of the application: RNA interference (RNAi) is a sequence-specific process mainly used to interfere or silence cell gene expression. The significant active ingredient shRNA (small hairpin RNA) can be introduced into organisms through vector construction, and processed in cells to form RNA molecules with silencing function, which can specifically silence target gene expression without genetic modification. RNAi technology has been widely used in gene function research of shellfish, such as exploring the role of key genes in reproductive development and growth metabolism. The present application realizes specific silencing of VgR gene of Hong Kong oysters by constructing shRNA-VgR interference vector, and further analyzes the function thereof.

[0017] Advantages of the application: The present application screens and clones VgR gene fragments from the transcriptome of Hong Kong oysters, designs and synthesizes shRNA-VgR sequences based on the gene sequences, and successfully obtains high-purity interference vectors through steps such as PLKO.1-EGFP-Puro vector construction, enzyme digestion and ligation, and sequencing verification, thereby ensuring the specificity and stability of the interference effect.

[0018] The present application introduces shRNA-VgR into Hong Kong oysters by closed muscle injection, which has small injection dose and low cost, can effectively silence VgR gene expression, and can control reproduction, specifically including controlling ovulation frequency and time to achieve synchronization of male and female, and allowing parent oysters to ovulate in non-conventional breeding seasons. The present application can avoid the high dose and high cost defects of the dsRNA method, and is suitable for popularization and application.

[0019] The present application can systematically analyze the mechanism of VgR gene and its regulatory pathway in the physiological process of Hong Kong oysters by detecting the expression and localization changes of VgR gene after interference, the changes of key genes and key enzyme activities of related signal pathways, the morphological structure and cell apoptosis of the tissue, and the like, thereby providing theoretical basis and technical support for related researches of aquaculture of Hong Kong oysters, such as reproductive regulation and growth optimization. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 For VgR Schematic diagram of expression changes of the gene at 3D, 9D and 15D time points after shRNA interference; Figure 2Oysters from Hong Kong VgR In situ hybridization expression localization of genes at 15 days after shRNA interference; Figure 3 The expression changes of estradiol (E2) hormone concentration in Hong Kong oysters at 3D, 9D, and 15D time points after shRNA-VgR interference; Figure 4 The expression changes of progesterone (PROG) hormone concentration in Hong Kong oysters at 3D, 9D, and 15D time points after shRNA-VgR interference; Figure 5 The in situ fluorescence distribution of reactive oxygen species (ROS) in the gonadal tissue of Hong Kong oysters at 15 days after shRNA-VgR interference; Figure 6 Images of gonadal tissue sections from Hong Kong oysters at 3D, 9D, and 15D time points after shRNA-VgR interference. Figure 7 A comparative diagram showing apoptosis in the gonadal tissue of Hong Kong oysters after injection of shRNA-VgR. Detailed Implementation

[0021] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0022] Example 1: Hong Kong Oyster VgR Gene Acquisition Gonadal RNA from Hong Kong oysters was prepared and reverse transcribed to synthesize the first strand of cDNA. The resulting cDNA was designed using Oligo 7.0 software. VgR Gene-specific primers (sequences shown in Table 1, synthesized by Sangon Biotech (Shanghai) Co., Ltd.) were used to amplify Hong Kong oysters using chain polymerase reaction (PCR) technology. VgR The amino acid sequence of the protein VgR it encodes is shown in SEQ ID NO: 2: .

