Fusarium head blight resistance related receptor protein kinase gene as well as expression vector and application thereof

By cloning and expressing the TaRLK3-3B gene and introducing it into the wheat variety Alondra's, the problem of wheat scab resistance was solved, the disease resistance of susceptible varieties was improved, toxin contamination was reduced, and crop yield and quality were enhanced.

CN121674433APending Publication Date: 2026-03-17NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511696537.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-19
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control the occurrence and spread of wheat scab, and infected wheat varieties are severely contaminated with deoxynivalenol and other trichothecene toxins, affecting crop yield and quality.

Method used

The receptor protein kinase gene TaRLK3-3B from the highly resistant wheat variety Wangshuibai was cloned and expressed, and inserted into the expression vector pAHC25. This gene was then introduced into the susceptible wheat variety Alondra's to enhance its resistance to Fusarium head blight.

Benefits of technology

It significantly improved the resistance of susceptible wheat varieties to Fusarium head blight, reduced the incidence of the disease and toxin contamination, and enhanced crop yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674433A_ABST
    Figure CN121674433A_ABST
Patent Text Reader

Abstract

The invention discloses a gibberellic disease resistance related receptor protein kinase gene as well as an expression vector and application thereof, and belongs to the field of gene engineering. The cDNA (complementary deoxyribonucleic acid) sequence of the TaRLK3-3B is SEQ ID NO. 1, and the amino acid sequence coded by the TaRLK3-3B is SEQ ID NO. 2. The gene is inserted into an expression vector pAHC25 to obtain an overexpression vector of the gene, and the overexpression vector of the gene is introduced into an infected wheat variety, so that the resistance of the wheat variety infected with the gibberellic disease to the gibberellic disease can be remarkably improved. The TaRLK3-3B is used for genetic engineering breeding, and when the TaRLK3-3B is introduced into wheat varieties susceptible to gibberellic disease, the gibberellic disease resistance of wheat can be improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and discloses a Fusarium head blight resistance-related receptor protein kinase gene, its expression vector, and its applications. Background Technology

[0002] Fusarium head blight (FHB) is a fungal disease that affects cereal crops such as wheat and barley, as well as corn, directly causing yield reduction and quality degradation. Furthermore, harvested grains contaminated with deoxynivalenol (DON) and other trichothecene toxins can be poisonous to humans and animals if ingested. Currently, with global warming, this disease is rapidly spreading in wheat-growing regions worldwide, making the control of FHB a global challenge.

[0003] Breeding wheat varieties resistant to Fusarium head blight is the most economical and effective way to control the disease. Clarifying the resistance mechanism and cloning resistance-related genes are of significant theoretical importance for wheat disease control and for conducting disease-resistant breeding and improvement. The molecular mechanism of wheat resistance is currently a hot topic in Fusarium head blight research. The interaction between the Fusarium head blight pathogen and the host wheat is highly complex. The Fusarium head blight pathogen is saprophytic and parasitic, able to live on dead plants and also obtain nutrients from living parasites. Wheat resistance to Fusarium head blight is not race-specific but also a quantitatively inherited trait controlled by multiple genes. Analyzing gene expression during the pathogen-host interaction process helps to discover resistance genes and pathways, which is crucial for elucidating the resistance mechanism. Currently, genes or proteins related to Fusarium head blight resistance have been reported, such as various pathogenesis-related proteins, cytochrome P450, glucosyltransferases, and ABC transporters. Signaling pathways related to resistance, such as the jasmonic acid pathway and the ethylene pathway, have also been identified.

[0004] The local wheat variety Wangshuibai is widely recognized to date as having strong and stable resistance to Fusarium head blight. This study investigated the differences in gene expression profiles between Wangshuibai and its susceptible mutant NAUH117 after Fusarium head blight induction in the ears. A receptor protein kinase gene, TaRLK3-3B, was cloned from Wangshuibai and transformed into the Fusarium head blight-susceptible wheat variety Alondra's, aiming to improve Fusarium head blight resistance. Summary of the Invention

[0005] The purpose of this invention is to address the aforementioned deficiencies in the prior art by providing a receptor protein kinase gene, TaRLK3-3B.

