Method for distinguishing biological activities of different GLP-1 analogues

Abstract

The invention discloses a method for distinguishing biological activities of different GLP-1 analogues. According to the method, liraglutide and semeglutide can be effectively distinguished, tilpotide and HISHS-2001 can be effectively distinguished, accurate matching of treatment requirements, optimization of a medication scheme, promotion of drug research and development and innovation and improvement of clinical medication safety are facilitated, and the application prospect is wide.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a method for distinguishing the biological activity of different GLP-1 analogs. Background Technology

[0002] Glucagon-like peptide-1 (GLP-1) is an intestinal-derived polypeptide hormone in the human body. It specifically acts on the GLP-1 receptor (GLP-1R), triggering a GLP-1R-mediated signaling cascade, thereby stimulating insulin secretion in a glucose concentration-dependent manner and exerting its hypoglycemic function. To overcome the short half-life of natural GLP-1 in vivo, numerous GLP-1 analogs have been marketed, including liraglutide, the world's first daily formulation of human natural GLP-1, and smegglutide, the first weekly formulation.

[0003] Clinical studies have shown that different GLP-1 analogs differ; for example, smegglutide has a better effect on lowering blood sugar and reducing weight than liraglutide. However, there is currently no reported in vitro activity assay method that can distinguish the activity of different GLP-1 analogs. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, the present invention provides a method for distinguishing the bioactivity of different GLP-1 analogs.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A first aspect of the present invention provides a method for detecting / distinguishing the bioactivity of GLP-1 analogs, the method comprising: diluting the drug with serum-free medium / 10% FBS, co-culturing it with cells, and then performing the detection. The GLP-1 analogues include one or more of smegglutinin, liraglutinin, vepenaenate, esupragglutinin α, telpogglutinin, and HISHS-2001. The distinction between GLP-1 analogs includes distinguishing liraglutide from smegglutide and / or distinguishing telposide from HISHS-2001.

[0006] Furthermore, serum-free culture medium was used to distinguish liraglutide from smegglutide.

[0007] Furthermore, 10% FBS culture medium was used to distinguish telpoeptide from HISHS-2001.

[0008] Furthermore, the cells include one or more of GLP-1R-luc / 293 cells, GIPR-Luc / 293 cells, or GLP1R / GIPR-luc-293 cells.

[0009] Furthermore, the serum-free culture medium is a serum-free culture medium containing L-glutamine.

[0010] Furthermore, the 10% FBS culture medium is a DMEM culture medium containing 10% FBS.

[0011] Furthermore, the initial drug concentration for distinguishing liraglutide from smegglutide is 100-300 nmol·L⁻¹. -1 .

[0012] Furthermore, the initial drug concentration used to distinguish liraglutide from smegglutide is 200 nmol·L⁻¹. -1 .

[0013] Furthermore, the drug dilution factor to distinguish liraglutide from smegglutide is 4-6 times.

[0014] Furthermore, the drug dilution factor to distinguish liraglutide from smegglutide is 6-fold dilution.

[0015] Furthermore, the initial drug concentration that distinguishes telpotetide from HISHS-2001 is 25-100 nmol·L⁻¹. -1 .

[0016] Furthermore, the initial drug concentration that distinguishes telpotetide from HISHS-2001 is 25 nmol·L⁻¹. -1 .

[0017] Furthermore, the drug dilution factor that distinguishes telpolide from HISHS-2001 is 4-6 times.

[0018] Furthermore, the drug dilution factor that distinguishes telpolide from HISHS-2001 is 4-fold dilution.

[0019] Furthermore, the incubation time of the method is 5-6 hours.

[0020] A second aspect of the present invention provides a system for distinguishing the bioactivity of GLP-1 analogs, the system comprising the culture medium and cells described in the first aspect of the present invention. The distinction between GLP-1 analogs includes distinguishing liraglutide from smegglutide and / or distinguishing telposide from HISHS-2001.

[0021] Furthermore, the system also includes a reference sample.

[0022] A third aspect of the present invention provides a product for distinguishing the bioactivity of GLP-1 analogs, the product comprising the system described in the second aspect of the present invention.

[0023] Furthermore, the product includes a reagent kit.

[0024] Furthermore, the kit also includes a luciferase substrate.

[0025] Furthermore, the kit also includes an instruction manual.

