RNA (Ribonucleic Acid) molecular marker for judging early gonad differentiation of young escargots in China and identification method

By detecting the expression levels of gonad-related genes Cchdmrt and Cchfoxl2 in *Viviparus chinensis*, and using qRT-PCR technology to establish discriminant functions |D|>1 or |D|<1, the problem of early sex identification in *Viviparus chinensis* was solved, achieving accurate identification of gonadal differentiation and simplifying sex identification, thus promoting the development of the aquaculture industry.

CN121674568APending Publication Date: 2026-03-17YANCHENG TEACHERS UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511530725.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-24
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify the early sex of the Chinese round snail, especially when the timing of its sex differentiation is not yet clear, and there is a lack of effective early sex identification techniques.

Method used

The expression levels of Cchdmrt and Cchfoxl2 genes related to gonads in Viviparus chinensis were detected by qRT-PCR. The gonadal differentiation status was determined by establishing a discriminant function of the Dmrt1/Foxl2 expression ratio (|D|>1 or |D|<1). The expression differences of Cchdmrt gene associated with males and Cchfoxl2 gene associated with females were utilized.

Benefits of technology

This study enabled accurate identification of early gonadal differentiation in *Viviparus chinensis*, simplified experimental procedures, improved the accuracy and efficiency of sex identification, and promoted the sustainable development of *Viviparus chinensis* farming in China.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674568A_ABST
    Figure CN121674568A_ABST
Patent Text Reader

Abstract

The invention provides an RNA (Ribonucleic Acid) molecular marker for judging early gonad differentiation of young river snails in China and an identification method. Dmrt1 and Foxl2 genes are important genes related to gonad differentiation of river snails. The method comprises the following steps: designing and verifying primers SEQ ID NO: 1-2 according to conserved regions of Dmrt1 and Foxl2 genes; the method comprises the following steps: collecting gonad tissue samples in a young snail stage and a sexual maturity stage, wherein n is greater than or equal to 120, extracting total RNA (Ribonucleic Acid) of a field snail tissue, carrying out reverse transcription to obtain cDNA (Complementary Deoxyribonucleic Acid), detecting a double-gene expression quantity through qRT-PCR (Quantitative Reverse Transcription-Polymerase Chain Reaction), calculating a standardized expression value by taking beta-actin as an internal reference, and establishing a discrimination function D = log2 (Dmrt1 / Foxl2); 1, judging that the juvenile snails of the field snails start gonad differentiation; according to the invention, the problems of deficiency of specific molecular markers for sex differentiation of the young escargots in China and indefinite gonad differentiation time point are solved in a breakthrough manner, accurate locking of the gonad differentiation time of the young escargots is realized, the gonad differentiation time is 15-20 days earlier than morphological differentiation, and verification of more than one hundred of samples shows that the identification accuracy reaches 100%.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of aquatic animals, and particularly relates to an RNA molecular marker for judging early gonadal differentiation of Cipangopaludina chinensis juvenile snails and a method for identifying the same. BACKGROUND

[0002] Cipangopaludina chinensis belongs to Mollusca, Gastropoda, Mesogastropoda, Viviparidae and Cipangopahudina. Cipangopaludina chinensis is widely distributed in East Asia and Southeast Asia, and inhabits various freshwater habitats such as paddy fields, lakes, marshes and rivers, showing excellent environmental adaptability. As an important benthic invertebrate, it plays a key role in the material cycle of the ecosystem and is often regarded as an effective environmental indicator species. Cipangopaludina chinensis is an important economic freshwater shellfish in China, which is delicious, rich in high-quality protein, various trace elements and amino acids needed by the human body, and is deeply loved by consumers; at the same time, it is an important bait for shrimp, crab, leech and fish breeding.

