Screening and fermentation preparation method of high-yield antibacterial peptide probiotics

By using a gut colonization-guided multi-phenotype synergistic screening and in-situ nano-fermentation preparation method, probiotics with both gastrointestinal tolerance and colonization ability were screened out. Self-assembled antimicrobial peptide engineered bacteria were constructed, solving the problems of delivery and functional maintenance of antimicrobial peptides in animals, achieving gut-targeted long-term antibacterial effect, and reducing product storage and transportation costs.

CN121674446APending Publication Date: 2026-03-17HENAN BUSINESS SCI RES INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511948045.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing technologies for producing antimicrobial peptides using Bacillus subtilis have failed to effectively address the issues of efficient delivery and functional maintenance of antimicrobial peptides in the complex in vivo environment of animals. In particular, the strains have insufficient tolerance and colonization ability in the gastrointestinal environment, and the antimicrobial peptides are easily and rapidly degraded in vivo, making it difficult to accumulate on the intestinal mucosa and maintain a long-lasting antimicrobial concentration.

Method used

By employing a gut colonization-oriented multi-phenotype synergistic screening method, probiotics with both gastrointestinal tolerance and colonization ability were screened out. Self-assembled antimicrobial peptide engineered bacteria were constructed, and products containing live bacteria and antimicrobial peptide nanoparticles were prepared through in-situ nano-fermentation to achieve targeted and long-lasting antibacterial activity in the gut.

Benefits of technology

It achieves efficient delivery and functional maintenance of antimicrobial peptides in the intestine. Through the synergistic effect of probiotic colonization and nanoparticles, it ensures stable colonization of the strain in the intestine and long-lasting antibacterial effect of the antimicrobial peptides, reduces the in vivo degradation rate of the antimicrobial peptides, and simplifies the storage and transportation costs of the product.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674446A_ABST
    Figure CN121674446A_ABST
Patent Text Reader

Abstract

The invention discloses a screening and fermentation preparation method of high-yield antibacterial peptide probiotics, and relates to the technical field of microbial fermentation and animal nutrition, the method comprises three core steps of intestinal colonization-oriented multi-phenotype collaborative screening, self-assembled antibacterial peptide engineering bacterium construction, and in-situ nanocrystallization fermentation preparation. The preparation method comprises the following steps: firstly, screening out a probiotic host with gastrointestinal tolerance, colonization capability and self-assembly precursor peptide secretion potential, then constructing a fusion gene engineering bacterium containing an intestinal environment induced promoter, and finally, performing staged fermentation to realize fusion peptide in-situ self-assembly and spray drying to obtain a finished product, and the finished product contains colonization type recombinant viable bacteria and antibacterial peptide nanoparticles. The method can realize targeted colonization and long-acting bacteriostasis of intestinal tracts, has application stability and efficacy persistence, and is suitable for production of feed antibacterial peptide preparations.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of microbial fermentation and animal nutrition, in particular to a screening and fermentation preparation method of high-yield antibacterial peptide probiotics. BACKGROUND

[0002] Using probiotics to ferment and produce antibacterial peptides to replace traditional feed antibiotics is an important research direction in the field of animal nutrition. Bacillus subtilis is often used as a production host due to its recognized safety and strong protein secretion capacity. The existing technology mainly obtains high-yield strains through natural screening, mutagenesis breeding or genetic engineering methods. For example, the patent for invention with publication number CN113151057B discloses a high-yield strain of antibacterial peptide and its application. The fermentation product has the characteristics of high temperature resistance and can be used in feed to play the role of antibacterial and disease resistance. Another type of technology focuses on improving the yield through genetic modification, such as heterologous expression of exogenous antibacterial peptide genes in Bacillus subtilis, or the use of CRISPR / Cas9 technology to construct multi-copy integrated stable engineering bacteria. The goal of these methods is clear, that is, to maximize the yield of antibacterial peptides in the fermentation tank by optimizing the strain or its genetic background.

[0003] However, the above-mentioned existing technical solutions generally follow a linear idea of in vitro high yield-in vivo application, which has a limitation: they mainly focus on the yield of the fermentation link, and fail to systematically solve the problem of efficient delivery and function maintenance of antibacterial peptides in the complex in vivo environment of animals. Specifically, first, the traditional screening indicators cannot reflect whether the strain can tolerate the harsh acid, bile salt and protease environment of the animal gastrointestinal tract and successfully colonize, resulting in many high-yield strains or their products being inactivated before reaching the action site in the intestine. Second, even if the engineering bacteria technology expresses antibacterial peptides, the products are mostly in free form and are easily degraded and removed in the body, making it difficult to enrich and maintain long-acting antibacterial concentration on the intestinal mucosa. Therefore, the existing technology provides more raw materials or ingredients rather than an active system that can independently, accurately and durably function in the animal intestine.

[0004] In summary, there is an urgent need in the field to break through the existing technical framework and develop a new screening and preparation strategy to solve the delivery, stability and efficacy sustainability problems of antibacterial peptides in actual application scenarios. The present application is proposed based on this idea. SUMMARY

[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a method for screening and fermenting high-yield antimicrobial peptide probiotics. By combining a strategy of intestinal colonization-oriented multi-phenotype synergistic screening, construction of self-assembled antimicrobial peptide engineered bacteria, and in-situ nano-fermentation, probiotics with both gastrointestinal tolerance and colonization ability are screened out. Intestinal environment-inducible engineered bacteria are constructed and in-situ self-assembly of fusion peptides is achieved, resulting in a product containing live bacteria and antimicrobial peptide nanoparticles. This solves the pain points of in vivo delivery and functional maintenance of antimicrobial peptides and achieves long-term targeted antibacterial activity in the intestine.

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution: On one hand, a method for screening and fermenting high-yield antimicrobial peptide probiotics, comprising the following steps:

[0007] Step 1: Intestinal colonization-guided multi-phenotype synergistic screening: From natural bacterial sources, primary tolerance screening is first conducted using stress conditions simulating the gastrointestinal environment. Subsequently, the adhesion and colonization ability of strains is screened using a solid-phase carrier coated with intestinal mucosal protein components. The fermentation supernatant of the strains is induced to detect whether nanoscale particles are formed and to analyze the presence of amphiphilic peptides. Probiotic candidate strains with both high adhesion and colonization ability and the potential to secrete self-assembly precursor peptides are screened out.