[0026] Advantages and beneficial effects of the present invention: The method described in this application can effectively distinguish between liraglutide and smegglutide, and between telposide and HISHS-2001, which helps to accurately match treatment needs, optimize medication regimens, promote drug research and development innovation, and improve the safety of clinical medication, and has broad application prospects. Attached Figure Description

[0027] Figure 1 This is a screening diagram of GLP-1R-luc / 293 cells; Figure 2 This is a screening diagram of GIPR-luc / 293 cells; Figure 3 This is a diagram showing the optimization of the method conditions for detecting GLP-1 analog drugs in GLP-1R-luc / 293 cells in serum-free culture medium. Among them, 3A is the diagram of the single clone with the highest screening response value, 3B is the diagram of the initial concentration optimization, 3C is the diagram of the dilution factor optimization, and 3D is the diagram of the cell seeding and drug dosing time interval optimization. Figure 4 This is a diagram showing the optimization of the method conditions for detecting telposide activity in GIPR-luc / 293 cells and GLP1R / GIPR-luc-293 cells in serum-free culture medium. In this diagram, 4A is the optimization diagram of the initial concentration for detecting telposide activity in GIPR-luc / 293 cells, and 4B is the optimization diagram of the initial concentration for detecting telposide activity in GLP1R / GIPR-luc-293 cells. Figure 5 This is a comparison of the results of detecting the activities of various GLP-1 analog drugs in GLP-1R-luc / 293 cells in medium containing 10% FBS and serum-free medium. Among them, 5A-B are the results of detecting GLP-1, smegglutinin and liraglutinin in GLP-1R-luc / 293 cells in medium containing 10% FBS and serum-free medium, respectively. 5C-D are the results of detecting vepenadine and esopagglutinin α in GLP-1R-luc / 293 cells in medium containing 10% FBS and serum-free medium, respectively. Figure 6 The figures show the activity comparison results of two GLP1R / GIPR dual agonists, telpoeptide and HISHS-2001, in GLP1R / GIPR-luc-293 cells in different culture media. Among them, 6A is the activity comparison result in medium containing 10% FBS, and 6B is the activity comparison result in serum-free medium. Detailed Implementation

[0028] The following provides definitions for some of the terms used in this specification. Unless otherwise stated, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0029] This invention provides a method for detecting / distinguishing the biological activity of GLP-1 analogs, the method comprising: diluting the drug with serum-free culture medium, co-culturing it with cells, and then performing the detection.

[0030] In some embodiments, this application uses the luciferase reporter gene assay to detect / distinguish the biological activity of GLP-1 analogs. Luciferase is derived from bioluminescent organisms in nature and is a general term for a class of enzymes that can catalyze the oxidation of luciferin or fatty aldehydes to produce light in organisms.

[0031] Luciferase reporter gene assays are an important tool in modern molecular biology research for analyzing the interactions between potential cis-elements (such as promoters, enhancers, and silencers) and trans-acting factors in flanking regions of structural genes. The luciferase reporter gene system is a reporter system that uses luciferin as a substrate to detect the activity of firefly luciferase. Luciferase catalyzes the oxidation of luciferin to oxyluciferin, during which bioluminescence is emitted, which is then measured using a chemiluminescence analyzer or liquid scintillation analyzer.

[0032] This invention provides a system for distinguishing the biological activity of GLP-1 analogs, the system comprising the culture medium and cells described in the above method.

[0033] In some implementations, the system refers to a drug quality control system, which refers to the use of scientific management methods to control various factors in the drug production process to ensure that the drug quality meets predetermined quality standards and requirements.

[0034] This invention provides a product for distinguishing the bioactivity of GLP-1 analogs, the product comprising the above-described system.

[0035] In some embodiments, the product may be a kit. The kit may also include diluent, luciferase substrate, instructions for use, positive control, negative control, etc.

[0036] The product also includes one or more sterile containers. Such containers may be boxes, ampoules, bottles, tubular vials, tubes, bags, pouches, blister packs, or other suitable container forms known in the art. Such containers may be made of plastic, glass, laminated paper, metal foil, or other materials.

