Cladosporium fulvum gene engineering bacterium with high yield of protohypericin as well as construction method and application of cladosporium fulvum gene engineering bacterium

Abstract

The invention discloses a cladosporium fulvum genetically engineered bacterium with high yield of protohypericin as well as a construction method and application of the cladosporium fulvum genetically engineered bacterium. According to the cladosporium fulvum genetically engineered bacterium constructed by the invention, a hygromycin resistance gene hph is introduced into cytochrome P450 enzyme RugGT452P-R160D, and short-chain dehydrogenase ClaC, dehydratase ClaB and anthrone oxidase ClaH2 genes in cladosporium fulvum ACCC37291 are knocked out and replaced; meanwhile, the copy number of a transcription factor ClaE and a transcription auxiliary factor ClaA gene is increased, so that the genetically engineered bacterium is obtained. The strain is cultured for 10 days under the conditions that the temperature is 22 DEG C, the speed is 300 rpm and the ventilation capacity is 2 vvm, and the original hypericin fermentation yield reaches 2.06 g / L. The cladosporium fulvum genetically engineered bacterium constructed by the invention can be used for efficiently preparing the protohypericin through a fermentation method and is environment-friendly.

Description

Technical Field

[0001] This invention belongs to the field of microbial and molecular biology application technology, specifically relating to a genetically engineered strain of Cladosporium that produces high levels of prohyperitone, its construction method, and its application. Background Technology

[0002] Hypericin is a dianthrone compound mainly isolated from St. John's wort, a plant in the Clusiaceae family. Its molecular formula is C64-C ... 30 H 16 O8, with a molecular weight of 504.44, possesses excellent pharmacological effects, including antidepressant, antiviral, and antitumor activity. However, hypericin has a low content in plants (0.01%-0.47%), leading to insufficient extraction supply (J. Chinese Pharm. Sci. 2012, 21, 388–400). Chemical synthesis methods involve numerous steps and low yields (Nat. Prod. Commun. 2007, 2, 67–70); cell suspension culture technology also results in low yields and long cycles (In Vitro Cell. Dev. Biol.-Plant 2002, 38, 58–65). These production methods significantly limit research on the mechanism of action and drug-likeness of hypericin. Therefore, how to prepare such compounds in a green and efficient manner is a key scientific issue in ensuring the supply of traditional Chinese medicine resources. Studies have found that the P450 monooxygenase RugG can catalyze the production of prohypericin (50.2 mg / L) from emodin dianthrone, which can then spontaneously oxidize to hypericin under visible light (Angew. Chem. Int. Ed. 2022, 61(8), e202114919). Prohypericin is a key precursor in hypericin synthesis, and RugG is a key enzyme in the prohypericin biosynthetic pathway. Currently, the reported yield of hypericin remains low, making it difficult to meet practical applications. Summary of the Invention

[0003] The purpose of this invention is to provide a genetically engineered *Cladosporium chrysogenum* strain that produces high levels of protohyperin, along with its construction method and applications. The technical solution of this invention represents the highest yield of protohyperin produced through fermentation currently available.

[0004] To achieve the above objectives, this invention provides a genetically engineered *Cladosporium chrysogenum* strain that produces high levels of prohypercarpine, along with its construction method and applications. The specific technical solution is as follows: A method for constructing a genetically engineered *Cladosporium chrysogenum* strain that produces high levels of prohypertylin, wherein the genetically engineered *Cladosporium chrysogenum* strain contains the RugG gene, which is encoded by a cytochrome P450 enzyme mutant. T452P-R160DThe transcription factor ClaE and transcription cofactor ClaA were overexpressed; at the same time, the short chain dehydrogenase ClaC, dehydratase ClaB, ​​and anthrone oxidase ClaH2 were knocked out. The nucleotide sequence of the gene encoding the cytochrome P450 enzyme mutant is shown in SEQ ID NO.2, and / or, The NCBI sequence number of the gene encoding the transcription factor ClaE is XM_047912054.1, and / or, The NCBI sequence number of the gene encoding the transcriptional cofactor ClaA is XM_047912055.1, and / or, The NCBI sequence number of the gene encoding the short-chain dehydrogenase ClaC is XM_047912058.1, and / or, The NCBI sequence number of the ClaB dehydrase encoding gene is XM_047912057.1, and / or, The NCBI sequence number of the anthrone oxidase ClaH2 encoding gene is XM_047912056.1.