[0023] Table 1 VgR Gene cloning primer sequences Example 2 can interfere with and suppress VgR shRNA screening of genes According to the Hong Kong oyster transcriptome database VgR The gene fragment was constructed using the PLKO.1-VgR interference vector by Sangon Biotech (Shanghai) Co., Ltd. The company first based on VgR Gene sequence-specific shRNA targets were designed (double-stranded oligo sequences containing STEMP and loop structures, with five targets from VgR-1 to VgR-5), and corresponding oligo fragments were synthesized. The oligo fragments are shown in Table 2. The pLKO.1-EGFP-Puro vector (Sangon Biotech, no catalog number) was then linearized by double digestion with AgeI-HF / EcoRI-HF. The annealed double-stranded oligos were then ligated to the linearized vector using T4 DNA ligase (Thermo, catalog number EL0012), and transformed into Stbl3 competent cells (Sangon Biotech). Positive clones were screened and sequenced for verification. Five glycerol-containing recombinant PLKO.1-VgR interference vectors containing the correct VgR gene fragment were obtained (final glycerol concentration 25%, stored at -80℃), namely: recombinant PLKO.1-VgR-1 interference vector plasmid, recombinant PLKO.1-VgR-1 interference vector plasmid, recombinant PLKO.1-VgR-1 interference vector plasmid, recombinant PLKO.1-VgR-1 interference vector plasmid, recombinant PLKO.1-VgR-1 interference vector plasmid, and recombinant PLKO.1-VgR-1 interference vector plasmid.

[0024] Take 500 μL of each of the above 5 different glycerol bacteria and inoculate them into LB liquid medium (Sangon Biotech, catalog number A507002) containing kanamycin sulfate (Sangon Biotech, catalog number A506636). Incubate at 37°C on a shaker (Taicang Experimental Equipment Factory, model TH2-C) at 200 rpm for 16 h to revive the bacterial strains. Subsequently, 5 mL of the revived bacterial culture was transferred to 50 mL of LB liquid medium containing the same antibiotic and cultured at 37°C for 12 h to complete the expansion culture. After expansion, the bacterial culture was collected, and a small amount of plasmid was extracted using the SanPrep column plasmid mini-extraction kit (Sangon Biotech, catalog number B518131) to verify the purity (A260 / A280 ratio of 1.8~2.0). Then, the EZ-500 column plasmid mass extraction kit (Sangon Biotech, catalog number B610465) combined with DNA-EZ Reagents P liquid phase endotoxin remover (Sangon Biotech, catalog number B641718) was used to extract a large amount of plasmid and remove endotoxins, finally obtaining a high-purity PLKO.1-VgR interference vector plasmid.

[0025] Table 2 VgR Gene shRNA Oligo synthesis fragment Seventy-two healthy 2-3 year old Hong Kong oysters (approximately 12 oysters per group) were selected and divided into six groups: shRNA-VgR-1 group, shRNA-VgR-2 group, shRNA-VgR-3 group, shRNA-VgR-4 group, shRNA-VgR-5 group, and a DEPC water control group. The treatments for each group were as follows: Oysters were first anesthetized by immersing them in MgCl2 seawater. Then, they were administered the drug via adductor muscle injection: groups 1-5 received 100 μL of the corresponding shRNA-VgR interference vector plasmid at a concentration of 500 ng / μL (derived from the PLKO.1-VgR interference vector, diluted to 500 ng / μL after plasmid amplification), while the control group received 100 μL of DEPC water. After injection, all oysters were temporarily kept in culture tanks filled with normal seawater.

[0026] Forty-eight hours after injection, six oysters were randomly selected from each group, dissected, and their sex was observed under a microscope. Three female oysters were selected, and their gonadal tissues were quickly collected. Total RNA was extracted from the gonadal tissues using the Trizol method, and cDNA was synthesized by reverse transcription. The relative expression level of the VgR gene in each group was detected by real-time quantitative PCR (qRT-PCR) using the PerfectStart® Uni RT+qPCR Kit.

[0027] The results showed that the shRNA-VgR-2 group had the highest silencing efficiency and the best interference effect on the VgR gene in the gonads of Hong Kong oysters.