[0003] Cipangopaludina chinensis is a gonochoristic species with a unique ovoviviparous reproductive mode. The antennae of Cipangopaludina chinensis show obvious sexual dimorphism: the left and right antennae of female snails are symmetrical, while the right antenna of male snails gradually thickens and curls during development, and finally transforms into a copulatory organ. The copulatory organ has a genital pore at the end, which serves as a channel for sperm discharge, thereby ensuring the effective reproduction. Based on this obvious morphological difference, the main method for identifying the gender of Cipangopaludina chinensis is to observe the structure of the antenna. In addition, under the condition of dissection, the difference in reproductive organs can also be used for identification: the testis of male snails shows the typical crescent shape of gastropods; mature female snails have ovaries composed of a large number of follicles, and a "uterus" for carrying and hatching embryos. However, there is still a technical gap in the identification of the gender of the early reproductive stage. Since the starting period of gender differentiation of this species has not been determined, the larvae developing in the mother's body lack recognizable sexual dimorphism, making it difficult to distinguish their gender, and there is currently a lack of effective early gender identification technology.

[0004] With the development of molecular biology, qRT-PCR technology has gradually become one of the mainstream methods for quantitative gene expression analysis. It boasts advantages such as high sensitivity, strong specificity, accurate quantification, and high efficiency and speed, enabling the simultaneous detection of multiple gene expression levels within a short time and allowing for relative quantitative analysis of gene expression. By comprehensively analyzing the expression patterns of key gonadal genes at different stages of gonadal differentiation in *Vibrio chinensis*, the critical periods of gonadal differentiation can be accurately identified. This is of great significance for the study of early gonadal differentiation and development in *Vibrio chinensis*, helping to improve the accuracy and efficiency of sex identification, promoting the development of sex control technology, and ultimately driving the sustainable development of *Vibrio chinensis* aquaculture in China. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention provides an RNA molecular marker and identification method related to the genetic sex differentiation of the Chinese round snail.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: This invention first provides the CDS sequences of the Cchdmrt and Cchfoxl2 genes related to gonadal differentiation in the Chinese snail, as follows: >Cchdmrt ATGAATACCTTACACTTTAAGCGCGGGGATCGCAACTTTATCATCATGGCCACTTCTGACATTGTCTTCATCATCATGAC CAGTTCTGACATCATCATGGCCAGTTCTGGCATTGTCTTCATCATCATGGCCAGTTCTGACATTGTCTTCATCATCATGG CCAGTTCTGACATTGTCTTCATCATCATGGCCAGTTCTGACATTGTCTCATGGTCATCTGGCATTGATAATCTTCAGCAT TTGATCCCTTTGCTGCATCGATCCCAGTGCTTCTTGGAGAGGAAAAGGTTATCTTTATTATCATCGTTGCTAAAGTTTAA CTATTGTTTATATTCAGAGCCCGGGAGCCCACTCTTTGCTTATCTAGAAATGTCACTCAGCAGCCCGGAGTCACCAATGT