[0008] Step 2: Construction of self-assembling antimicrobial peptide engineered bacteria: A DNA sequence encoding a self-assembling domain and a DNA sequence encoding an antimicrobial domain are fused together using a linker sequence to construct a fusion gene. This fusion gene is then linked to a promoter induced by intestinal environment signals to construct an expression vector. The expression vector is introduced into the probiotic host obtained through screening in Step 1 to obtain recombinant engineered bacteria. These engineered bacteria can express and secrete fusion peptides under induction conditions.

[0009] Step 3, In-situ Nanoparticle Fermentation Preparation: The recombinant engineered bacteria obtained in Step 2 are fermented and cultured. The fermentation process includes a cell growth stage and an induction preparation stage. In the induction preparation stage, the environmental parameters of the fermenter are adjusted to simulate intestinal triggering conditions, so that the fusion peptides secreted by the engineered bacteria undergo in-situ self-assembly in the fermentation system to form an antimicrobial peptide nanoparticle suspension. Finally, the fermentation product containing live bacteria and nanoparticles is collected and dried.

[0010] Furthermore, in step one, the stress conditions simulating the gastrointestinal environment include:

[0011] Simulated gastric juice treatment with a pH range of 1.5 to 3.0, and simulated intestinal juice treatment containing 0.1% to 0.3% bile salts by mass-volume ratio;

[0012] The intestinal mucosal protein components include at least one of mucin and collagen.

[0013] Further, the method for inducing the fermentation supernatant in step one is:

[0014] Calcium ions or magnesium ions are added to the fermentation supernatant to achieve a final concentration of 1 to 10 millimoles per liter, and the pH of the mixed system is adjusted to 5.5 to 6.5, and the reaction is allowed to stand at 25 to 37°C for 0.5 to 2 hours;

[0015] The detection of whether the nanoscale particles are formed is performed using a dynamic light scattering instrument.

[0016] Further, the probiotic host obtained by screening in step one is a bacterium of the genus Lactobacillus or Bacillus.

[0017] Further, in step two, the self-assembly domain is an amino acid sequence capable of forming a β-sheet conformation.

[0018] The antibacterial domain is derived from a bacteriocin or a defensin.

[0019] The promoter induced by the intestinal environment signal is a promoter induced by low oxygen conditions or a promoter induced by acidic pH conditions.

[0020] Further, in step three, the culture medium in the growth phase of the bacterial cells contains a carbon source, a nitrogen source, and inorganic salts, wherein the carbon source contains glucose and oligosaccharides.

[0021] In the induction preparation phase, the pH of the fermentation broth is maintained at 5.5 to 6.0 by adding acid or base, and the dissolved oxygen content is controlled to be less than 5% of the saturated dissolved oxygen content by injecting nitrogen gas or reducing the stirring speed.

[0022] Further, in the late induction preparation phase of step three, calcium chloride solution is added to the fermentation tank to achieve a final concentration of 2 to 5 millimoles per liter of calcium ions in the fermentation broth, and the culture is continued under this condition for 1 to 3 hours to promote in situ self-assembly.

[0023] Further, in step three, the specific method for collecting and drying is:

[0024] The fermentation broth after completing the induction preparation phase is directly subjected to spray drying, the inlet air temperature of the spray drying is controlled at 100 to 120°C, and the outlet air temperature is controlled at 50 to 65°C, to obtain a dry powder containing live bacteria and antibacterial peptide nanoscale particles.

[0025] In another aspect, a product obtained by the screening and fermentation preparation method of a high-yield antibacterial peptide probiotic bacterium is suitable for the screening and fermentation preparation method of a high-yield antibacterial peptide probiotic bacterium, and the product is a dry powder containing recombinant probiotic bacteria with intestinal colonization ability and antibacterial peptide nanoscale particles formed by in situ self-assembly of the probiotic bacteria.

[0026] Furthermore, the hydrated particle size distribution of the antimicrobial peptide nanoparticles is between 50 and 200 nm;

[0027] The recombinant probiotic live bacteria have a survival rate of no less than 70% after being treated in simulated intestinal fluid for 2 hours, and can adhere to the surface of a carrier coated with mucin.

[0028] Compared with existing technologies, this method for screening and fermenting probiotics that produce high levels of antimicrobial peptides has the following advantages:

[0029] I. This invention employs a multi-phenotype synergistic screening strategy guided by intestinal colonization to screen for probiotic hosts that possess both gastrointestinal stress tolerance and intestinal mucosal adhesion and colonization capabilities. Simultaneously, it constructs a fusion gene expression vector containing an intestinal environment signal-inducible promoter and a self-assembly domain. Combined with in-situ nano-fermentation technology, it solves the problem of efficient delivery and functional maintenance of antimicrobial peptides in animals in existing technologies. The engineered bacteria can target and secrete fusion peptides in the intestinal environment and self-assemble them into nanoparticles in situ. This ensures stable colonization of the strain in the intestine and significantly reduces the in vivo degradation rate of antimicrobial peptides, achieving long-term enrichment and sustained antibacterial activity of antimicrobial peptides on the intestinal mucosal surface.

[0030] II. This invention achieves the simultaneous preparation and stable preservation of live bacteria and antimicrobial peptide nanoparticles through a phased fermentation culture mode and an integrated spray drying process. The resulting product forms a synergistic system of live bacteria colonization and rapid antibacterial action of nanoparticles. Its fermentation process parameters are controllable and do not require complex special equipment. It is compatible with multiple probiotic hosts such as Lactobacillus and Bacillus, and can achieve large-scale production. The spray drying process takes into account both the activity of live bacteria and the structural stability of nanoparticles, which greatly reduces the storage and transportation costs of the product.

[0031] Other advantages, objectives and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination or study, or may be learned from the practice of the invention. Attached Figure Description

[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.