[0005] Preferably, the nucleotide sequence of the gene encoding the cytochrome P450 enzyme mutant is shown in SEQ ID NO.2; the NCBI sequence number of the gene encoding the transcription factor ClaE is XM_047912054.1; the NCBI sequence number of the gene encoding the transcription cofactor ClaA is XM_047912055.1; the NCBI sequence number of the gene encoding the short-chain dehydrogenase ClaC is XM_047912058.1; the NCBI sequence number of the gene encoding the dehydratase ClaB is XM_047912057.1; and the NCBI sequence number of the gene encoding the anthrone oxidase ClaH2 is XM_047912056.1.

[0006] The origin strain of the genetically engineered *Cladosporium chrysogenum* is *Cladosporium chrysogenum*. Cladosporium fulvum ACCC37291.

[0007] The method for constructing the *Cladosporium xanthosporium* genetically engineered bacterium includes the following steps: amplifying the coding gene for the cytochrome P450 enzyme mutant, the coding gene for the transcription factor ClaE, the coding gene for the transcription cofactor ClaA, the upstream homologous arm of the ClaC coding gene, and the downstream homologous arm of the ClaH2 coding gene; cloning these genes into a plasmid vector to obtain a recombinant plasmid; introducing this plasmid into the starting bacterium; and obtaining the *Cladosporium xanthosporium* genetically engineered bacterium through homologous recombination. Preferably, the coding gene for the cytochrome P450 enzyme mutant uses a hygromycin resistance gene. hph Introduction. A hygromycin resistance gene was inserted at the knockout site. hphThe gene encoding the cytochrome P450 enzyme mutant RugG T452P-R160D Transcription cofactors ClaA and ClaE. More preferably, the insertion gene linking order is as follows: ClaC encodes the upstream homologous arm of the gene – hygromycin resistance gene. hph - Cytochrome P450 enzyme mutant encoding gene - Transcription cofactor ClaA encoding gene - Transcription factor ClaE encoding gene - Downstream homologous arm of ClaH2 encoding gene. The upstream homologous arm of the ClaC encoding gene is formed by primer U- hph -F / U- hph -R amplification was obtained, and the downstream homologous arm of the ClaH2 encoding gene was obtained by primer D- hph -F / D- hph The primer sequences obtained by -R amplification are as follows: U- hph -F:CCGAATTAATTCGGGGCTCGAGTTAAGAGGATTAAAATTGAAC; U- hph -R: CTCCTTCAATATCATCTTCTGAGCAAAGAAGGAGAGTGGATC; D- hph -F: TGCTCCCCCGATGATAGCCATA; D- hph -R:GTTTAATTCCCGATCTAGTAACCGGCAATGGTATGCGCCAGAAC.

[0008] The plasmid vector is a binary expression vector, preferably the pCAMBIA1391Xa plasmid.

[0009] Secondly, the present invention provides a genetically engineered *Cladosporium chrysogenum* strain obtained by the construction method described in the first aspect.

[0010] Thirdly, this invention provides a genetically engineered strain of *Cladosporium chrysogenum*, which is classified and named as follows: hph hph The strain number is XM08, the accession number is CCTCC NO: M 2025969, the accession date is May 6, 2025, and it is deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China.

[0011] Fourthly, the present invention provides the application of the second or third aspect in the fermentation production of protohyperin by genetically engineered strains of Cladosporium chrysogenum.