CAGGTCTGAAAGAAAGCAGAAGTGTAGACGCCAACTCATCCCCCTCAGTTCTCAACGAGTGCAGTTGTAGACGCTTGCCGC AATCAAGGTTCACCGGAAGCGGAAGAGGATGATGGCAAGAGAGATGATGTCTTGAACTTTACAAGCATCAATGACTTCAT CAAGGATGATCCCAAAACAACAGATATTGTTCCGTAGCCCTGTCATGCGCAGTCAACAGCTTCTCACTCGAGAAACCAG ATGCAGATGGGTCAATCAGCATCTATAACGTTCGCCATGCCTGCGTACCGGTAACACGACGGAAACAAAGACAGTGCACA TTCTGCAAGCTTCACGGTCTTTCCGCCAGCATCAAAGGTCACAAAACGTTTTGCCAGTTTCGTGAGAACTGCAAGTGTTC GGGCTGCAACTTAATCCGACGAAACCAAATGGTGTCCAAAAAACCAAGTTCGCCTGCGCCGTCAGAAAGAGATGGAAGTGG AACTCTTGCAAATTGGAAGAAATTCTGATGAATCGATAGACCTTCTAGAAGCCACGGTTTCAAGTCAAACGAAACCCTATG TGCTTCAAATGTTGGGTCCACGATAGCATCCGAGTGCGTTTGAAAGGACATAGAACAATTTGCCCCTATGTCCGGTGTGC ATGCGCTAACTGTACACTTAATTGTGACCGGAAACGTCTGAATCGTGAACTACGTCAATTATCTACAGAGTCGCTCAAAA GTGAATGGCTGAAAGGAACAACCCTTACGAGACGTCTCAGTTATAACTAGTGGTTTCCCTTTGGTCCCTCATTCATTC CCTATGACAGCCAGTGACCACCAGCATAATGTTCATTCAGCGATGCTGATGTCCCAGACTCCCATGACGATGTCAGCTAG ATTAAATGGTTCCATAGAAACATCTCCAGTCGGCATTCTGAAGTCGAACAATTGGCATGTGTCTTCCAATCAGCTTTATC CAGCGACTTACGGTATCAAACAGGTGAGTCCTCACTTTTCTGATGAGACAAACACAATCAATGGTCTTCCTTTCTCAATG GCTTCACTCCCCTTTGTGGGTCCTAGCTCTGCCACAACGACAACTCCCGACATGCAACATTCAGCCACCACAATTCCATC GTCTTACGCTTCTGCCATGCCGAGAAGTGCATTCTTCACCAGCATTGCCAGTCGCAGTTCTAACAATAGCTATTTCTATG ACAATCATAGTGGAGGGAATGCTGTCCTTGGTCTCAACAACGGCGAAGGTTACTTTCGGCAGTGGACACCTACTCCGGCC GGAAAGTCCACCCTCAACAACATGGAGCAGACACTGGCTGCCGAATTGCTGAAAGAAACCCACGGCGGATTTCAGTTTCA ACCACATTTGTATTTGCAGAGACAGCCAACGGATCTCTCTTCTAGAACCCAACACTTGGTGTCAGATCACGCTTCTGCAA TTGGTAAAACACGTTTTGGTGTTTTGTCGACACCAGTCATCTGCACTTCAAATCAGTCAATAGCAGTTACGACTGTGCCCAGCCTTTGA(SEQ ID NO:1) >Cchfoxl2 ATGCAGAAGAAAACGTGCTACGTCAACCGTTTGCCACGGTCCTTAAATCCGTTCGGCATCAGTCGTGTCCTTGGCGACGA TTGGAATGCAGAAAGCTCATCTGAGCAGCAGATGACGTTGATGAGGTTGGCAGCTGCAACCTCGCTGTCGACGTCGGTG GCTCCGACGTCTCTTTTAGCCCGTCGTCGTTTGCGGACGAGTCGAGGATCTCCGAGGATCACATTGACTCCGTAGACGAA GGTGACAATAACGTGGAGAGTAAGAGCGATGAAACTTTAGCTGTTCTCGACCAGAGGGACGCGGATATCCGCCATGTTTC TCGCGACACGCGGTACTTGATGACATCCGCGCGTAGTGAAGTTCAACGGGACGATATGCACCCATCGATAAACGACGACG GCTTTGATGATGAAGAAGAAGGGAAAGATGGTTGTAATGACGAAGCAGAACTTGAAGGTAGCGTCATCGATATGTCT AAGAGGAGTTGCGTGAGTGAAGATTCCGGAAAAATGGAAACCGAAGCAGAAGTACCAGGAGAGAGCAAGAGCGATAATAA GGGGAAGAAACTGCAGATGAAGATGACAAAAAAGCGAGAAAACCTCCGTTCTCATACAACGCCCTCATCATGATGGCCA TCCGCAACAGTCCCGAGAGACGGTTGACCTTGAGCCAGATCTATGAGTTCATCGTCAAGAACTTCCCGTACTACCGTGAC AACAAACAAGGGTGGCAGAACTCCATCCGACAACCTTAGCCTCAATAAGTGCTTTCTCAAGGTTCCACGGCATTACGA TGACCCGGGTAAAGGGAATTACTGGATGTTGGACCCTTCGTGCGACGACGTTTTCATCGGCGGCACGACGGGCAAATTGC GACGGCGCTCTTCCTCAGCATCACGTAACCGGCTAGCCGCAATGAAACGAGTAGGGCTTCCGTACCCAGGGTACCCTCAC TTCTACACCCAATCTGACCGCCTGACAGCCTTCCAGTTCGCACTCTCTTCCTCGGGGTACGCGTTCCCGCCGTCTATGCG CGTGGGCGTAGGAGTTGGGTCCAGTTTTGATGGACATCCGATTTCCCTGGCCGCCGCCGCCGCTGCCGCTGCGGCGTCAC ATCATCATTTTCCCGGTCATTTGTTTCCGTCGTCGGCAGGCGGTTCCATGCAGTTTCCTCGAACGACTGGCCTTCTGAGC TTTTCCATCGATAAGCTCCTTGCCACAGACTCCTCGTCACTGGGTAAACACACTAACGTCACCGCCAGCGCATTTACCGG CGTGGCGAACGGTAGGGCAGGTCGAGATTTGGTCAGCACCGGGACTGATTCCGGAGACAAACTTGCAGGTGTCAGCAGAG GAAACGTAAGTCAAACAACGCAGCTGCCGTTCTACCTGTCTCATGCCAACCCCAGCCTTCTCGCCCCGCCGCTCGCCCAT TCGCAGGGTGTTCCGGGCAGTGCTGGAGCGGTGGCGGCTATTAACGAACTGTACAACAGGTTACGGGTGGCTTCGGCTTT CACCTCTTTCCCTTTGTCATCACTGCAAGGAACTCTGTCTGGAGTCGACGGCATGCTGGGTGTGAGTGCCAGGAACTCGC TGCGAGTGGAGCCAAGAACACTTATTACCTCCCCTGATAGTTCCTTCACACCTGTTAGTCCTCAAAACAGGACTTCATAA(SEQ ID NO:2),