[0037] In some embodiments, the components of the kit may be packaged in an aqueous medium or in a lyophilized form. Suitable containers in the kit typically include at least one vial, test tube, long-necked flask, syringe, or other container in which one component can be placed, and preferably, the component can be suitably aliquoted. When more than one component is present in the kit, the kit will also typically include a second, third, or other additional container in which the additional components are placed separately. However, different combinations of components may be contained in a single vial. The kit of the present invention will also typically include a container for containing the reactants, sealed for commercial sale. Such a container may include injection-molded or blow-molded plastic containers in which the desired vials can be held.

[0038] The invention is further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments described herein are by way of example and are not intended to limit the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention.

[0039] Example I. Experimental Methods 1. Experimental culture medium GLP-1R-luc / 293 cell growth medium: containing 3 μg·mL -1 puromycin, 1000 μg·mL -1 G418, 10% FBS DMEM high glucose medium (purchased from Solarbio, catalog number D8371).

[0040] GIPR-luc / 293 cell growth medium: containing 3 μg / mL -1 puromycin, 6 μg·mL -1 Blastidin S, DMEM high-glucose medium containing 10% FBS.

[0041] GLP1R / GIPR-luc-293 cells (accession number: CGMCC NO.46309) growth medium: containing 200 μg / mL -1 zeocin, 3 μg·mL -1 puromycin, 1000 μg·mL -1 G418, DMEM high-glucose medium containing 10% FBS.

[0042] Detection culture medium: containing 6 mmol·L -1 Serum-free culture medium containing L-glutamine (purchased from ExCell, catalog number HE000-N012).

[0043] 10% FBS medium: DMEM medium containing 10% FBS (DMEM medium was purchased from Solarbio, catalog number D8371; FBS was purchased from Gibco, catalog number A5256701).

[0044] 2. Cell construction and positive cell screening GLP-1R-luc / 293 cell construction and positive cell selection: The GLP-1R gene was constructed into the pLU.cmv.neo vector (purchased from Suzhou Dongling Biotechnology) through the BamHI and SalI cloning sites, and the CRE-miniP gene was constructed into the pLU.CMV.Luc.PGK.PURO vector (purchased from Suzhou Dongling Biotechnology) through the ClaI and XbaI cloning sites. The plasmids were then amplified and purified. Lentiviral viruses were packaged using a viral packaging kit (purchased from Suzhou Dongling Biotechnology) and the pLU-cmv-GLP-1R-neo and pLU-CMV-CRE-Luc-PGK-PURO plasmids, respectively. HEK293T cells (purchased from Suzhou Dongling Biotechnology) were infected with the virus packaged using the pLU-CMV-CRE-Luc-PGK-PURO plasmid. After 3 days of infection, cells were injected with 3 μg / mL... -1 Cells were screened using puromycin (purchased from Gibco) to obtain stably transfected CRE-miniP-luc-HEK293 cells. Lentiviral virus packaged with pLU-cmv-GLP-1R-neo plasmid was added to these cells, and after 3 days of infection, 1000 μg / mL of the virus was injected. -1 Cells were screened using G418 (purchased from Gibco, catalog number 10131035) to obtain stably transfected CRE-miniP-luc-GLP1R-HEK293 cells. Five monoclonal cell lines were obtained through limiting dilution and preserved in our laboratory. Finally, flow cytometry was used to analyze the expression of GLP-1R on the cell surface. Figure 1 The positive rates of GLP1R expression in the five monoclonal cell lines were as follows: D5: 98.9%; D11: 99.1%; E5: 98.1%; E10: 99.2%; G2: 98.2%.

[0045] GIPR-luc / 293 cell construction and positive cell selection: The GIPR gene was constructed into the pLVX-IRES-blast vector (purchased from Sinocare) through the XbaI and BamHI cloning sites, and the CRE-miniP gene was constructed into the pLV-mPuro vector (purchased from Sinocare) through the ApaI and KpnI cloning sites. The plasmids were then amplified and purified, and lentiviruses were packaged using a viral packaging kit (purchased from Sinocare). The viruses packaged using the pLV-CRE-Luc-mPuro plasmid were used to infect 293LT cells (purchased from Suzhou Dongling Biotechnology). After 3 days of infection, 3 μg / mL of the virus was injected into the cells. -1 Cells were screened using puromycin (purchased from Gibco, catalog number A1113803) to obtain stably transfected CRE-miniP-luc-HEK293 cells. Lentiviral virus packaged with pLVX-IRES-GIPR-blast plasmid was added to these cells, and after 3 days of infection, 6 μg / mL of the virus was injected. -1 Cells were screened using Blastidin S (purchased from Solarbio, catalog number B9300) to obtain stably transfected cells CRE-miniP-luc-GLP1R-HEK293. Six monoclonal cell lines were obtained through limiting dilution and preserved in our laboratory. Finally, the expression of GIPR on the cell surface was analyzed by flow cytometry. Figure 2 The positive rates of GLP1R expression in the six monoclonal cell lines were as follows: #17-7: 88.0%; #17-11: 85.2%; #17-17: 68.7%; #17-21: 79.7%; #19-27: 81.2%; #31-53: 90.8%. Cloning #31-53, with the highest positive rate, was selected for subsequent experiments.