[0012] The *Cladosporium chrysogenum* genetically engineered bacteria are inoculated into a fermentation medium and fermented at 20-26°C for 6-13 days to obtain prohypercarpine. Preferably, the frozen *Cladosporium chrysogenum* genetically engineered bacteria are activated on a solid plate medium; then inoculated into a fermentation medium to obtain a seed culture; the seed culture is then transferred to the fermentation medium for further fermentation. More preferably, the seed culture conditions are 20-26°C, shaken at 100-200 rpm for 5-9 days; after transferring the seed culture to the fermentation medium, the fermentation speed is 100-300 rpm, and the aeration rate is 0.5-5 vvm.

[0013] Preferably, the method for extracting the protohyperin from the fermentation broth is as follows: filtering the fermentation broth, extracting the filtrate with an equal volume of ethyl acetate 2-4 times, extracting the mycelium with ethyl acetate 2-4 times, combining the extracts and purifying them by rotary evaporation under reduced pressure to obtain protohyperin.

[0014] The fermentation medium comprises 20-100 g / L of carbon source and 10-30 g / L of nitrogen source; the carbon source comprises glucose and / or maltose; and the nitrogen source comprises yeast extract. Preferably, the fermentation medium is based on PDB medium with the addition of 20 g / L glucose, 30 g / L maltose, and 10 g / L yeast extract.

[0015] Beneficial effects: Based on protein-directed evolutionary modification and transcriptional regulation strategies, this invention knocks out and replaces *Cladosporium chrysogenum*. hph hph The genes for the short-chain dehydrogenase ClaC, dehydratase ClaB, ​​and anthrone oxidase ClaH2 in ACCC 37291 utilize the RugG gene mutant with higher catalytic activity. T452P-R160D Furthermore, by increasing the copy number of a transcriptional regulatory gene (ClaE and ClaA), a novel method for constructing a genetically engineered strain of Cladosporium that produces high levels of hypericin was proposed, with the aim of significantly increasing hypericin yield and reducing production costs.

[0016] Compared with existing technologies, the beneficial effects of this invention are as follows: First, the fermentation culture medium in the method of this invention includes potato, glucose, maltose, and yeast extract, whose raw materials are inexpensive and readily available, which is conducive to its widespread application. Second, the culture medium provided by this invention ferments *Cladosporium xanthosporium* genetically engineered bacteria, which can significantly increase the yield of protohyperin in this culture medium, reducing the difficulty of subsequent separation and purification. The highest yield of protohyperin can reach 2.06 g / L. Attached Figure Description

[0017] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0018] hph pCAMBIA1391Xa- hph - hph - hph T452P-R160D Plasmid map.

[0019] hph pCAMBIA1391Xa- hph - hph - hph T452P-R160D hph - hph Plasmid map.

[0020] hph It is a fungus called Cistanche deserticola. hph A schematic diagram of homologous recombination constructed using strain XM08.

[0021] hph The image is an electrophoresis diagram for gene verification. From left to right, lane 1 is the 5000 Marker, lanes 2-7 are the XM08 strain, and lanes 8-13 are the WT strain.

[0022] hph The time progression curves of the products in a 5 L fermenter are shown, where pHyp is protohyperin, Hyp is hyperinin, and EB is emodin dianthrone.

[0023] hph This is a high-resolution mass spectrum of protohyperin.

[0024] hph This is the ultraviolet spectrum of the original hypericin. Detailed Implementation

[0025] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. After reading the present invention, any modifications of the present invention in various equivalent forms by those skilled in the art will fall within the scope defined by the appended claims.

[0026] The following examples describe Cladosporium chrysogenum hph ACCC 37291, purchased from the China Agricultural Microbial Culture Collection Center.

[0027] In the following examples, the NCBI sequence number of the gene encoding the short-chain dehydrogenase ClaC is XM_047912058.1, the NCBI sequence number of the gene encoding the dehydratase ClaB is XM_047912057.1, the NCBI sequence number of the gene encoding the anthrone oxidase ClaH2 is XM_047912056.1, the NCBI sequence number of the gene encoding the transcription factor ClaE is XM_047912054.1, and the NCBI sequence number of the gene encoding the transcription cofactor ClaA is XM_047912055.1.