[0007] This invention also provides RNA molecular marker primers for the Cchdmrt and Cchfoxl2 genes related to gonad development in the Chinese snail *Viburnum chinense*, as shown below: CCH-Dmrt1F:GTGTAGACGCCAACTCAT (SEQ ID NO: 3); CCH-Dmrt1R: CTCTTGCCATCATCCTCTT (SEQ ID NO: 4); CCH-Foxl2F:GAGTTGCGTGAGTGAAGA (SEQ ID NO: 5); CCH-Foxl2R: GTTGTGTCGGATGGAGTT (SEQ ID NO: 6);

[0008] The principle upon which this invention is based is that the Cchdmrt and Cchfoxl2 genes are closely related to the development of gonads in shellfish, the Dmrt gene family is closely related to testicular development and is stably highly expressed during testicular development, and the Foxl2 gene family is related to ovarian development and is continuously highly expressed during ovarian development.

[0009] Furthermore, the present invention also provides a method for identifying the gonadal differentiation initiation time of *Vibrio chinensis*, comprising the following steps:

[0010] RNA was extracted from juvenile snails and gonads of mature male and female individuals, and the expression levels of the dual genes Cchdmrt and Cchfoxl2 were detected by qRT-PCR based on the molecular marker primers.

[0011] This invention uses β-actin as an internal reference to calculate standardized expression values. Based on the expression levels of Dmrt1 and Foxl2 in the testes and ovaries of juvenile snails and mature snails, a discriminant function D = log2(Dmrt1 / Foxl2) is established to achieve the following: |D|>1, gonads are differentiated; |D|<1, gonads are undifferentiated.

[0012] The beneficial effects of this invention are as follows:

[0013] (1) This invention utilizes qRT-PCR technology, with the expression ratio (logarithmic transformation) of the male-related gene Cchdmrt and the female-related gene Cchfoxl2 in Viviparus chinensis as the core indicator, to achieve specific identification of the critical period of gonadal differentiation. It is not limited by the gonadal development and differentiation time of Viviparus chinensis, and can accurately determine the gonadal differentiation status at each stage of development from fertilized egg to adult.

[0014] (2) In terms of experimental operation, RNA is extracted from the uterus of young snails developing in *Vibrio chinensis*, verified by qRT-PCR, and the expression level is calculated, which can complete the detection. This method is simple, rapid, stable, and accurate. This method is of great significance to the development of genetic breeding work of *Vibrio chinensis*. Attached Figure Description