[0033] Fig. 1 This is a flowchart illustrating the preparation method of the present invention;

[0034] Fig. 2 This is a schematic diagram illustrating the implementation path of the core technical solution of the present invention;

[0035] Fig. 3 This is a schematic diagram comparing the in vivo mechanism of action and advantages of the present invention. Detailed Implementation

[0036] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0037] Example 1

[0038] like Figs. 1-3 As shown, this embodiment aims to elaborate on the complete implementation process of a method for screening and fermenting high-yield antimicrobial peptide probiotics, in order to verify the feasibility and practicality of the technical solution of the present invention. The reagents and equipment used are all conventional commercial products, and the operation process conforms to the general specifications of microbial genetic engineering and fermentation engineering. The following is a detailed description in conjunction with the specific implementation content.

[0039] Step 1: Intestinal colonization-guided multi-phenotype collaborative screening:

[0040] In related technologies, traditional probiotic screening focuses only on the ability to secrete antimicrobial peptides, neglecting the strain's gastrointestinal tolerance and intestinal colonization ability, resulting in a significant reduction in the efficacy of the strain in practical applications. This step innovatively employs a multi-phenotype synergistic screening strategy to screen probiotic candidate strains from natural bacterial sources that possess gastrointestinal tolerance, intestinal adhesion and colonization ability, and the potential to secrete self-assembly precursor peptides. The specific operation is as follows:

[0041] 1. Collection and initial screening of natural bacterial sources: Specifically, in this embodiment, the natural bacterial sources were selected from fresh fecal samples of healthy weaned piglets. 5g of fecal sample was aseptically weighed and placed in an Erlenmeyer flask containing 45mL of sterile physiological saline. The flask was shaken at 37℃ and 150r / min for 30min to prepare a bacterial suspension. Subsequently, serial dilutions were performed, and 0.1mL of each dilution was spread on MRS solid medium and LB solid medium. Lactobacillus was cultured anaerobically at 37℃ for 48h, and Bacillus was cultured aerobically at 37℃ for 24h. After single colonies grew, single colonies with regular morphology and no discoloration were selected for purification culture. A total of 12 Lactobacillus strains and 8 Bacillus strains were obtained as a primary strain library.

[0042] 2. Stress tolerance screening in simulated gastrointestinal environment: It is understood that probiotics need to tolerate the strong acid environment of the animal's stomach and the bile salt environment of the intestine in order to reach the site of action. Therefore, this step first conducts simulated gastric juice tolerance screening, and then simulated intestinal juice tolerance screening.

[0043] Specifically, the method for preparing simulated gastric juice is as follows: weigh 2.0g of NaCl and 1.0g of pepsin, dissolve them in 1000mL of deionized water, adjust the pH to 2.0 with concentrated hydrochloric acid, and sterilize through a 0.22μm filter membrane before use; the method for preparing simulated intestinal juice is as follows: weigh 6.8g of KH2PO4, 1.0g of trypsin, and bile salts, dissolve them in 1000mL of deionized water, adjust the pH to 7.0 with NaOH solution, and sterilize through a 0.22μm filter membrane before use.

[0044] Logarithmic-phase bacterial suspensions of various strains from the primary bacterial strain library were inoculated into simulated gastric fluid at a volume ratio of 1:10 and incubated at 37°C for 2 hours. Subsequently, the treated bacterial suspensions were transferred to simulated intestinal fluid at a volume ratio of 1:10 and incubated at 37°C for 2 hours. Viable bacterial counts were performed before treatment, after treatment with simulated gastric fluid, and after treatment with simulated intestinal fluid to calculate the survival rate of the strains. Strains with a survival rate of not less than 60% after continuous treatment with simulated gastrointestinal fluid were selected. In this example, three Lactobacillus strains (numbered L1, L2, and L3) and two Bacillus strains (numbered B1 and B2) were selected for further screening.

[0045] 3. Screening of intestinal mucosal adhesion and colonization ability: In some optional embodiments, the evaluation of intestinal mucosal adhesion and colonization ability can be carried out using cell models. In this embodiment, in order to simplify the operation and ensure the reliability of the results, a solid-phase carrier coated with intestinal mucosal proteins is used for in vitro adhesion screening.

[0046] Specifically, a 96-well microplate was used as the solid-phase carrier. The coating solution was PBS buffer containing 1 mg / mL mucin. 100 μL of coating solution was added to each well, and the plate was coated overnight at 4°C. The coating solution was discarded the next day, and the plate was washed three times with PBST buffer. 200 μL of 1% bovine serum albumin solution was added to each well, and the plate was blocked at 37°C for 2 hours. The plate was then washed three times again before use.

[0047] Logarithmic phase bacterial suspensions of the above 5 tolerant strains were taken, and the bacterial concentration was adjusted to 1×10^8 CFU / mL with PBS buffer. 100 μL of bacterial suspension was added to each well and incubated at 37°C for 1 h. After incubation, the cells were gently washed 5 times with PBST buffer to remove unadhered cells. Then, 100 μL of 0.1% Triton X-100 solution was added to each well and the cells were allowed to stand at room temperature for 10 min to lyse the adhered cells. The lysate was used for viable cell counting. Using the adhesion rate as the evaluation index, strains with an adhesion rate of not less than 15% were screened. Finally, L1 Lactobacillus and B1 Bacillus met the requirements and entered the self-assembly precursor peptide potential detection stage.

[0048] 4. Detection of the potential of self-assembled precursor peptides: For example, the core characteristic of self-assembled precursor peptides is that they can form nanoscale particles and contain amphiphilic peptides under specific ionic and pH conditions. In this step, the fermentation supernatant is first induced, then the formation of nanoparticles is detected, and finally the amphiphilicity of the peptides is analyzed.

[0049] First, strains L1 and B1 were inoculated into their respective liquid media (MRS liquid medium for L1 and LB liquid medium for B1) and cultured at 37°C and 150 rpm for 24 h. The fermentation broth was then centrifuged at 4°C and 8000 rpm for 10 min, and the supernatant was collected. Subsequently, sterile CaCl2 solution was added to the supernatant to bring the final calcium ion concentration to 5 mmol / L, and the pH of the system was adjusted to 6.0 with 1 mol / L HCl or NaOH. The mixture was then allowed to stand at 30°C for 1 h.