[0046]

[0047]

[0048] Sequence of the CRE gene: TGACGTCAGCTGCCAGATCCCATGGCCGTCATACTGTGACGTCTTTCAGACACCCCATTGACGTCA (SEQ ID NO: 3).

[0049] The sequence of the miniP gene is: TAGAGGGTATATAATGGAAGCTCGACTTCCAG (SEQ ID NO:4).

[0050] Sequence of the CRE-miniP gene: TGACGTCAGCTGCCAGATCCCATGGCCGTCATACTGTGACGTCTTTCAGACACCCCATTGACGTCAATGGGAGAACAGATCTGGCCTCGGCGGCCAAGCTTAGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG (SEQ ID NO: 5).

[0051] 3. Cell inoculation Logarithmic growth phase cells (cell confluence rate 50-80%) were removed from the culture medium, washed once with PBS, and digested in a 37°C CO2 incubator for 2-3 min with 1 mL of 0.05% trypsin. The cells were then removed, dispersed using a 1 mL pipette, and added to 5 mL of growth medium containing 10% FBS. The cells were centrifuged at 1000g for 2 min, the supernatant discarded, and the cells resuspended in 15 mL of PBS. After centrifugation at 1000g for 2 min, the PBS discarded, the cells were resuspended in 5 mL of detection medium. Cell density was counted and prepared to a density of approximately 8 × 10⁶ cells / mL using the detection medium. 5 Cell suspension of cells / mL was seeded at 50 µL / well into white 96-well plates, and growth medium was added at 100 µL / well to the outer wells. The plates were then capped and placed in an incubator at 37℃±1℃ and 5%±1% CO2 for later use.

[0052] 4. Sample preparation and drug dosing Take the GLP-1 analog drugs semaglutide (Novo Nordisk registered laboratory sample), liraglutide (Novo Nordisk registered laboratory sample), vepenaenate (PegBio registered laboratory sample), esupragglutide α (Shanghai Yinnuo registered laboratory sample), and GLP-1 synthetic peptide (commissioned by Wuhan Genscript), and dilute them with the detection medium to an initial concentration of 200 nmol·L⁻¹. -1Take this solution and dilute it 6-fold with the test medium, for a total of 9 concentration points (e.g., take a 96-well cell culture plate and add 200 nmol·L⁻¹ to the first column). -1 For each column of the drug, add 250 µL of detection medium to columns 2 through 10. Using a multichannel pipette, perform a sequential 6-fold serial dilution from high to low concentration, pipetting 50 µL of each dilution into the next column of medium (mixing 10 times by pipetting). Remove the plates from the incubator and add 50 μL of the diluted GLP-1 analog drug to each well of the GLP-1R-luc / 293 cell culture plate, changing the pipette tip between each addition. Incubate the plates at 37°C and 5% CO2 for 5–6 hours.

[0053] Take GIP (synthesized by Wuhan Genscript) and telpolide (sample retained by the Eli Lilly registered laboratory), and dilute them separately with test medium to an initial concentration of 1000 nmol·L⁻¹. Take this solution and continue to dilute it 5-fold with test medium, for a total of 9 concentration points (e.g., take a 96-well cell culture plate and add 1000 nmol·L⁻¹ to the first column). -1 For each column of the drug, add 200 µL of detection medium to columns 2 through 10. Using a multichannel pipette, perform a 5-fold serial dilution from high to low concentration, pipetting 50 μL of each dilution into the next column of medium (mixing 10 times by pipetting). Remove the plates from the incubator and add 50 μL of the diluted drug to each well of the GIPR-luc / 293 cell culture plate, changing the pipette tip between each addition. Incubate the plates at 37°C and 5% CO2 for 5–6 hours.