[0028] Example 1 Recombinant plasmid hph - hph - hph T452P-R160D hph - hph Construction This example illustrates *Cladosporium chrysogenum*. hph - hph - hph T452P-R160D hph - hph The method for constructing genetically engineered bacteria includes the following steps: (1) Using pCAMBIA1391Xa plasmid and the resistance gene hygromycin ( hph Using the nucleotide sequence shown in SEQ ID NO.1 as a template, primers were designed. hph -F / hph The hygromycin fragment was amplified by -R and then recombined in vitro with the pCAMBIA1391Xa plasmid to construct pCAMBIA1391Xa- containing the hygromycin resistance gene. hph Plasmid, design primers pCAMBIA1391Xa-F / pCAMBIA1391Xa-R from pCAMBIA1391Xa- hph A hygromycin resistance gene fragment containing the pCAMBIA1391Xa homologous arm was amplified from the plasmid.

[0029] (2) With Cladosporium hph Using the genome of ACCC 37291 as a template, primers U- were designed. hph -F / U- hph -R amplification hph upstream homologous arm of the gene, design primer D- hph -F / D- hph -R amplification hph Downstream homologous arm of the gene.

[0030] (3) with hph Gene (cytochrome P450 gene, NCBI Accession: QZS37287, derived from...)hph Using YE3016 as a template, primer pYET- was designed. hph -F / pYET- hph -R, amplifies the amplification of the amplified arm. hph Fragment; using the vector pYET (a vector for heterologous expression in yeast, containing the ADH2P promoter and ADH2T terminator, tryptophan-deficient, ampicillin-resistant, and preserved in this laboratory) as a template, primers pYET-WK-F / pYET-WK-R were designed to amplify the linearized plasmid pYET. (The fragment contains homologous arms.) hph In vitro recombination of fragments and linearized plasmid pYET to construct plasmid pYET- hph Using plasmid pYET- hph Using the template, primers T452P-F / T452P-R and R160D-F / R160D-R were designed to construct a mutant. hph T452P-R160D mutant plasmid pYET- hph T452P-R160D Using plasmid pYET- hph T452P-R160D Design primers using templates. hph T452P-R160D -F / hph T452P-R160D -R amplifies the ADH2P- hph T452P-R160D The -ADH2T gene fragment has a pCAMBIA1391Xa homologous arm at one end and a hygromycin resistance gene homologous arm at the other end. The mutant described herein... hph T452P-R160D The nucleotide sequence is shown in SEQ ID NO.2, and the ADH2P- hph T452P-R160D The nucleotide sequence of the -ADH2T gene fragment is shown in SEQ ID NO.3.

[0031] (4) The hygromycin resistance gene fragment containing the pCAMBIA1391Xa homologous arm amplified in (1) above, and the fragment amplified in (2) hph upstream homologous arms of genes and hph The downstream homologous arm of the gene is amplified in (3) ADH2P- hph T452P -R160D The ADH2T fragment, along with four other fragments and the linearized pCAMBIA1391Xa plasmid, was recombined in vitro using the ClonExpress MultiS OneStep Cloning Kit (Vazyme Biotech). Each fragment was arranged according to the pCAMBIA1391Xa vector... hphUpstream homologous arm of the gene - hygromycin resistance gene fragment - hph T452P-R160D Gene fragments - hph The sequence of the gene's downstream homologous arm-plasmid pCAMBIA1391Xa vector was followed to construct the pCAMBIA1391Xa- vector. hph - hph - hph T452P-R160D Plasmids. Plasmid maps are shown below. hph As shown, the insertion site of the target fragment is located 532 bp upstream of the kanamycin resistance gene fragment in the plasmid, at a non-specific restriction site.

[0032] (5) With Cladosporium chrysogenum hph Using the genome of ACCC 37291 as a template, primers were designed. hph -TDH3 P -F / hph -TDH3 P -R amplification hph Genes, primer design hph -GAP P -F / hph -GAP P -R amplification hph Gene.