[0006] Another object of the present invention is to provide an expression vector for the gene.

[0007] Another object of the present invention is to provide the application of the gene and expression vector.

[0008] The objective of this invention can be achieved through the following technical solutions:

[0009] The receptor protein kinase gene TaRLK3-3B is derived from the local wheat variety Wangshuibai (Triticum asetivum L.), and its nucleotide sequence is SEQ ID NO.1.

[0010] The protein TaRLK3-3B encoded by the receptor protein kinase gene has the amino acid sequence SEQ ID NO.2.

[0011] An expression vector containing the receptor protein kinase gene TaRLK3-3B.

[0012] The expression vector containing the receptor protein kinase gene TaRLK3-3B as described in claim 1 is preferably obtained by inserting the TaRLK3-3B gene as described in claim 1 between the Sma I and Sac I restriction sites of pAHC25 as the starting vector.

[0013] The application of the receptor protein kinase gene TaRLK3-3B in the construction of wheat varieties resistant to Fusarium head blight.

[0014] The application of the expression vector containing the receptor protein kinase gene TaRLK3-3B in the construction of wheat varieties resistant to Fusarium head blight.

[0015] Beneficial effects:

[0016] This invention marks the first time a receptor protein kinase gene, TaRLK3-3B, and its encoded protein, TaRLK3-3B, have been cloned from wheat, representing a first-time report in wheat. Insertion of this gene into the expression vector pAHC25, and subsequent introduction of the resulting overexpression vector into susceptible wheat varieties, enhances the resistance of these varieties to Fusarium head blight. TaRLK3-3B can be used in genetic engineering breeding; its introduction into susceptible Fusarium head blight wheat varieties can further improve wheat resistance to the disease. Attached Figure Description

[0017] Figure 1 Quantitative qRT-PCR of TaRLK3-3B in wheat spike tissues induced by Fusarium graminearum in Wangshuibai, NAUH117, Alondra's, Sumai 3, and Mianyang 8545 wheat varieties, at 0h, 24h, 48h, 72h, and 96h of Fusarium graminearum induction.

[0018] Figure 2 Construction of TaRLK3-3B overexpression vector

[0019] A: Plant expression vector pAHC25; B: Construction of pAHC25:TaRLK3-3B expression vector.

[0020] Figure 3 PCR molecular identification of TaRLK3-3B transformed T0 generation positive plants of Alondra's

[0021] Lane 1 is the DNA ladder, lane 2 is the water control, lane 3 is the untransformed Alondra's, lane 4 is the vector control containing the target gene, and lanes 5-8 are the transformed plants containing the target band.

[0022] Figure 4 qRT-PCR identification of TaRLK3-3B-transformed T0 generation positive plants of Alondra's

[0023] Figure 5 Images of Fusarium head blight symptoms in T2 generation positive plants of Alondra transformed with TaRLK3-3B.

[0024] T2-34, T2-56, T2-58, and T2-61 are identified as positive transformant plants, while Alondra's is a disease-susceptible control of the transgenic recipient wheat.

[0025] Figure 6 Results of Fusarium head blight resistance identification in T2 generation positive plants of Alondra transformed with TaRLK3-3B

[0026] T2-34, T2-56, T2-58, and T2-61 are identified positive transformant plants, while Alondra's is a disease-susceptible control of the transgenic recipient wheat. * indicates significant difference, ** indicates extremely significant difference. Detailed Implementation

[0027] Example 1: Cloning of a receptor protein kinase gene in spike tissue induced by Fusarium graminearum in *Gnaphalium affine*

[0028] Wangshuibai is a highly resistant variety to Fusarium head blight. In previous studies, our laboratory used fast neutron irradiation to screen Wangshuibai and obtained the Fusarium head blight-susceptible mutant NAUH117 (Jin xiao, Xinping Jia et al. A Fast-neutron Induced Fragment Deletion of 3BS in wheat variety Wangshuibai Increased Its Susceptibility to Fusarium Head Blight, Chromosome Research, 2011-2-18, 19:225-234.). This mutant has a partial chromosomal deletion in the 3BS region, and the deleted segment is precisely the region where the major QTL for Fusarium head blight resistance in Wangshuibai is located. In order to obtain the genes related to Fusarium head blight resistance in Wangshuibai, this invention uses wheat gene chips to screen differentially expressed genes in Wangshuibai and NAUH117 before and after inoculation with Fusarium head blight, and selects important genes for functional verification.