[0015] Figure 1 This is a flowchart of the experimental process of the present invention; Figure 2 The distribution of Cchdmart and Cchfoxl2 D values ​​in the transcriptome of gonad tissues of *Rhizophora chinensis* juvenile and adult snails in China and by qRT-PCR. Figure 3 The expression levels of Cchdmart and Cchfoxl2 genes in the gonadal tissue of male Viviparus chinensis in China; Figure 4 This image shows the expression levels of the Cchdmart and Cchfoxl2 genes in the gonadal tissue of female *Viburnum chinense*. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0017] The materials used in the following examples are as follows: RNA extraction kit—FreeZol Reagent, purchased from Vazyme, catalog number R711; reverse transcription kit—HisyGo RT Red SuperMix for qPCR (+gDNA Wiper), purchased from Vazyme, catalog number RT101; qRT-PCR kit—SupRealQ Purple Universal SYBR qPCRMaster Mix (U+), purchased from Vazyme, catalog numbers Q412 and Q312; validation primers—Sangon Biotech (Shanghai) Co., Ltd. Example 1

[0018] Sample collection: One hundred juvenile snails were collected from the bodies of mature female *Viviparus chinensis*. Total RNA extraction was performed according to the instructions of the FreeZol Reagent RNA extraction kit purchased from Vazyme, catalog number R711.

[0019] The cDNA system and reaction procedure are as follows: ①Total RNA: 1 μg, 5×gDNA Wiper 3 μl, RNase-free ddH2O to 15 μl, genomic clearance at 42℃ for 2 min; ②Add 4×HisyGo qRT RedSuperMix 5 μl to the reaction tube of ①, reverse transcription reaction at 37℃ for 15 min, and at 85℃ for 5 sec.

[0020] The qRT-PCR reaction system was as follows: 10 μL of 2×ChamQ Blue Universal SYBR qPCR, 0.5 μL each of 10 μM forward and reverse primers, 2 μL of 1 ng / μL cDNA template, and 7 μL of ddH2O.

[0021] The reaction program for qRT-PCR is as follows: pre-denaturation at 95℃ for 30s, followed by 40 cycles, each cycle consisting of denaturation at 95℃ for 10s, annealing at 56℃ for 30s, and extension at 72℃ for 30s.

[0022] Normalized expression values ​​were calculated for qRT-PCR results using β-actin as an internal reference. Among 100 juvenile snails, 38 snails showed high expression of the Dmrt1 gene, while 40 showed low expression. Based on the expression levels in the juvenile snails, analysis using the function D = log2(Dmrt1 / Foxl2) showed that a significant proportion (80%) of the maternal juvenile snail samples exhibited a |D|>1 characteristic, indicating that gonadal differentiation had begun in the maternal uterus. Example 2:

[0023] To further verify the applicability and effectiveness of the molecular marker for sex identification described in this invention, 20 mature Chinese round snails were selected for experimental verification.

[0024] Based on physiological characteristics, ten mature male and ten mature female individuals with a shell height of 23-25 ​​mm and a shell width of 20-23 mm were selected from mature, sexually differentiated Chinese round snails for dissection to obtain ovarian and testicular tissues.

[0025] Testis and ovary tissues from both male and female individuals were collected, and total RNA was extracted using the same method as in Example 1. qRT-PCR experiments were performed on testis and ovary tissues from 20 adult snails, using the same reaction system and procedure as in Example 1.

[0026] Normalized expression values ​​were calculated for qRT-PCR results using β-actin as an internal reference. Results are as follows: Figure 3(Bar chart showing expression levels of Cchdmrt and Cchfoxl2 genes in testes and ovaries) The results indicate that in male snail testes, Cchdmrt is highly expressed, while Cchfoxl2 is lowly expressed. In female snail ovaries, Cchdmrt is lowly expressed, while Cchfoxl2 is highly expressed. The |D| values ​​in both testes and ovaries are greater than 1. The morphological and molecular marker results are consistent.

[0027] The molecular identification results and the histological determination results of mature gonads in this embodiment are consistent, firstly proving that the juvenile snails in the mother's body have begun gonadal differentiation. Secondly, for snail samples from different stages in China, the female-specific molecular markers of this invention can equally ensure the effectiveness of sex identification. Therefore, the method of detecting sex using female-specific molecular markers of this invention is not limited by gonadal morphology and developmental stage, has a wide range of applications, is simple, rapid, stable, and accurate.