[0033] Using plasmid pRS403 (containing promoter TDH3 and terminator CYC1) and pY26-TEF-GAP (a high-copy expression vector of Saccharomyces cerevisiae containing promoters TEF1, GAP, ADH1, and CYC1, which respectively initiate the expression of two target genes) as vectors, plasmid pRS403- was reconstructed in vitro. P TDH3 - hph - T CYC1 With plasmid pY26- P GAP - hph - T CYC1 .

[0034] With plasmid pRS403- P TDH3 -claA- T CYC1 Design primers using templates. hph F / hph R, amplification yields a result with one end bearing... hph The other end has a gene homology arm. hph T452P-R160D Gene homologous arms P TDH3 hphCYC1 Gene fragments.

[0035] With plasmid pY26- P GAP -claE- T CYC1 Design primers using templates. hph F / hph R, amplification yields a result with one end bearing... hph The gene homology arm has a pCAMBIA1391Xa homology arm at the other end. P GAP hph CYC1 Gene fragments.

[0036] (6) Using the pCAMBIA1391Xa- constructed above hph - hph - hph T452P-R160D Using plasmids as templates, primers were designed. hph - hph - hph T452P-R160D -F / hph - hph - hph T452P-R160D -R, perform amplification, and compare the amplified gene fragment with the homologous arm described in (5). hph Gene fragments and hph The gene fragment underwent three-segment in vitro recombination to obtain a recombinant plasmid with the following ligation sequence: hph Upstream homologous arm of the gene, hygromycin resistance gene fragment, ADH2P- hph T452P-R160D -ADH2T 、P TDH3 - hph - T CYC1 , P GAP - hph - T CYC1 Finally connect hph Downstream homologous arms of the gene, plasmid construction map as follows hph As shown, pCAMBIA1391Xa- was successfully constructed. hph - hph - hph T452P-R160D - hph Plasmid.

[0037] The primer sequences (5'-3') used in this embodiment are as follows: hph-F: CAGAAGATGATATTGAAGGAGC; hph -R: GGATCCTCTAGAAAGAAGGATTACC; pCAMBIA1391Xa-F: GTTACTAGATCGGGAATTAAAC; pCAMBIA1391Xa-R: CTCGAGCCCCGAATTAATTCGGCGTTAATTCAG; U- hph -F:CCGAATTAATTCGGGCTCGAGTTAAGGATTAAATTTGAAC; U- hph -R: CTCCTTCAATATCATCTTCTGAGCAAAGAAGGAGAGTGGATC; D- hph -F: TGCTCCCCCGATGATAGCCATA; D- hph -R:GTTTAATTCCCGATCTAGTAACCGGCAATGGTATGCGCCAGAAC; pYET-WK-F: ATGATGGTATTACGATATAGTTAATAGTTG; pYET-WK-R: GTTTAAACATGCCTTCACGATTTATAGTTTCC; pYET- hph -F: TCGTAATACCATCATATGGACCTGAACTCGCAGGA; pYET- hph -R: AAGGCATGTTTAAACTTAAGCCTTCTCCCTAGGAACATAC; T452P-F: CTGCCCAGGCATGAGATGGGCGAAGTTGCAGC; T452P-R: ATCTCATGCCTGGGCAGGGGTGACGACCCGCG; R160D-F: TCTTCCAGACGTAACCAGAGACGCTCGCGCTG; R160D-R: TGGTTACGTCTGGAAGACGCTTTGTGAGCTGT; hph T452P-R160D-F: CTTCTTTCTAGAGGATCCGCTGGAGCTCGGATCCATTTAG; hph T452P-R160D -R: CTATCATCGGGGGAGCAGCGAATTGGGTACCCTCGAGG; hph -TDH3 P -F: CACACATAAACAAACAAAATGAGCGACAGCCTTGCCGGC; hph -TDH3 P -R: CATAACTAATTACATGATCAACTACGAAAGCTGAAAGGCCAAT; hph -GAP P -F: CACCAGAACTTAGTTTCGAATGTCCCTGTCACGCAGCGTGG; hph -GAP P -R: GATCCACTAGTTCTAGAATCCGTCACAGATTCTTCAGAC; hph F: CTGCTCCCCCGATGATAGATAAAAAACACGCTTTTTCAGTTCG; hph R: CGAGTATTGATAATGAGCAAATTAAAGCCTTCGAGCG; hph F: AAGGCTTTAATTTGCTCATTATCAATACTCGCCATTTCA; hph R: CACTGTACAAGTTATGGGCAAATTAAAGCCTTCGAGC; hph - hph - hph T452P-R160D -F: CCATAACTTGTACAGTGATAGAGAAAG; hph - hph - hph T452P-R160D -R: CTATCATCGGGGGAGCAGCG。