[0028] Example 3 The injectable formulation for regulating the physiological processes of Hong Kong oysters includes the recombinant PLKO.1-VgR-2 interference vector plasmid. This plasmid expresses the shRNA-VgR sequence, which includes both a sense strand and an antisense strand. The nucleotide sequence of the sense strand of shRNA-VgR-2 is as follows: CCGGGAAAAATGGAGAAATCAAAGATCTCTTGAATCTTTGATTTCTCCATTTTTCTTTTTTG, as shown in SEQ ID NO.3; The nucleotide sequence of the shRNA-VgR-2 antisense strand is as follows: AATTCAAAAAAGAAAAATGGAGAAATCAAAGATTCAAGAGATCTTTGATTTCTCCATTTTTC, as shown in SEQ ID NO.4.

[0029] The injection method for the above-mentioned preparation is as follows: During the breeding season, Hong Kong oysters were anesthetized by soaking in seawater with 30 g / L MgCl2. The oysters were then injected through the adductor muscle and cultured after the injection. The shRNA-VgR-2 sequence was injected at a concentration of 500 ng / µL and the injection dose was 100 µL.

[0030] Example 4: Long-term interference experiment of the above-mentioned injectable formulation on the VgR gene of Hong Kong oysters Example 2 (shRNA-VgR-1~5 target screening) revealed that the shRNA-VgR-2 group exhibited the highest silencing efficiency and best interference effect on the VgR gene in the gonads of Hong Kong oysters. Based on this, a long-term interference experiment lasting 15 days was conducted, with the specific procedures as follows: Sixty healthy 2-3 year old Hong Kong oysters were selected and randomly divided into two groups of 30 each: shRNA-VgR-2 interference group: Oysters were first anesthetized by soaking in seawater containing 35 g / L MgCl2 (the adductor muscle was relaxed). Then, 100 μL of the injection preparation (extracted by EZ-500 column plasmid large-scale extraction kit, detoxified with DNA-EZ Reagents P liquid phase endotoxin remover, and diluted with DEPC water) was injected into the adductor muscle. DEPC water control group: After anesthesia under the same conditions, 100 μL of enzyme-free DEPC water was injected through the adductor muscle.

[0031] After injection, both groups of oysters were temporarily kept in culture tanks containing normal seawater (suitable for the growth of Hong Kong oysters, without salinity stress). The water temperature was maintained at 25~28℃ and dissolved oxygen ≥5mg / L. Chlorella was fed to them regularly every day, and 1 / 3 of the seawater was replaced periodically to ensure water quality.

[0032] Three oysters were randomly selected from each group at 3, 9, and 15 days post-injection. Gonadal tissue was rapidly dissected and collected (to avoid cross-contamination), and immediately cryopreserved in liquid nitrogen for subsequent use. VgR Gene expression level detection (qRT-PCR) and analysis of key genes and enzyme activities in related signaling pathways.

[0033] Example 5: Localization and distribution of the VgR gene 15 days after long-term interference with the above-mentioned injectable formulation. Oyster gonadal tissue samples from the shRNA-VgR-2 interference group and the DEPC water control group were collected 15 days (360 h) post-injection and preserved in 4% paraformaldehyde fixative (fixed at 4°C for 24 h, then preserved in 70% ethanol). Zixi Biotechnology Co., Ltd. was commissioned to design and synthesize a specific digoxigenin-labeled probe based on the VgR gene CDS sequence (SEQ ID NO: 1). The probe information is as follows: P-VgR: 5'-TTTACAGATCTTTCCATTGATGAGGTCCCA-3' The location and distribution of the VgR gene in gonadal tissue were detected using fluorescence in situ hybridization (FISH). The experimental procedure was briefly described as follows: After dewaxing and rehydration of paraffin sections, they were digested with pepsin, pre-hybridized and blocked, and then digoxigenin-labeled P-VgR probes (final concentration of 5 ng / μL) were added and hybridized overnight at 42°C. The next day, after rigorous washing to remove non-specific bindings, the sections were incubated sequentially with anti-digoxigenin fluorescent secondary antibody and DAPI for nuclei staining. Finally, the sections were mounted with anti-fluorescence quenching mounting medium, and the images were observed and acquired using an Olympus FV3000 laser confocal microscope.