[0054] Take telpolide and HISHS-2001 (synthesized by Wuhan Genscript), and dilute them to an initial concentration of 25 nmol·L⁻¹ using detection medium. -1 Take this solution and dilute it 4-fold with the test medium, for a total of 9 concentration points (e.g., take a 96-well cell culture plate and add 25 nmol·L⁻¹ to the first column). -1 For each column of the drug, add 150 µL of detection medium to columns 2 through 10. Using a multichannel pipette, perform sequential 4-fold serial dilutions from high to low concentrations, pipetting 50 µL of each dilution into the next column of medium (mixing 10 times by pipetting). Remove the plates from the incubator and add 50 μL of the diluted drug to each well of the GLP1R / GIPR-luc-293 cell culture plate, changing the pipette tip between each addition. Incubate the plates at 37°C and 5% CO2 for 5–6 hours.

[0055] 5. Add the test substrate and take the reading. Add 100 µL of luminescent substrate solution (e.g., Britelite plus reporter GeneAssay System, Revvity, 6066769; or equivalent reagent) to all wells and incubate with shaking for 5 minutes at room temperature in the dark. Measure the luminescence intensity using a chemiluminescence microplate reader and record the results.

[0056] II. Experimental Results like Figure 3 As shown in Figure A, the five GLP-1R-luc / 293 cell lines responded differently to semaglutide, with cell D5 showing the highest response value. GLP-1R-luc / 293 cells D5 were selected for subsequent experiments. Semaglutide was diluted to an initial concentration of 100 nmol·L⁻¹. -1 200 nmol·L -1 300 nmol·L -1 Subsequently, 4-fold serial dilutions were performed, resulting in 10 concentration points, to verify the response of cell line D5 to semaglutide. Figure 3 As shown in B, all three initial concentrations reached the plateau on the curve, especially when the initial concentration was 200 nmol·L⁻¹. -1 At that point, the curve had formed a clear upper plateau, but there was only one lower plateau point; therefore, 200 nmol·L⁻¹ was chosen. -1 To further optimize the dilution factor based on the initial concentration, 200 nmol·L⁻¹ was used. -1 The initial concentration of semaglutide was diluted 4-, 5-, and 6-fold, resulting in 10 concentration points for each dilution. When the dilution factor was 6-fold, there were 3 points on both the upper and lower plateaus of the curve, with the linear portion having the most points. Figure 3 C), therefore the optimal starting concentration for the method was determined to be 200 nmol·L⁻¹. -1 The optimal dilution factor was 6-fold. To verify the effect of the drug addition and cell plating interval, smegglutinin was added 0 h, 0.5 h, 1.0 h, and 1.5 h after cell plating, and the cell response was measured. The four curves almost overlapped, indicating that the drug addition and plating interval had no significant effect on the results. Figure 3 D). To verify that serum-free culture methods can also be applied to GIPR-Luc / 293 and GLP1R / GIPR-luc-293 cells, tirzepatide was added to both cell types, and the initial drug concentration was optimized. For example... Figure 4 As shown, the optimal starting concentration of telposide for GIPR-Luc / 293 cell detection is 1000 nmol·L⁻¹. -1 The optimal starting concentration of telposide in GLP1R / GIPR-luc-293 cells is 25 nmol·L⁻¹. -1 .