[0038] Example 2: Cladosporium hph - hph- hph T452P-R160D hph - hph Construction of genetically engineered bacteria Using the conventional Agrobacterium-mediated method, the recombinant plasmid pCAMBIA1391Xa- hph - hph hph - hph T452P-R160D - hph The cells were transformed into Agrobacterium AGL1 competent cells, and single clones were picked to obtain Agrobacterium-positive transformants. The Agrobacterium-positive transformants were cultured using standard methods to obtain bacterial culture.

[0039] Induction and screening were performed using a co-culture method of Agrobacterium and Cladosporium: First, the successfully verified recombinant plasmid pCAMBIA1391Xa- was introduced into the culture. hph - hph - hph T452P-R160D - hph Positive AGL1 strains were cultured at 28 °C in LB medium with corresponding resistance. The bacterial cells were collected by centrifugation and added to IM medium (K2HPO4·3H2O 2.6854 g / L, KH2PO4 1.45 g / L, NaCl 0.15 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.01 g / L, FeSO4·7H2O 0.0025 g / L, (NH4)2SO4 0.5 g / L, glucose 2 g / L, glycerol 0.5%), pH 5.8. The bacterial suspension was cultured until OD500 reached. 600 Approximately 0.25. *Cladosporium chrysogenum* cultured for an appropriate time was washed with sterile water. hph ACCC 37291 spores were filtered through four layers of lens paper to remove mycelia and impurities, resulting in a concentration of 1×10⁻⁶. 7 Spores / mL spore suspension. Equal volumes of the two suspensions were mixed and incubated at 22 °C for 48 h. The mixture was then plated onto PDA plates containing hygromycin and cefixime resistance for screening, and incubated at 22 °C for approximately 14 days. After new transformants emerged, single colonies were picked for genome extraction and verification. Successfully verified single colonies were transferred to screening plates for amplification, preserved in glycerol, and recombinant bacteria were obtained, achieving homologous recombination. Among them, *Cladosporium xanthophora*... hph A schematic diagram of homologous recombination on the genome is shown below. hph As shown.

[0040] With Cladosporium hph ACCC 37291 was the originating strain (WT). Positive transformant verification was performed using the knockout identification primer Diag-Δ. hph-F / Diag-Δ hph -R identification revealed that recombinant bacteria... hph Non-specific bands in the lane (see) hph swimming lane hph ),prove hph Gene knockout successful; Diag-Δ primer used for knockout identification. hph -F / Diag-Δ hph -R identification revealed that recombinant bacteria... hph The absence of specific bands in the lanes proves... hph Gene knockout successful (see) hph swimming lane hph ); to identify primer Diag- hph -F / Diag- hph -R identification revealed that recombinant bacteria... hph The appearance of specific bands in the lanes proves... hph Insertion successful (see) hph swimming lane hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph hph ); to identify primer Diag- rugG -F / Diag- rugG -R identification revealed that recombinant bacteria... rugG The appearance of specific bands in the lanes proves... rugG T452P-R160D Insertion successful (see) Figure 4 swimming lane rugG T452P-R160D and rugG ); to identify primer Diag-TDH3 P - class A -F / Diag-TDH3 P - class A -R identification revealed that recombinant bacteria... class A Specific bands appeared in the swim lanes, while no bands were observed in the wild type (knockout primers were only targeted at introducing specific promoters and terminators). class A Gene fragments, for the wild-type strain itself class A (The gene fragment has no effect), proving that... class A Insertion successful (see) Figure 4 ); to identify primer Diag-GAP P - class -F / Diag-GAP P - class -R identification revealed that recombinant bacteria... class The appearance of specific bands in the lanes proves that... class Insertion successful (same principle) class A Verification, see Figure 4 ); the genetically engineered strain of Cladosporium chrysogenum ΔclaC - ΔclaB-ΔclaH2 - rugGT452P-R160D - classA-classE Named *Cladosporium chrysogenum* Cladosporium fulvum XM08 is deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M2025969, located at Wuhan University, Wuhan, China, on May 6, 2025.