[0034] Figure 1 The results showed that the VgR gene was widely expressed in the gonadal tissue of Hong Kong oysters, and the positive signal (red fluorescence) was mainly located in germ cells. Compared with the DEPC water control group, the red fluorescence signal of the VgR gene in the gonadal tissue of the shRNA-VgR-2 interference group was significantly weakened 15 days after injection, and the quantitative analysis of fluorescence intensity showed that the difference was statistically significant. This indicates that the shRNA-VgR-2 screened in this experiment can effectively inhibit the expression of the VgR gene in the gonadal tissue of Hong Kong oysters, which is consistent with the results of qRT-PCR detection.

[0035] Example 6: Changes in VgR gene expression levels in gonadal tissue of Hong Kong oysters after long-term interference with the above-mentioned injectable formulation. The expression changes of VgR gene 15 days (360 h) after injection of shRNA-VgR-2 were detected by qRT-PCR technology to analyze the silencing effect of shRNA-VgR-2 on VgR gene (the VgR gene-specific primers used for detection can be referred to the previous cloning experiment design and synthesized by Sangon Biotech (Shanghai) Co., Ltd.).

[0036] Figure 2 This indicates that, compared with the DEPC water control group, the shRNA-VgR-2 group showed higher levels of [unclear - likely referring to a specific type of protein] in the gonadal tissue of Hong Kong oysters 15 days after injection. VgR Gene expression levels were significantly reduced; this result further validated the effectiveness of shRNA-VgR-2 interference in the previous preliminary experiments, and also demonstrated that long-term interference (15 days) mediated by shRNA-VgR-2 can stably silence the gene. VgR Gene expression analysis provides a reliable gene interference model for further analysis of the function of the VgR gene in the physiological processes of Hong Kong oysters.

[0037] Table 3. Primer sequences for quantitative real-time analysis of VgR gene shRNA-VgR-2 interference in Hong Kong oysters. Example 7: Changes in sex hormone (estradiol, progesterone) content in gonadal tissue of Hong Kong oysters after long-term interference with the above-mentioned injectable formulation. According to the ELISA testing procedure, a professional testing institution (Wuhan Fabre Biotechnology Co., Ltd.) was commissioned to detect hormone levels using corresponding kits: estradiol (E2) was detected using the shellfish estradiol (E2) ELISA research kit, and progesterone (PROG) was detected using the shellfish progesterone (PROG) ELISA research kit (both detected using an Infinite F50 enzyme-linked immunosorbent assay analyzer). The subjects were Hong Kong oyster gonadal tissues from the shRNA-VgR-2 interference group and the DEPC water control group, taken 3, 9, and 15 days after injection. Biological replicates were set up for each group, and a total of 18 samples were tested.

[0038] Test results (corresponding to hormone test analysis data): Changes in estradiol (E2) levels: The estradiol levels in the interference group at 3 days (13.13 ng / mg protein) were significantly lower than those in the control group at the same time point (55.69 ng / mg protein); the levels in the interference group at 9 days (54.95 ng / mg protein) were lower than those in the control group (76.24 ng / mg protein); and the levels in the interference group at 15 days (58.25 ng / mg protein) were still lower than those in the control group (84.12 ng / mg protein). Statistically significant differences were observed between the interference group and the control group at each time point.

[0039] Changes in progesterone (PROG) levels: The progesterone levels in the 3-day interference group (1.23~1.30 ng / mg protein) were lower than those in the control group; the levels in the 9-day interference group (1.25~1.76 ng / mg protein) showed a decreasing trend compared to the control group; and the levels in the 15-day interference group (0.85~1.83 ng / mg protein) remained at a low level, showing a significant difference from the control group.