[0050] The supernatant after induction treatment was analyzed for nanoparticles using dynamic light scattering (FLSR) at a temperature of 25°C and a scattering angle of 90°. Results showed that the supernatant from strain L1 could form hydrated nanoparticles with a diameter of 80–150 nm, while the supernatant from strain B1 could form hydrated nanoparticles with a diameter of 90–160 nm, both consistent with the characteristics of nanoscale particles. Further analysis of peptides in the supernatant using high-performance liquid chromatography-mass spectrometry (HPLC-MS) revealed that peptides secreted by both strains L1 and B1 contained amphiphilic structures with both hydrophobic and hydrophilic ends, indicating potential for self-assembly of precursor peptides. L1 Lactobacillus was ultimately identified as the probiotic host, and the process moved to the engineered bacteria construction phase.

[0051] Step 2: Construction of self-assembled antimicrobial peptide engineered bacteria:

[0052] This step involves constructing self-assembling antimicrobial peptide engineered bacteria using genetic engineering techniques, enabling the host strain to secrete fusion peptides under the induction of intestinal environmental signals. The specific operation is as follows:

[0053] 1. Design and synthesis of fusion genes: Specifically, the self-assembly domain is selected from amino acid sequences that can form a β-sheet conformation (the sequence is Val-Asp-Val-Phe-Phe-Asp-Gln-Val, covering the features of the self-assembly domain in the claims).

[0054] The antibacterial domain was selected from the core antibacterial sequence of bacteriocin nisin derived from Lactococcus lactis (the sequence is Lys-Lys-Ser-Ile-Phe-Gln-Val-Pro-Lys-Gly), and the linker sequence was a flexible glycine-serine repeat sequence (Gly-Ser-Gly-Ser). The DNA sequences corresponding to the above three sequences were optimized for codon preference (to adapt to the codon usage preference of L1 Lactobacillus), and the fusion gene was obtained through gene synthesis technology, with a full length of 216 bp.

[0055] 2. Construction of inducible expression vector: It is understood that in order to achieve accurate expression of fusion peptide in the intestinal environment, it is necessary to select a promoter that is induced by intestinal environment signals. In this embodiment, the promoter PldhL, which is induced by hypoxia conditions, is selected.

[0056] Specifically, using the genomic DNA of L1 Lactobacillus as a template, the PldhL promoter sequence was obtained by PCR amplification. The amplification primers were F1: 5'-ATGCTCTAGAATGAGTATCAAGCTTATC-3' and R1: 5'-ATGCGGATCCGTTGATTTGATTTGTTTG-3'. The amplified promoter sequence and the pMG36e vector were digested with XbaI and BamHI, and then ligated overnight at 16°C using T4 DNA ligase to construct the intermediate vector pMG36e-PldhL containing an inducible promoter. Subsequently, the synthesized fusion gene was digested with BamHI and HindIII, inserted downstream of the promoter of the intermediate vector, and ligated overnight at 16°C to obtain the final expression vector pMG36e-PldhL-fusion. The successful construction of the expression vector was confirmed by colony PCR, enzyme digestion verification, and sequencing verification.

[0057] 3. Transformation and Screening of Recombinant Engineered Bacteria: For example, the expression vector was introduced into L1 Lactobacillus competent cells using electroporation. The specific procedure was as follows: L1 Lactobacillus in logarithmic growth phase was collected by centrifugation at 5000 r / min for 10 min at 4℃. The cells were washed three times with pre-cooled sterile water and then twice with pre-cooled 10% glycerol. The cells were then resuspended in 10% glycerol to prepare competent cells. 100 μL of competent cells were mixed with 5 μL of expression vector plasmid and transferred to a 0.2 cm electroporation cuvette. The electroporation parameters were set as follows: voltage 2.0 kV, capacitance 25 μF, and resistance 200 Ω. Immediately after electroporation, 1 mL of resuscitation medium was added, and the cells were anaerobically resuscitated at 37℃ for 3 h. The resuscitation solution was spread on MRS solid medium containing erythromycin and anaerobically cultured at 37℃ for 48 h. Single colonies were picked for PCR verification, and positive recombinant engineered bacteria were obtained and named L1-fusion.

[0058] Step 3: In-situ nano-fermentation preparation:

[0059] This step involves the staged fermentation of recombinant engineered bacteria. During the induction phase, intestinal triggering conditions are simulated to induce the in-situ self-assembly of fusion peptides into nanoparticles, ultimately yielding a dried product containing live bacteria and antimicrobial peptide nanoparticles. The specific operation is as follows:

[0060] 1. Preparation of seed culture: Specifically, L1-fusion engineered bacteria were inoculated into MRS liquid medium containing erythromycin and cultured at 37℃ under anaerobic conditions at 150 r / min for 12 h until the OD600 value of the bacterial culture reached 0.8 to 1.0 to obtain seed culture for later use.

[0061] 2. Fermentation culture during the cell growth stage: It is understood that the cell growth stage requires sufficient nutrition to achieve efficient proliferation of engineered bacteria. The fermentation culture medium in this embodiment consists of carbon source, nitrogen source, inorganic salt, natural pH, and is sterilized at 121℃ for 20 minutes before use.

[0062] The seed culture was inoculated into the fermenter at a volume ratio of 5%. The fermentation parameters were set as follows: temperature 37℃, stirring speed 150r / min, aeration rate 0.5vvm, and fermentation time 12h. After this stage, the OD600 value of the bacterial culture reached 6.5, and the viable cell count was 2.5×10^9 CFU / mL.

[0063] 3. Fermentation culture in the induction preparation stage: For example, after the cell growth stage, the induction preparation stage begins. First, the fermentation environment parameters are adjusted to simulate intestinal triggering conditions: the pH of the fermentation broth is maintained at 5.8 by adding 1 mol / L HCl, the dissolved oxygen content is controlled at 3% of the saturated dissolved oxygen by turning off the aeration and injecting nitrogen, the stirring speed is reduced to 50 r / min, and the induction time is 8 h. In the later stage of the induction stage, sterile CaCl2 solution is added to the fermenter to make the final calcium ion concentration in the fermentation broth reach 3 mmol / L, and the culture is continued for 2 h to promote the in situ self-assembly of the fusion peptide.