[0041] In addition, this embodiment also uses the recombinant plasmid pCAMBIA1391Xa- ΔclaC - ΔclaB-ΔclaH2 - rugG T452P -R160D Insert into *Cladosporium chrysogenum* using the method described above. Cladosporium fulvum Intermediate recombinant strains were obtained from the ACCC 37291 genome.

[0042] The primer sequences (5'-3') used in this embodiment are as follows: Diag- ΔclaC -F: GCTGTCCATCTTGGCCGGC; Diag- ΔclaC -R:AAAGACTCGATCGAATTCCTCTTC; Diag- hp -F:CAGAAGATGATATTGAAGGAGC; Diag- hp -R:ATTTGTCTCAACTCCGGAGCTG; Diag- ΔclaH2 -F: ATGGCGGAACCACGATCTTTC; Diag- ΔclaH2 -R:GTACAAGTATAGACCGCAGATAC; Diag- rugG -F:ATGGACCTGAACTCGCAGGATTTT; Diag- rugG -R:TTAAGCCTTCTCCCTAGGAACATAC; Diag-TDH3 P - class A -F: ATAAAAAACACGCTTTTTCAGTTC; Diag-TDH3 P - class A -R: GCAAATTAAAGCCTTCGAGC; Diag-GAP P - class-F: TCATTATCAATACTCGCCATTTC; Diag-GAP P - class -R: TCACAGATTCTTCAGACGATC.

[0043] Example 3: Genetically engineered strain of Cladosporium leucosus Cladosporium fulvum XM08 Method for producing protohypericin Using PDA solid culture medium, take the medium that has been frozen at -80 ℃. Cladosporium fulvum The XM08 strain was cultured at 22 ℃ for 6-9 days for the first activation. Then, the strain was activated twice more using the same method to obtain the strain after three generations of activation. Cladosporium fulvum strain XM08.

[0044] Fermentation medium preparation method: Prepare PDB medium and add 20 g / L glucose, 10 g / L yeast extract and 30 g / L maltose. Place it in an autoclave and sterilize at 115 ℃ for 30 min.

[0045] Take the activated 3rd generation Cladosporium fulvum The XM08 strain was inoculated into the sterilized and cooled fermentation medium and cultured at 22 ℃ and 180 rpm for 7-8 days to obtain the seed culture. 10% (v / v) of the seed culture was inoculated into 3 L of fermentation medium and cultured in a 5 L fermenter at 22 ℃, 300 rpm, and an aeration rate of 2 vvm for 6 days. 1% v / v Tween-80 was added, and the culture was continued for 10-13 days to obtain the fermentation broth. The protohyperin content in the fermentation broth was determined by liquid chromatography (see method described above). Angew. Chem. Int. Ed. 2022, 61(8), e202114919), converted to the actual content in the fermentation broth using a standard curve, the content of protohyperin was highest on day 10 of fermentation, reaching 2.06 g / L (see Figure 5 The fermentation broth at which the protohypocyanidin yield was highest was filtered, and the filtrate was extracted three times with an equal volume of ethyl acetate. The mycelium was also extracted three times by soaking in ethyl acetate. The extracts were combined and purified by rotary evaporation under reduced pressure to obtain protohypocyanidin. Analysis using high-resolution mass spectrometry with a negative ion source (see...) Figure 6 ): HR-ESI-MS [MH] - m / z 505.0921 has been confirmed to have the molecular formula C 30 H 18 O8 (C) 30 H 17The calculated value of O8 is 505.0923; the ultraviolet absorption spectrum shows that the compound forms a large conjugated system through the benzene ring and the exocyclic double bond, with two relatively large absorption peaks at 370 nm and 540 nm (see Figure 7 Based on the high-resolution mass spectrometry and ultraviolet spectroscopy data mentioned above, it was confirmed that the product was protohyperin.