[0029] During the heading stage, spikelets were inoculated with *Fusarium graminearum* using the single-flower drip method. The *Fusarium graminearum* strain was isolated and cultured from naturally diseased plants in the field (for *Fusarium graminearum* collection and culture methods, see: Liu Chuanqin, Guan Shuqing, Huang Wei. Isolation, Culture and Inoculation of *Fusarium graminearum* in wheat, Modern Agriculture, 1998: 9). Water free of *Fusarium graminearum* was used as a negative control, for a total of four treatments. 24 hours after inoculation, spikelets were collected, and total RNA was extracted using TRIZOL (Invitrogen) according to the reagent instructions. Gene chip hybridization was performed (Affymetrix wheat gene expression profiling chip, part number 900515). This experiment was conducted at the Shanghai National Biochip Engineering Center. One gene was presumed to be a receptor kinase homolog, which showed upregulated expression in *Wangshui Bai* induced by *Fusarium graminearum*, significantly higher than its expression in NAUH117. This gene was selected for candidate gene cloning studies. The full-length sequence of this gene is 1002 bp, as shown in SEQ ID NO.1. Sequence analysis shows that the sequence encodes 333 amino acids (SEQ ID NO.2). Analysis using SMART software (http: / / smart.embl-heidelberg.de / ) revealed that the gene encodes an intracellular domain containing only serine / threonine protein kinase (S / TPK). Genes with this protein structure are receptor-like cytoplasmic kinases (RLCKs), and this gene is named TaRLK3-3B.

[0030] Example 2: Expression characteristics of the TaRLK3-3B gene induced by Gibberellinia spp.

[0031] Primer pairs F1 (cggcaagctcgagccaagtg) and R1 (atctgcaagccatcaacact) specifically amplifying TaRLK3-3B were used to analyze the gene induced by Gibberella fusarium. The PCR reaction was amplified and fluorescence was detected using a Roche 480 real-time quantitative PCR instrument (qRT-PCR). The 10 μL PCR reaction system contained 10 μL of 2×SYBR Green PCR Master Mix, 0.5 μM primers F1 and R1, and 1 μL of reverse transcribed cDNA template (the first strand of cDNA was synthesized as follows; all reagents were purchased from Vazyme. Add 1 μg of total RNA and 2 μL of 4×gDNA wiper Mix to a 0.2 ml eppendorf centrifuge tube to remove genomic DNA. Make up the volume to 8 μL with RNase-free sterile water. After mixing, centrifuge at 42°C for 2 min on a PCR instrument, and collect the sample by slight centrifugation. Then add 2 μL of 5×HiScriptII qRT SuperMixII to the reaction tube. Centrifuge briefly to mix, and incubate at 25°C for 10 min, 50°C for 30 min, and 85°C for 5 min on a PCR instrument. After the reaction, dilute the reaction solution 5-fold and store at -20°C for later use). The amplification parameters were: 95℃ for 10 minutes, then 95℃ for 15 seconds, 60℃ for 30 seconds, 72℃ for 1 minute, for a total of 40 cycles. After the reaction, the melting curve was measured. Gene expression levels were detected. The results showed that TaRLK3-3B was upregulated in Wangshuibai after induction by Fusarium graminearum, and the expression level was highest after 96 h; TaRLK3-3B was missing in NAUH117, so its expression could not be detected at any time before and after induction by Fusarium graminearum. In the Fusarium graminearum-susceptible wheat variety Alondra's (Li Minghao, Chen Wei, Xing Liping, et al., Establishment of genetic transformation system for common wheat variety Alondra's, Acta Botanica Sinica, 2010, 45(4): 466-471.), its expression level was much lower than that in Wangshuibai at all time points. Figure 1 The results of qRT-PCR suggest that TaRLK3-3B may be associated with resistance to Fusarium head blight.