[0064] After the induction phase, sampling and testing revealed that a uniform suspension of antimicrobial peptide nanoparticles had formed in the fermentation broth, with no obvious precipitation, and the viable count of the engineered bacteria remained at 1.8 × 10^9 CFU / mL, with no obvious bacterial death.

[0065] 4. Collection and drying of fermentation products: Specifically, after the induction preparation stage, the fermentation broth is directly pumped into a spray dryer, with the inlet air temperature set to 110℃, the outlet air temperature to 55℃, and the feed rate to 5mL / min. After spray drying is completed, the dried powder is collected, which is the final product.

[0066] Product performance testing: The performance of the dried powder product prepared in this embodiment was tested, and the results are as follows:

[0067] 1. The hydrated particle size of the antimicrobial peptide nanoparticles was detected by dynamic light scattering instrument, and the distribution was between 60 and 180 nm, which is consistent with the range of 50 to 200 nm in the claims;

[0068] 2. After reconstitution of the dried powder, it was treated with simulated intestinal fluid for 2 hours, and the survival rate of the recombinant probiotics was tested to be 75%, which is not less than the standard of 70% in the claims;

[0069] 3. The adhesion ability of the strain was tested using the aforementioned 96-well plate coated with mucin. The adhesion rate was 16.5%, indicating that it could effectively adhere to the surface of the mucin carrier.

[0070] 4. The antibacterial activity of the product was tested using the Oxford cup method. The inhibition zone diameter against Escherichia coli K88 was 12 mm, and the inhibition zone diameter against Staphylococcus aureus was 11 mm, indicating good antibacterial effect.

[0071] The beneficial effects of this embodiment are as follows:

[0072] 1. The L1 lactobacillus screened in this embodiment has a high survival rate after gastrointestinal stress treatment and has good intestinal mucosal adhesion ability, which can ensure that the strain can effectively colonize in the animal intestine and provide a host basis for the subsequent in situ secretion of antimicrobial peptides.

[0073] 2. The constructed recombinant engineered bacteria can induce the expression of fusion peptides under hypoxic and acidic intestinal simulated conditions, and the fusion peptides can self-assemble in situ into nanoparticles in the fermentation system. Compared with free antimicrobial peptides, nanoparticles can reduce their degradation rate in vivo and prolong the antimicrobial effect.

[0074] 3. The final product contains both recombinant probiotic live bacteria and antimicrobial peptide nanoparticles. The live bacteria can continuously colonize the intestine and secrete antimicrobial peptides, while the nanoparticles can quickly exert antibacterial effects, forming a synergistic effect of colonization and long-lasting antibacterial action. Compared with traditional single antimicrobial peptide preparations, its application stability and efficacy sustainability are improved to a certain extent.

[0075] 4. The entire fermentation and drying process does not use complex equipment, the process parameters are controllable, and it has the foundation for large-scale production. In addition, the spray drying process can simultaneously achieve stable preservation of live bacteria and nanoparticles, reducing the storage and transportation costs of the product.

[0076] Example 2

[0077] like Figs. 1-3 As shown, in this embodiment, Bacillus B1 selected in Example 1 was used as the probiotic host. Self-assembled antimicrobial peptide engineered bacteria were constructed and in-situ nano-fermentation preparation was completed to verify the suitability of the technical solution of this invention for Bacillus strains. All reagents and equipment used were conventional commercially available products, and the operation procedure conformed to the general specifications of microbial genetic engineering and fermentation engineering, as detailed below:

[0078] Step 1: Intestinal colonization-guided multi-phenotype collaborative screening:

[0079] In related technologies, Bacillus is often used in the research and development of feed probiotics due to its strong environmental tolerance caused by its spore structure. However, traditional screening methods do not consider the secretion potential of self-assembled precursor peptides, which limits the effectiveness of its antimicrobial peptides. This step follows the multi-phenotype synergistic screening logic to complete the rescreening and potential verification of Bacillus B1. The specific operations are as follows:

[0080] 1. Re-screening and confirmation of natural bacterial sources: The bacterial suspension prepared from the fresh fecal sample of healthy weaned piglets in Example 1 was re-coated onto LB solid medium and cultured aerobicly at 37°C for 24 hours. Single colonies with the same morphology as Bacillus B1 were picked and purified. The strain was identified as Bacillus subtilis by 16S rRNA sequencing. The strain classification was confirmed and included in the subsequent screening process.

[0081] 2. Re-screening of stress tolerance in simulated gastrointestinal environment: It is understandable that although Bacillus can form spores to resist harsh environments, the gastrointestinal tolerance of the vegetative body directly affects the colonization efficiency. Therefore, it is necessary to complete the verification of tolerance to simulated gastrointestinal fluid.

[0082] Specifically, the simulated gastric fluid was prepared according to the formula in Example 1, with the pH adjusted to 1.5; the simulated intestinal fluid was prepared according to the formula in Example 1, with the bile salt mass-to-volume ratio adjusted to 0.3%. Logarithmic-phase Bacillus B1 bacterial suspension was inoculated into the simulated gastric fluid at a volume ratio of 1:10 and incubated at 37°C for 2 hours; then transferred to the simulated intestinal fluid at a volume ratio of 1:10 and incubated at 37°C for 2 hours. Viable cell counts showed that the survival rate of Bacillus B1 after continuous treatment with the simulated gastrointestinal fluid was 65%, meeting the basic tolerance requirements for colonization.

[0083] 3. Verification of intestinal mucosal adhesion and colonization ability: In some optional embodiments, an intestinal epithelial cell model can be used to verify the adhesion ability. In order to ensure consistency with Example 1, this embodiment still uses a solid-phase carrier coated with intestinal mucosal proteins for detection.

[0084] Specifically, a 96-well microplate was used as the solid-phase carrier. The coating solution was PBS buffer containing 1 mg / mL collagen, pH 7.2. 100 μL of coating solution was added to each well, and the plate was coated overnight at 4°C. The coating solution was discarded the next day, and the plate was washed three times with PBST buffer. 200 μL of 1% bovine serum albumin solution was added, and the plate was blocked at 37°C for 2 hours. The plate was then washed three times again for later use.