[0046] The genetically engineered strain of Cladosporium constructed in this invention ΔclaC - ΔclaB-ΔclaH2 - rugG T452P-R160D - classA-classE ( Cladosporium fulvum The highest yield of protohyperin produced by fermentation of XM08 reached 2.06 g / L, significantly higher than the yield of the intermediate recombinant strain constructed in Example 2. Furthermore, compared with previous literature ( Angew. Chem. Int. Ed. Reported in 2022, 61(8), e202114919) ΔclaM-rugG Compared with the original hypericin fermentation yield of 50.2 mg / L, the yield of the strain was increased by 41 times; the fermentation raw materials are simple and readily available, and the product content is high.

[0047] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing a genetically engineered strain of Cladosporium sphaeroides with high production of proanthracene, characterized in that, The Cladosporium fulvum engineered strain is inserted with a cytochrome P450 enzyme mutant coding gene, overexpresses a transcription factor ClaE coding gene and a transcription auxiliary factor ClaA coding gene, and knocks out a short-chain dehydrogenase ClaC coding gene, a dehydrase ClaB coding gene and an anthrone oxidase ClaH2 coding gene.

2. The construction method of claim 1, wherein, The nucleotide sequence of the cytochrome P450 enzyme mutant coding gene is shown as SEQ ID NO. 2, and / or, The NCBI sequence number of the transcription factor ClaE coding gene is XM_047912054.1, and / or, The NCBI sequence number of the transcription auxiliary factor ClaA coding gene is XM_047912055.1, and / or, The NCBI sequence number of the short-chain dehydrogenase ClaC coding gene is XM_047912058.1, and / or, The NCBI sequence number of the dehydrase ClaB coding gene is XM_047912057.1, and / or, The NCBI sequence number of the anthrone oxidase ClaH2 coding gene is XM_047912056.

1.

3. The construction method of claim 1, wherein, The said genetically engineered Clonostachys rosea strain, wherein the starting strain is Clonostachys rosea Cladosporium fulvum ACCC 37291.

4. The construction method of claim 1, wherein, The construction method specifically comprises the following steps: amplifying a cytochrome P450 enzyme mutant coding gene, a transcription factor ClaE coding gene, a transcription auxiliary factor ClaA coding gene, a ClaC coding gene upstream homologous arm and a ClaH2 coding gene downstream homologous arm, cloning into a plasmid vector to obtain a recombinant plasmid; introducing into a starting strain to obtain the Cladosporium fulvum engineered strain through homologous recombination.

5. The construction method according to claim 4, characterized in that, The plasmid vector comprises a binary expression vector.

6. The Cladosporium fulvum engineered strain obtained by the construction method in any one of claims 1-5.

7. A genetically engineered fungus of Cladosporium cladosporioides, which is classified as Cladosporium cladosporioides and has a strain number XM08 and a preservation number CCTCC NO: M 2025969, and was preserved on May 6, 2025. Cladosporium fulvum , a strain number XM08, a preservation number CCTCC NO: M 2025969, and a preservation date of May 6, 2025.

8. The use of the Cladosporium fulvum engineered strain in claim 6 or 7 in the fermentation production of protoanemonin.

9. Use according to claim 8, characterized in that, The Cladosporium fulvum engineered strain is inoculated into a fermentation medium and fermented at 20-26 ℃ for 6-13 days to obtain protoanemonin.

10. Use according to claim 9, characterized in that, The fermentation medium comprises 20-100 g / L of a carbon source and 10-30 g / L of a nitrogen source; the carbon source comprises glucose and / or maltose; and the nitrogen source comprises yeast extract.

Images