[0032] Example 3: Construction of TaRLK3-3B expression vector and its transformation into common wheat Alondra's and identification of disease resistance.

[0033] Using the TaRLK3-3B gene gDNA from *Bletilla striata* as a template, PCR amplification was performed using primer pairs F2 (cgatctaggatccccgggatgcagcaaatggtcggtcc, SEQ ID NO.3) and R2 (tcggggaaattcgagctctcacacatcaatatttacac, SEQ ID NO.4), and the amplified fragment was recovered. The amplified product was double-digested with Sma I and Sac I, and the digested product was inserted into the Sma I and Sac I double-digested vector pAHC25 (publicly known, Christensen AH, Quail P H, Ubiquitin promoter-based vectors for high-level expression of selectable and / or screenable marker genes in monocotyledonous plants, Transgenic Research, 1996, 5: 213-218.), placing TaRLK3-3B at the multiple cloning site after the Ubi promoter, replacing the GUS gene already present in the vector. Therefore, the target gene TaRLK3-3B was cloned downstream of the strong promoter Ubi to obtain the expression vector pAHC25:TaRLK3-3B. Figure 2 ).

[0034] Approximately 2000 Alondra's immature embryo callus tissues were selected after 7 days of pre-culture. The overexpression vector pAHC25:TaRLK3-3B carrying the target gene TaRLK3-3B was transformed into Alondra's embryos using a gene gun bombardment method. Before bombardment, the embryos were pretreated on hypertonic medium (MS + ABA 0.5 mg / L + hydrolyzed casein 500 mg / L + 2,4-D 2 mg / L + glucose 30 g / L + 0.4 mol / L mannitol, pH 5.8) for 4–5 hours. After bombardment, the embryos were cultured on hypertonic medium for another 16 hours. The callus tissue was then transferred to recovery medium (1 / 2 MS + hydrolyzed casein 500 mg / L + 2,4-D 2 mg / L + sucrose 30 g / L, pH 5.8) and cultured in the dark for 2 weeks. Then it was transferred to selection medium containing herbicide (1 / 2 MS + ABA 0.5 mg / L + hydrolyzed casein 500 mg / L + 2,4-D 1 mg / L + sucrose 30 g / L + 4 mg / L Bialaphos, pH 5.8) and cultured for 2 weeks. The resistant callus tissue was then transferred to differentiation medium (1 / 2 MS + L-glutamine 1 mmol / L + hydrolyzed casein 200 mg / L + KT 1 mg / L + IAA 0.5 mg / L + sucrose 30 g / L + agar 0.8%, pH 5.8) for differentiation. When the differentiated shoots reached 2–4 cm in length, they were transferred to rooting medium (1 / 2 MS + KT 1 mg / L + sucrose 30 g / L + agar 0.8%, pH 5.8). When the regenerated seedlings reached approximately 8 cm in length and had relatively robust root systems, they were hardened off for 1–2 days. Finally, the culture medium residue carried by the roots was washed away, and the seedlings were transplanted into pots, yielding a total of 40 regenerated plants.

[0035] Genomic DNA was extracted from all regenerated plants. Transformed plants were amplified by PCR using internal primer F3 (tttagccctgccttcatacg) and promoter primer R3 (tgtactcgtagacaagcgct) to identify positive plants. PCR program: 10-50 ng / ul DNA template, 0.2 µl each of 10 µM P1 and P2; 5 µl 2×TaqMaster Mix (Vazyme), diluted to 10 µl with water. PCR conditions: 94℃ pre-denaturation for 3 min; 94℃ for 45 s, 57℃ for 45 s, 72℃ for 1 min, 33 cycles; 72℃ extension for 5 min. PCR products were detected by 1% polypropylene gel electrophoresis. Four strains amplified a 400 bp target band, numbered T0-34, T0-56, T0-58, and T0-61 (…). Figure 3 ).