[0040] Figure 3 The results showed that, under normal aquaculture conditions, the estradiol content in the gonadal tissue of Hong Kong oysters in the shRNA-VgR-2 interference group was consistently lower than that in the DEPC water control group at three detection time points: 3 days, 9 days, and 15 days. Furthermore, the inhibitory effect on hormone content decreased with the extension of interference time.

[0041] Figure 4 The results indicate that, under normal aquaculture conditions, the progesterone content in the gonadal tissue of Hong Kong oysters in the shRNA-VgR-2 interference group was consistently lower than that in the DEPC water control group at all three detection time points (3, 9, and 15 days). Furthermore, the inhibitory effect on hormone levels gradually increased with prolonged interference time. These results suggest that shRNA-VgR-2, by specifically silencing VgR gene expression, can significantly affect the synthesis or metabolism of sex hormones in the gonadal tissue of Hong Kong oysters, and may thus participate in regulating physiological activities related to oyster reproductive development.

[0042] Example 8: Changes in reactive oxygen species in the gonadal tissue of Hong Kong oysters after 15 days of long-term interference with the above-mentioned injectable formulation. To investigate the long-term effects of shRNA-VgR on reactive oxygen species (ROS) in the gonadal tissue of Hong Kong oysters, gonadal tissue samples were collected 15 days after interference. ROS-specific fluorescent probes (such as CellROX Deep Red) were used for staining, and ROS fluorescence signals at different time points were observed and quantified by fluorescence microscopy.

[0043] Figure 5 The study showed changes in reactive oxygen species (ROS) in the gonadal tissue of Hong Kong oysters 15 days after shRNA-VgR interference. Compared with the control group, the red fluorescence intensity of the shRNA-VgR group showed phased differences at each time point, suggesting that shRNA-VgR has a long-term regulatory effect on ROS levels in the gonadal tissue of Hong Kong oysters.

[0044] Example 9: Changes in morphology and apoptotic cell count of gonadal tissue in Hong Kong oysters after long-term interference with the above-mentioned injectable formulation. Oyster gonadal tissues from the shRNA-VgR-2 interference group and the DEPC water control group were fixed in 4% paraformaldehyde fixative for 24 hours at 3, 9, and 15 days post-injection. Following standard histological procedures, the tissues underwent dehydration (gradual dehydration from 75% to anhydrous ethanol), clearing (gradual treatment with xylene), paraffin infiltration (gradual paraffin infiltration at 60℃), and embedding. Sections were cut into 4μm thick sections using a Leica RM 2016 rotary microtome. After hematoxylin-eosin (HE) staining and mounting with neutral resin, the sections were observed and images acquired using an Olympus BX53 upright biological microscope (4X and 20X magnification).

[0045] Figure 6 The results showed that under normal aquaculture conditions, the gonadal tissue of the DEPC water control group of Hong Kong oysters had intact morphology and structure, with regular and compact cell arrangement; while the shRNA-VgR-2 interference group showed different degrees of tissue morphological changes at three time points: 3 days, 9 days, and 15 days, which were characterized by loose cell arrangement and decreased structural integrity. Moreover, the trend of change became more significant with the extension of interference time, suggesting that shRNA-VgR-2-mediated VgR gene silencing may affect the structural stability of gonadal tissue of Hong Kong oysters.

[0046] The TUNEL assay was used to detect apoptosis in gonadal tissue cells. The reagent used was the Roche Applied Science TUNEL apoptosis detection kit (catalog number 11684817910). The specific steps are as follows: After dewaxing and gradient rehydration, paraffin sections were incubated with proteinase K working solution (10~20µg / ml) at 37℃ for 30 min and washed three times with PBS. Add 50 μl of TUNEL reaction mixture (enzyme solution:fluorescein labeled solution = 1:9), incubate at 37°C in the dark for 60 min, and wash 3 times with PBS; Add 50 μl converter-POD, incubate at 37°C in the dark for 30 min, and wash 4 times with PBS; Add DAB colorimetric solution (Beijing Solarbio DA1010) and develop color at room temperature for 3-5 minutes, then rinse with tap water to stop the process. Counterstain with hematoxylin for 30 seconds, differentiate with 1% hydrochloric acid alcohol, rinse with running water to turn blue, dehydrate, clear, and mount.