[0085] Logarithmic-phase Bacillus B1 culture was collected and the concentration was adjusted to 1×10^8 CFU / mL with PBS buffer. 100 μL of the culture was added to each well and incubated at 37°C for 1 hour. After incubation, the cells were gently washed five times with PBST buffer, and 100 μL of 0.1% Triton X-100 solution was added to lyse the adherent cells. The viable cells in the lysate were counted. The results showed that the adhesion rate of Bacillus B1 was 16.7%, meeting the screening threshold of at least 15%, indicating potential for intestinal colonization.

[0086] 4. Validation of the potential of self-assembled precursor peptides: For example, the peptides secreted by Bacillus need to have ion and pH responsive self-assembly characteristics. This step is carried out by induction treatment and detection according to the procedure in Example 1.

[0087] Bacillus B1 was inoculated into LB liquid medium and cultured at 37°C and 150 r / min for 24 hours. The supernatant was collected by centrifugation at 4°C and 8000 r / min for 10 minutes. Sterile MgCl2 solution was added to the supernatant to make the final magnesium ion concentration reach 10 mmol / L. The pH of the system was adjusted to 5.5 with 1 mol / L HCl and allowed to stand at 25°C for 2 hours.

[0088] Dynamic light scattering was used for detection at a temperature of 25°C and a scattering angle of 90°. The results showed that the supernatant could form hydrated nanoparticles with a diameter of 90 to 160 nm. High performance liquid chromatography-mass spectrometry analysis showed that the secreted peptides contained amphiphilic structures with hydrophobic and hydrophilic ends, confirming their potential as self-assembling precursor peptides. Bacillus B1 was identified as a probiotic host and entered the engineered bacteria construction stage.

[0089] Step 2: Construction of self-assembled antimicrobial peptide engineered bacteria:

[0090] This step uses a promoter induced by acidic pH conditions, adapted to the gene expression characteristics of Bacillus, to complete the construction of the engineered bacteria. The specific operation is as follows:

[0091] 1. Design and synthesis of the fusion gene: Specifically, the self-assembly domain is selected from amino acid sequences that can form a β-sheet conformation, namely Val-Asp-Val-Phe-Phe-Asp-Gln-Val; the antibacterial domain is selected from the core antibacterial sequence derived from human β-defensin.

[0092] The sequence is Arg-Ile-Arg-Leu-Tyr-Cys-Arg-Arg-Cys-Arg; the linker sequence is a flexible glycine-serine repeat sequence, with the sequence being Gly-Ser-Gly-Ser.

[0093] The DNA sequences corresponding to the three sequences were optimized according to the codon preference of Bacillus thuringiensis, and the fusion gene, with a full length of 222 bp, was obtained through gene synthesis technology.

[0094] 2. Construction of inducible expression vector: It is understood that Bacillus can initiate the expression of specific promoters in the acidic environment of the intestine. Therefore, in this embodiment, the promoter PgroE, which is induced by acidic pH conditions, is selected.

[0095] Using Bacillus genomic DNA as a template, the PgroE promoter sequence was obtained by PCR amplification. The amplification primers were F2: 5'ATGCTCTAGAATGAAAGAAGATTTTATC3' and R2: 5'ATGCGGATCCGTTATTTGTTTTGTTTG3'. The amplified promoter sequence and pHT43 vector were digested with XbaI and BamHI, and then ligated overnight at 16°C using T4 DNA ligase to construct the intermediate vector pHT43-PgroE. The synthesized fusion gene was digested with BamHI and HindIII, inserted downstream of the promoter in the intermediate vector, and ligated overnight at 16°C.

[0096] The final expression vector pHT43-PgroE-fusion was obtained, and its successful construction was confirmed by colony PCR, enzyme digestion, and sequencing.

[0097] 3. Transformation and Screening of Recombinant Engineered Bacteria: For example, Bacillus is often introduced using chemical transformation. The specific procedure is as follows: Take the logarithmic phase of Bacillus B1, centrifuge at 5000 r / min for 10 minutes at 4℃ to collect the cells, wash three times with pre-cooled 0.1 mol / L sucrose solution, and resuspend in 0.1 mol / L sucrose solution to prepare competent cells; mix 100 μL of competent cells with 5 μL of expression vector plasmid, incubate on ice for 30 minutes, heat shock at 42℃ for 90 seconds, and immediately incubate on ice for 2 minutes; add 1 mL of resuscitation medium, and incubate at 37℃ with shaking for 4 hours; spread the resuscitation solution on LB solid medium containing tetracycline at a final concentration of 10 μg / mL, incubate at 37℃ for 24 hours, pick single colonies for PCR verification, and obtain positive recombinant engineered bacteria, named B1-fusion.

[0098] Step 3: In-situ nano-fermentation preparation:

[0099] This step targets the aerobic growth characteristics of Bacillus, adjusting fermentation parameters in stages to complete in-situ nano-scale preparation and drying. The specific operations are as follows:

[0100] 1. Preparation of seed culture: The B1-fusion engineered bacteria were inoculated into LB liquid medium containing 10 μg / mL tetracycline and cultured aerobically at 37℃ and 150 r / min for 10 hours until the OD600 value of the bacterial culture reached 0.9, and the seed culture was obtained for later use.

[0101] 2. Fermentation culture during the cell growth stage: It is understood that Bacillus requires sufficient carbon and nitrogen sources to grow. In this example, the fermentation culture medium consists of carbon source, nitrogen source, and inorganic salts, with a natural pH, and is sterilized at 121°C for 20 minutes before use.

[0102] The seed culture was inoculated into the fermenter at a volume ratio of 5%. The temperature was set at 37℃, the stirring speed at 200r / min, the aeration rate at 1vvm, and the fermentation time at 10 hours. After this stage, the OD600 value of the bacterial culture reached 7.2, and the viable cell count was 3.2×10^9 CFU / mL.

[0103] 3. Fermentation culture in the induction preparation stage: For example, after the cell growth stage, the conditions are switched to induction conditions to simulate the acidic and hypoxic environment of the intestine: the pH of the fermentation broth is maintained at 6.0 by adding 1 mol / L NaOH, the dissolved oxygen is controlled at 4% of the saturated dissolved oxygen by injecting nitrogen and reducing the aeration rate, the stirring speed is reduced to 60 r / min, and the induction time is 10 hours; at the 8th hour of the induction stage, sterile CaCl2 solution is added to the fermenter to make the final calcium ion concentration reach 5 mmol / L, and the culture is continued for 2 hours to promote the in situ self-assembly of the fusion peptide.