[0036] RNA was extracted from all regenerated plants, and real-time quantitative PCR (qRT-PCR) analysis was performed on the TaRLK3-3B gene induced by Gibberella fusarium using primer pairs F1 (cggcaagctcgagccaagtg) and R1 (atctgcaagccatcaacact) that specifically amplify the gene. PCR reactions were amplified and fluorescence was detected using a Roche 480 real-time quantitative PCR instrument (USA). The 10 μL PCR reaction system contained 10 μL of 2×SYBR Green PCR Master Mix, 0.5 μM primers F1 and R1, and 1 μL of reverse transcribed cDNA template (the first strand of cDNA was synthesized as follows; all reagents were purchased from Vazyme. Add 1 μg of total RNA and 2 μL of 4×gDNA wiper Mix to a 0.2 ml eppendorf centrifuge tube to remove genomic DNA. Make up the volume to 8 μL with RNase-free sterile water. After mixing, centrifuge at 42°C for 2 min on a PCR instrument, and collect the sample by slight centrifugation. Then add 2 μL of 5×HiScriptII qRT SuperMixII to the reaction tube. Centrifuge briefly to mix, and incubate at 25°C for 10 min, 50°C for 30 min, and 85°C for 5 min on a PCR instrument. After the reaction, dilute the reaction solution 5-fold and store at -20°C for later use). The amplification parameters were: 95℃ for 10 minutes, then 95℃ for 15 seconds, 60℃ for 30 seconds, and 72℃ for 1 minute, for a total of 40 cycles. After the reaction, melting curves were measured to detect gene expression levels. The results showed that the gene expression was significantly upregulated in T0-61. Figure 4 ).

[0037] All positive plants were subjected to Fusarium head blight resistance assessment (Fusarium head blight resistance assessment was performed using the single-flower drip method: 10 μl of Fusarium head blight spore suspension at a concentration of 5000 spores / ml was dripped onto a small flower in the middle of a newly opened spike, the plant was bagged and kept moist for 3 days, and the bag was removed. The diseased spikelet rate was investigated 19 days after inoculation. Diseased spikelet rate = (number of diseased spikelets / total number of spikelets) × 100%). The unconverted susceptible wheat variety Alondra's, the resistant variety Wangshuibai, and the susceptible variety Alondra's (publicly known material, Pei Ziyou, Jia Gaofeng, et al., Combining ability analysis of DON content in common wheat grains, Acta Agronomica Sinica, 2007, 33(5): 731-737) were used as controls. Compared with untransformed Alondra's, transgenic T2 generation positive plants T2-34, T2-56, T2-58, and T2-61 showed significantly improved resistance to Fusarium head blight. Figure 5 and Figure 6 ).

Claims

1. Use of the receptor protein kinase gene TaRLK3-3B as shown in SEQ ID NO. 1 in constructing a wheat variety resistant to scab.

2. Use of the receptor protein kinase gene TaRLK3-3B as shown in SEQ ID NO. 1 in improving the resistance of wheat to scab.

3. Use according to claim 2, characterized in that, 3. Use of overexpressing the receptor protein kinase gene TaRLK3-3B as shown in SEQ ID NO. 1 in improving the resistance of wheat to scab.

4. Use of the recombinant expression vector containing the receptor protein kinase gene TaRLK3-3B as shown in claim 1 in constructing a wheat variety resistant to scab.

5. Use according to claim 4, characterized in that, The recombinant expression vector is obtained by inserting the TaRLK3-3B gene as shown in claim 1 into the Sma I and Sac I enzyme cutting sites of pAHC25.

6. A method of increasing resistance to Gibberella diseases in a crop, characterized in that, The recombinant expression vector as shown in claim 4 or 5 is transformed into a host crop to improve the resistance of the crop to scab.

7. The method of claim 6, wherein, The crop is wheat.