[0028] The above description is only a partial embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for identifying a RNA molecular marker related to early gonadal differentiation of juvenile Cipangopaludina c. chinensis, characterized in that: The nucleotide sequences of the conserved regions of the double genes Dmrt1 and Foxl2 are SEQ ID NO: 1-2; ​ Collecting n≥120) of the gonad tissue samples of the juvenile snails and the sexually mature snails, extracting the total RNA of the gonad tissue of the juvenile snails and the sexually mature snails in vivo of the Chinese round snails and reverse transcribing the cDNA, detecting the expression amount of the double genes Dmrt1 and Foxl2 through qRT-PCR, taking β-actin as the internal reference to calculate the standardized expression value, establishing a discriminant function D=log2(Dmrt1 / Foxl2), and determining to enter the differentiation critical period when |D|>1, and the specific steps are as follows: (1) Collecting the gonad tissue samples of the juvenile snails and the sexually mature snails in vivo of the Chinese round snails, extracting the total RNA; (2) Reverse transcribing the total RNA into cDNA; (3) Detecting the expression amount of the double genes Dmrt1 and Foxl2 through qRT-PCR, taking β-actin as the internal reference to calculate the standardized expression value, establishing a discriminant function D=log2(Dmrt1 / Foxl2), and determining to enter the differentiation critical period when |D|>1; The total RNA extraction method is as follows: (1) Taking 0.5g of the testis / ovary tissue of the Chinese round snails, washing the tissue surface with ultrapure water, cutting the tissue into pieces, taking about 20mg of the tissue into a 1.5mL centrifuge tube; (2) Extracting the total RNA through the Trizol method, and storing the extracted RNA in an ultralow-temperature refrigerator at-80℃ for standby use, and the specific operation steps are as follows: 1) Grinding the gonad tissue block on ice in 500μl of the lysis solution RNAiso Plus) to homogenate, and standing at room temperature for 5min; 2) Continuously adding 100μl of Elution buffer into the sample, mixing the sample in the reagent, standing for 15min, and centrifuging in a centrifuge at 4℃ and 12000rpm for 15min, and transferring about 400μl of the upper liquid to a new 1.5mL EP tube; 3) Adding 400μl of isopropanol into the EP tube containing the sample, mixing the original supernatant with the isopropanol, standing at room temperature for 20min, and then centrifuging at 4℃ and 12000rpm for 10min, and discarding the supernatant and leaving the precipitate; 4) Washing the precipitate by adding 1000μl of 75% ethanol, centrifuging at 4℃ and 9000rpm for 3min, discarding the supernatant and leaving the precipitate, and repeating the step twice; 5) Air-drying the precipitate, removing the residual ethanol, adding appropriate RNase-free water according to the amount of the precipitate, detecting the concentration and purity of the RNA through a Nanodrop2000 spectrophotometer, and detecting the integrity of the RNA through 1% agarose gel electrophoresis.

2. The method of claim 1, wherein: The total RNA reverse transcription system and reaction procedure are as follows: ① total RNA: 1 μg, 5×gDNA Wiper 3 μl, RNase-free ddH2O to 15 μl, 42 ℃ for 2 min for genome elimination; ② adding 4×HisyGo qRT Red SuperMix 5 μl to the reaction tube of ①, 37 ℃ for 15 min, 85 ℃ for 5 sec for reverse transcription reaction.

3. The method of claim 1, wherein: The reaction system of the qRT-PCR is as follows: 2×ChamQ Blue Universal SYBR qPCR 10 μL, 10 μM upstream and downstream primers each 0.5 μL, 1 ng / μL cDNA template 2 μL, 7 μL ddH2O, the reaction procedure of the qRT-PCR is as follows: 95 ℃ pre-denaturation for 30 s, then 40 cycles, each cycle including 95 ℃ denaturation for 10 s, 56 ℃ annealing for 30 s, 72 ℃ extension for 30 s, the melting curve analysis step is as follows: 95 ℃ for 15 s, 60 ℃ for 1 min, 95 ℃ for 15 s.

4. A primer pair for identifying the key period of differentiation of the Chinese pond snail's spermiduct based on the quantitative analysis of double gene expression, characterized in that: The upstream primer of the primer pair Dmrt1 is SEQ ID NO: 3, and the downstream primer is SEQ ID NO: 4; the upstream primer of the primer pair Foxl2 is SEQ ID NO: 5, and the downstream primer is SEQ ID NO: 6.