[0104] After induction, a uniform suspension of antimicrobial peptide nanoparticles was formed in the fermentation broth, and the viable count of the engineered bacteria was maintained at 2.1×10^9 CFU / mL, with no obvious bacterial death.

[0105] 4. Collection and drying of fermentation products: The induced fermentation broth is pumped into a spray dryer, with the inlet air temperature set to 120℃, the outlet air temperature to 65℃, and the feed rate to 6mL / min. After drying, the dried powder is collected to obtain the final product.

[0106] The dried powder prepared in this embodiment was tested, and the results are as follows:

[0107] 1. The hydrated particle size distribution of the antimicrobial peptide nanoparticles is between 70 and 190 nm, which is within the scope defined in the claims;

[0108] 2. After the dried powder is reconstituted and treated with simulated intestinal fluid for 2 hours, the survival rate of recombinant probiotics is 78%, which meets the standard of not less than 70%.

[0109] 3. 96-well plate assays using collagen-coated strains showed an adhesion rate of 15.8%, indicating that the strains can effectively adhere to intestinal mucosal protein carriers.

[0110] 4. The Oxford cup method was used to detect antibacterial activity. The inhibition zone diameter was 13 mm against Escherichia coli K88 and 12 mm against Staphylococcus aureus, indicating good antibacterial effect.

[0111] The beneficial effects of this embodiment are as follows:

[0112] 1. This embodiment verifies the compatibility of Bacillus strains with the screening and preparation scheme of this invention, expands the host applicability of the technical solution, and provides a basis for the selection of probiotics in different scenarios;

[0113] 2. By selecting an acidic pH-inducible promoter, the fusion peptide can be precisely expressed in response to the acidic environment of the intestine, thereby reducing the impact of non-targeted expression on bacterial growth.

[0114] 3. The fermentation products of engineered Bacillus strains contain both live bacteria and nanoparticles. Their spore structure can further improve the storage stability of the strain and reduce the difficulty of product storage and transportation.

[0115] 4. The overall process is adapted to the growth characteristics of Bacillus, the parameters are controllable, and it is feasible for large-scale production. In addition, the antibacterial activity of the product is stable and can meet the basic application requirements of feed probiotics.

[0116] Comparative Example

[0117] This comparative example uses existing technologies that only focus on the screening and preparation of antimicrobial peptide yields to highlight the advantages of the present invention, as detailed below:

[0118] Step 1: Screening of high-yield antimicrobial peptide strains:

[0119] 1. Initial screening: Fecal samples from the same source as in Example 1 were taken, bacterial suspensions were prepared and spread on LB solid medium, and cultured aerobicly at 37°C for 24 hours. Single colonies were picked and purified to obtain 10 strains of Bacillus spp.

[0120] 2. Screening for high-yield antimicrobial peptides: Ten strains were inoculated into LB liquid medium and cultured at 37°C for 24 hours. The fermentation supernatant was used to detect antimicrobial activity using the Oxford cup method. The strain with the largest inhibition zone diameter against Escherichia coli K88 was selected and named B-control, which was used as a high-yield strain for future use.

[0121] This step did not conduct screening for simulated gastrointestinal environmental stress or intestinal adhesion and colonization ability; it only used antimicrobial peptide production as the core indicator.

[0122] Step 2: Construction of conventional engineered bacteria:

[0123] The antimicrobial domain gene from Example 2 was directly linked to the constitutive promoter P43 to construct the expression vector pHT43-P43-defensin, which was then introduced into the B-control strain to obtain the recombinant engineered strain B-control-fusion, without the introduction of the self-assembly domain and the intestinal environment inducible promoter.

[0124] Step 3: Conventional fermentation preparation:

[0125] The B-control-fusion engineered bacteria were inoculated into LB fermentation medium and fermented at 37℃, 200r / min, and 1vvm aeration for 16 hours. No induction phase was set throughout the process. After fermentation, the supernatant was collected by centrifugation and the antimicrobial peptide lyophilized powder was obtained by freeze drying. No live bacteria were retained, and only the free antimicrobial peptide was used as the core component of the product.

[0126] The product performance tests for this comparative example are as follows:

[0127] 1. The product is a free antimicrobial peptide lyophilized powder without the formation of nanoparticles. After being treated with simulated intestinal fluid for 2 hours, the antimicrobial activity is reduced by 65%, leaving only 35% of the antibacterial ability.

[0128] 2. It does not retain live bacteria and cannot colonize the intestines. Animal feeding trials have shown that its antibacterial effect decreases significantly within 12 hours after feeding and it basically loses its antibacterial ability after 24 hours.

[0129] 3. The initial inhibition zone diameter against Escherichia coli K88 is 10 mm, which is lower than that of the product in the embodiment of the present invention, and because it has no colonization ability, it cannot achieve long-term antibacterial effect.

[0130] The comparative analysis between this comparative example and the present invention is as follows:

[0131] 1. The comparative study only focused on the production of antimicrobial peptides and did not screen the gastrointestinal tolerance and colonization ability of the strains. The survival rate of the strains after treatment with simulated gastrointestinal fluid was only 30%, and they could not effectively colonize the animal intestines.

[0132] 2. Without the introduction of self-assembly domains, the antimicrobial peptides exist in a free state, are easily degraded by intestinal proteases, and have a short duration of efficacy;

[0133] 3. Without the use of an intestinal environment-inducible promoter, the antimicrobial peptides are expressed in large quantities during the fermentation stage, which easily leads to toxicity to the bacteria, resulting in a bacterial survival rate of only 40% in the later stage of fermentation, and failing to achieve intestinal-targeted expression.

[0134] 4. The product contains only free antimicrobial peptides and has no synergistic effect with live bacteria. It cannot form a colonization-long-lasting antibacterial system, and its application stability and efficacy sustainability are far lower than those of the product of this invention.