[0057] To verify the advantages of the serum-free culture medium method for detecting GLP-1 analogue activity, the activities of various drugs were detected using GLP-1R-luc / 293 cells and GLP1R / GIPR-luc-293 cells, respectively. Figure 5 As shown in AB: When tested with a medium containing 10% FBS, liraglutide and smegglutide showed comparable in vitro activities (EC50 values ​​of 0.1682 and 0.1884 nmol·L⁻¹, respectively). -1 The activity (P=0.0678) was higher than that of GLP-1 (EC50 was 0.2212 nmol·L⁻¹). -1 When tested with serum-free medium, semaglutide activity was 1.8 times that of liraglutide (EC50 values ​​were 0.1496 nmol·L⁻¹). -1 and 0.2756 nmol·L -1 (P=0.0025), and the activity of GLP-1 (EC50 was 0.1917 nmol·L⁻¹) was also observed. -1 The activity of smegglutinin was also higher than that of liraglutide, being 1.4 times that of liraglutide (P=0.0747). This indicates that the serum-free medium method can distinguish the activity differences between liraglutide and smegglutinin, and the activity results are more relevant to clinical efficacy. Figure 5 As shown in CD: The activities of PEGylated GLP-1 analog vepenaetin and FC fusion protein long-acting GLP-1 analog esupragutide α were tested in media containing 10% FBS and serum-free medium, respectively. Consistent with expectations, there was no significant difference in the activity of vepenaetin in media containing 10% FBS and serum-free medium, with EC50 values ​​of 0.1228 nmol·L⁻¹. -1 and 0.1299 nmol·L -1 The etanercept α activity showed no significant difference in the two assay media, with EC50 values ​​of 0.0337 nmol·L⁻¹. -1 and 0.04367 nmol·L -1This study also optimized the experimental conditions for detecting the activity of the dual-target agonist Tirzepatide in GLP1R / GIPR-luc-293 cells in serum-free medium, and compared the activities of Tirzepatide and HISHS-2001 (sequence information from the report "Binding kinetics, bias, receptor internalization and effects on insulinsecretion in vitro and in vivo of a novel GLP-1R / GIPR dual agonist, HISHS-2001"). Figure 6 As shown, in a medium containing 10% FBS, the activity of HISHS-2001 was lower than that of Tirzepatide (EC50 was 0.175 nmol·L⁻¹). -1 and 0.080 nmol·L -1 Tirzepatide activity was twice that of HISHS-2001 (P = 0.0137). However, in serum-free medium, the activity of HISHS-2001 was significantly lower than that of Tirzepatide (EC50: 0.0136 nmol·L⁻¹). -1 and 0.0127 nmol·L -1 There was no significant difference (P=0.0821).

[0058] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. A method of detecting / differentiating the biological activity of GLP-1 analogs, characterized in that, The method comprises: diluting the drug using a serum-free medium / 10% FBS medium, detecting after co-culturing with the cells, The GLP-1 analogue comprises one or more of semaglutide, liraglutide, velusetrag, isoxsupraglutide alpha, taspoglutide, HISHS-2001; The distinguishing GLP-1 analogue comprises distinguishing liraglutide from semaglutide and / or distinguishing taspoglutide from HISHS-2001.

2. The method of claim 1, wherein, The cells comprise one or more of GLP-1R-luc / 293 cells, GIPR-Luc / 293 cells, or GLP1R / GIPR-luc-293 cells.

3. The method of claim 1, wherein, The serum-free medium is a serum-free medium containing L-glutamine; Preferably, the 10% FBS medium is a DMEM medium containing 10% FBS.

4. The method of claim 1, wherein, The drug starting concentration for differentiating liraglutide from semaglutide is 100-300 nmol·L -1 ; Preferably, the drug starting concentration at which liraglutide is distinguished from semaglutide is 200 nmol L -1 .

5. The method of claim 1, wherein, The drug dilution factor for distinguishing liraglutide from semaglutide is 4-6-fold dilution; Preferably, the drug dilution factor for distinguishing liraglutide from semaglutide is 6-fold dilution.

6. The method of claim 1, wherein, The drug initial concentration of differentiating telopeptide from HISHS-2001 is 25-100 nmol·L -1 ; Preferably, the drug starting concentration that distinguishes between telopeptides and HISHS-2001 is 25 nmol-L -1 .

7. The method of claim 1, wherein, The drug dilution factor for distinguishing taspoglutide from HISHS-2001 is 4-6-fold dilution; Preferably, the drug dilution factor for distinguishing taspoglutide from HISHS-2001 is 4-fold dilution.

8. The method according to any one of claims 1 to 7, characterized in that, The incubation time of the method is 5-6h.

9. A system for distinguishing between biological activities of GLP-1 analogs, characterized in that, The system comprises the medium, the cells in the method of any one of claims 1-8, The distinguishing GLP-1 analogue comprises distinguishing liraglutide from semaglutide and / or distinguishing taspoglutide from HISHS-2001.

10. A product for distinguishing biological activity of GLP-1 analogs, characterized in that, The product comprises the system of claim 9; Preferably, the product comprises a kit; Preferably, the kit further comprises a luciferase substrate; Preferably, the kit further comprises an instruction manual.

Images