[0047] The number of apoptotic cells was counted using Image Pro software (apoptotic cells appear brownish-brown), and the acquired images were observed using an Olympus BX53 microscope (4X and 20X magnification) (corresponding to the DAPI, FITC, and Merged imaging results of the control and interference groups in the Tunel group PPT).

[0048] Figure 7 The results showed that, compared with the DEPC water control group, the number of apoptotic cells in the gonadal tissue of *Oyster hainanensis* significantly increased in the shRNA-VgR-2 interference group, reaching a peak at 15 days. The overall distribution of apoptotic cells was observable at 4X magnification, and the morphology of individual apoptotic cells was clearly identified at 20X magnification. These results suggest that shRNA-VgR-2, by silencing VgR gene expression, can significantly induce apoptosis in gonadal tissue cells of *Oyster hainanensis*, and the apoptotic effect increases with prolonged interference time. In this invention, the effect of shRNA-VgR inducing gonadal cell apoptosis can precisely serve the industrial needs of large-scale breeding of Hong Kong oysters: on the one hand, by regulating the rhythm of gonadal cell apoptosis mediated by the VgR gene, the gonadal development process of parent oysters can be precisely controlled, and the timing and frequency of ovulation in female parent oysters can be precisely regulated, solving the problems of uneven gonadal maturity and unstable ovulation rate; on the other hand, by moderately inducing gonadal cell apoptosis in parent oysters during the non-breeding period, excessive gonadal development can be avoided from consuming nutrients, and at the same time, combined with the gene silencing effect, the limitations of the conventional breeding season can be broken, achieving gamete supply in a non-natural cycle.

[0049] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A Crassostrea hongkongensis VgR gene characterized in that: The nucleotide sequence of the protein VgR is shown as SEQ ID NO:

2.

2. A gene according to claim 1 VgR The encoded protein VgR, characterized by: The nucleotide sequence of the protein VgR is shown as SEQ ID NO:

2.

3. The application of the gene VgR of claim 1 or the protein VgR of claim 2 in regulating the related signal pathway involved in physiological processes.

4. A Crassostrea hongkongensis VgR A recombinant PLKO.1-VgR-2 interference vector plasmid of the gene, characterized in that: The recombinant PLKO.1-VgR-2 interference carrier plasmid can express shRNA-VgR sequence, which includes shRNA-VgR sense strand and shRNA-VgR antisense strand; wherein, The nucleotide sequence of the shRNA-VgR sense strand is shown as SEQ ID NO. 3; The nucleotide sequence of the shRNA-VgR antisense strand is shown as SEQ ID NO.

4.

5. The application of the shRNA-VgR sequence of claim 4 in controlling the ovulation frequency and time of Crassostrea hongkongensis.

6. An injectable formulation for modulating physiological processes in Crassostrea hongkongensis, characterized in that: The preparation includes the recombinant PLKO.1-VgR-2 interference carrier plasmid of claim 4.

7. The application of the injection preparation of claim 8 in physiological processes of Crassostrea hongkongensis.

8. Use of the injection formulation according to claim 6 for controlling the number and timing of ovulations in Crassostrea hongkongensis, characterized in that: The steps of the application method are as follows: The 2-3 years old Crassostrea hongkongensis are soaked in MgCl2 sea water for anesthesia treatment, and injection is performed through the adductor muscle, and after the injection is completed, the cultivation is performed.

9. Use according to claim 5, characterized in that: The injection concentration of the recombinant PLKO.1-VgR-2 interference carrier plasmid is 500 ng / µL, and the injection dose is 100 µL.

10. Use of the injectable formulation of claim 6 in screening VgR genes functionally related in Crassostrea hongkongensis.