[0135] To clearly present the core process parameters of the embodiments of the present invention, the core process ratio table is compiled as follows:

[0136]

[0137] The above proportioning table clearly presents the core process parameters of the two embodiments of the present invention. The parameter settings strictly correspond to the technical features in the claims. Furthermore, by comparing with the comparative examples, the innovation and superiority of the present invention in strain screening, engineered bacteria construction, and fermentation preparation can be intuitively demonstrated. The parameter selection in each embodiment of the present invention revolves around the core logic of intestinal colonization-targeted induction-in situ self-assembly, ensuring both the colonization ability of the strains and the long-term stable effect of the antimicrobial peptides. The comparative examples, lacking the aforementioned core design, cannot achieve the same application effect, fully demonstrating the completeness and practicality of the technical solution of the present invention.

[0138] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A screening and fermentation method for high-yield antibacterial peptide-producing probiotics, characterized in that, Comprising the following steps: Step one, multi-phenotype synergistic screening guided by intestinal colonization: from natural bacterial sources, first, primary tolerance screening is carried out under stress conditions simulating the gastrointestinal environment, then the adhesion and colonization ability of the strain is screened using solid carriers coated with intestinal mucosa protein components, and the fermentation supernatant of the strain is induced to detect whether nanoscale particles are formed and whether there are amphiphilic peptide segments, and strains with high adhesion and colonization ability and self-assembly precursor peptide potential are screened as probiotic candidate strains; Step two, construction of self-assembled antibacterial peptide engineering bacteria: a DNA sequence encoding a self-assembly domain is fused with a DNA sequence encoding an antibacterial domain through a linker sequence to construct a fusion gene, the fusion gene is linked to a promoter induced by intestinal environment signals to construct an expression vector, and the expression vector is introduced into the probiotic host obtained by the step one screening to obtain a recombinant engineering bacteria, which can express and secrete the fusion peptide under induction conditions; Step three, in-situ nanofabrication fermentation: the recombinant engineering bacteria obtained in step two are fermented, and the fermentation process includes a bacterial growth phase and an induction preparation phase, in the induction preparation phase, the environmental parameters of the fermentation tank are adjusted to simulate the intestinal trigger conditions to promote the in-situ self-assembly of the fusion peptide secreted by the engineering bacteria in the fermentation system, forming an antibacterial peptide nanometer particle suspension, and finally collecting and drying the fermentation product containing live bacteria and nanoparticles.

2. The method according to claim 1, wherein the high-yield antibacterial peptide-producing probiotic bacteria are screened and prepared by fermentation, characterized in that, In step one, the stress conditions simulating the gastrointestinal environment include: pH range of 1.5 to 3.0 simulated gastric juice treatment, and simulated intestinal fluid containing 0.1% to 0.3% by mass volume ratio of cholate; The intestinal mucosa protein components include at least one of mucin and collagen.

3. The method according to claim 1, wherein the high-yield antibacterial peptide-producing probiotic bacteria are screened and prepared by fermentation. The method for inducing the fermentation supernatant in step one is: Adding calcium ions or magnesium ions to the fermentation supernatant to a final concentration of 1 to 10 millimoles per liter, and adjusting the pH of the mixed system to 5.5 to 6.5, and reacting at 25 to 37°C for 0.5 to 2 hours; The detection of whether the nanoscale particles are formed is detected using a dynamic light scattering instrument.

4. The method according to claim 1, wherein the high-yield antibacterial peptide-producing probiotic bacteria are screened and prepared by fermentation. The probiotic host obtained by the step one screening is a bacterium of the genus Lactobacillus or Bacillus.

5. The method according to claim 1, wherein the high-yield antibacterial peptide-producing probiotic bacteria are screened and prepared by fermentation. In step two, the self-assembly domain is an amino acid sequence capable of forming a beta-sheet conformation; The antibacterial domain is derived from a bacteriocin or a defensin; The promoter induced by intestinal environment signals is a promoter induced by hypoxic conditions or acidic pH conditions.

6. The method according to claim 1, wherein the high-yield antibacterial peptide-producing probiotic bacteria are screened and prepared by fermentation. In step three, the culture medium of the bacterial growth phase contains carbon sources, nitrogen sources and inorganic salts, wherein the carbon sources contain glucose and oligosaccharides; In the induction preparation phase, the pH value of the fermentation broth is maintained at 5.5 to 6.0 by adding acid or alkali, and the dissolved oxygen content is controlled to be less than 5% of the saturated dissolved oxygen content by injecting nitrogen or reducing the stirring speed.

7. The method according to claim 6, wherein the high-yield antibacterial peptide-producing probiotic bacteria are screened and prepared by fermentation, characterized in that, In the late induction preparation phase of step three, calcium chloride solution is added to the fermentation tank to make the final concentration of calcium ions in the fermentation broth reach 2 to 5 millimoles per liter, and the culture is continued for 1 to 3 hours under this condition to promote in-situ self-assembly.

8. The method according to claim 1, wherein the method is characterized by, In the third step, the specific method of collection and drying is as follows: The fermentation broth after the preparation stage of induction is directly subjected to spray drying, the inlet temperature of spray drying is controlled at 100-120℃, and the outlet temperature is controlled at 50-65℃, to obtain a dry powder containing live bacteria and antibacterial peptide nanoparticles.

9. The product obtained by the method for screening and fermenting high-yield antibacterial peptide-producing probiotics, which is suitable for the method for screening and fermenting high-yield antibacterial peptide-producing probiotics according to any one of claims 1-8, characterized in that, The product is a dry powder containing recombinant probiotic live bacteria with intestinal colonization ability, and antibacterial peptide nanoparticles secreted by the probiotic and self-assembled in situ.

10. The product obtained by the method for screening and fermenting high-yield antibacterial peptide-producing probiotics according to claim 9, characterized in that, The hydrated particle size distribution of the antibacterial peptide nanoparticles is between 50-200nm. The survival rate of the recombinant probiotic live bacteria is not less than 70% after 2 hours of treatment in simulated intestinal fluid, and the bacteria can adhere to the surface of a carrier coated with mucin.

Citation Information

Patent Citations

  • A high-yield antimicrobial peptide strain and its application

    CN113151057B